Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6639550.5                      79 END     1           9        1                (no blast hit)
     2   2.0    0Xl3.1-IMAGE:6326537.5                      17 END     2          18       11                (no blast hit)

 This cluster: approximate FL confidence score = 45%

 1012782960 Xl3.1-IMAGE:6859906.5 - 11 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6859906.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCATCGCAAGTTACCGGGCGGTCTCCCCGCCTGTAGCGGCCGCCGCCGCCTCCTCCCTCCCCGCCTGGCCTGGTGCAGCATTGACTGGGAGCAGGTGCTGCTGTTGGAGCCATTGGGTTCCGGAGGCTTCGGCTCAGTCTACCGGGCCACGTATAGAGGGGAGACGGTGGCGCTGAAGAAGGTAAAACGCTCCACCAAGAACAGTTTGGCTTCCCGGCAGAGCTTCTGGGCCGAACTGAACGCAGCCCGACTCCGGCATCCGCATGTGGTGCGAGTAGTGGCCGCCAGCGCCTCCTGCCCCGGGGACCCGGGCTGCCCCGGCACCATCATCATGGAATACACCGGCACCGGAACCCTCCACCAGCGCATATACGGGCGCTCCCCGCCGCTCGGAGCCGATATCTGCATGCGCTATGCCCGACACGTCGCCGACGGACTGCGCTTCCTGCACCGGGACGGGGTGGTGCACCTGGATCTGAAGCCGGCCAATGTGCTGCTCGCCCCGGGGGACCTGTGTAAGATCGGCGACTTCGGCTGCTCTCAGAGGCTGCGCGAGGGGGATGAGGCCGCTGGAGGGGAACCGTGTTGCACCCAACTCCGCCACGTGGGGGGAACCTACACTCACCGAGCCCCGGAGCTGCTCAAGGGAGAGCCCGTCACTGCCAAAGCCGACATCTACTCGTTCGCTATCACCCTGTGGCAGATGGTGAGCCGGGAGCTGCCCTACACCGGGGACCGACAGTGCGTTCTCTATGCGGTAGTGGCCTATGATCTACGGCCGGAGATAGGCCCGTTGTTCAGTCACACGGAGGAAGGCAGAGCCACCAGGACCATTGTGCAGAGCTGCTGGGCTGCGCGACCTCAGGAGAGACCCAATGCCGAGCAACTGCTGGAGAGACTGGAGCAGGAATGTGCCATGTGCACGGGGGGACCTCCGTCCTGCAGCCCTGAATCTAATGCACCCCCTCCTCTCGGCACTGGTCTATAGCGCCCAGAACAGGGAGCCAATCAGCACTGTGCCACAGGACATATAAAGCCAGACCAGCGATCTCATCATTAATGTGTTGGGGGGACACATGCCCAGGGCAGCATCACAGGCTTCCACTCCACTGAATCCCAGCTCAGTCGTGCACTAGTGAGGGAGCATCACTCCTTGTCCTATCCACTTGCCCAGATGATCTGAAATAGTGGCCAGGATCTCTTACATGCCTGGGCCTTGCAATTTGCCCGGCACTATCTTCCTTCTTATCAATTGAAAACTTTAAAGATGAGATGCCATTGGTCGCTTTTTCCTGTGCCTGAGACATTTGGTCTGTGATTTAGACAATGACAATAATGTCAGCGGGGAGAGCTTTGCTTTTGCACGGCCAAACTTTACATTGCTTTAGCCATAGAGGGTTTTTCTGTGTGACTTGTGGCACTCTGTAA
                                                  Xl3.1-CHK-1012694474                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAGTTACCGGGCGGTCTCCCCGCCTGTAGCGGCCGCCGCCGCCTCCTCCCTCCCCGCCTGGCCTGGTGCAGCATTGACTGGGAGCAGGTGCTGCTGTTGGAGCCATTGGGTTCCGGAGGCTTCGGCTCAGTCTACCGGGCCACGTATAGAGGGGAGACGGTGGCGCTGAAGAAGGTAAAACGCTCCACCAAGAACAGTTTGGCTTCCCGGCAGAGCTTCTGGGCCGAACTGAACGCAGCCCGACTCCGGCATCCGCATGTGGTGCGAGTAGTGGCCGCCAGCGCCTCCTGCCCCGGGGACCCGGGCTGCCCCGGCACCATCATCATGGAATACACCGGCACCGGAACCCTCCACCAGCGCATATACGGGCGCTCCCCGCCGCTCGGAGCCGATATCTGCATGCGCTATGCCCGACACGTCGCCGACGGACTGCGCTTCCTGCACCGGGACGGGGTGGTGCACCTGGATCTGAAGCCGGCCAATGTGCTGCTCGCCCCGGGGGACCTGTGTAAGATCGGCGACTTCGGCTGCTCTCAGAGGCTGCGCGAGGGGGATGAGGCCGCTGGAGGGGAACCGTGTTGCACCCAACTCCGCCACGTGGGGGGAACCTACACTCACCGAGCCCCGGAGCTGCTCAAGGGAGAGCCCGTCACTGCCAAAGCCGACATCTACTCGTTCGCTATCACCCTGTGGCAGATGGTGAGCCGGGAGCTGCCCTACACCGGGGACCGACAGTGCGTTCTCTATGCGGTAGTGGCCTATGATCTACGGCCGGAGATAGGCCCGTTGTTCAGTCACACGGAGGAAGGCAGAGCCACCAGGACCATTGTGCAGAGCTGCTGGGCTGCGCGACCTCAGGAGAGACCCAATGCCGAGCAACTGCTGGAGAGACTGGAGCAGGAATGTGCCATGTGCACGGGGGGACCTCCGTCCTGCAGCCCTGAATCTAATGCACCCCCTCCTCTCGGCACTGGTCTATAGCGCCCAGAACAGGGAGCCAATCAGCACTGTGCCACAGGACATATAAAGCCAGACCAGCGATCTCATCATTAATGTGTTGGGGGGACACATGCCCAGGGCAGCATCACAGGCTTCCACTCCACTGAATCCCAGCTCAGTCGTGCACTAGTGAGGGAGCATCACTCCTTGTCCTATCCACTTGCCCAGATGATCTGAAATAGTGGCCAGGATCTCTTACATGCCTGGGCCTTGCAATTTGCCCGGCACTATCTTCCTTCTTATCAATTGAAAACTTTAAAGATGAGATGTCATTGGTCGCTTTTTCCTGTGCCTGAGACATTTGGTCTGTGATTTAGACAATGACAATAATGTCAGCGGGGAGAGCTTTGCTTTTGCACGGCCAAACTTTACATTGCTTTAGCCATAGAGGGTTTTTCTGTGTGACTTGTGGCACTCTGTAACATATA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     3     2     3     2     3     2     3     3     4     3     4     4     4     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     5     6     6     6     6     6     5     6     5     6     5     6     6     7     6     7     6     7     6     7     6     7     6     7     6     7     4     7     6     6     6     6     5     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     4     4     4     3     3     3     3     3     3     3     3     3     3     2     3     3     3     2     3     2     3     2     3     1     2     1     2     1     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     3     4     4     5     4     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---G--------
                                               BLH ATG     -92      71                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Ci ---- 2e-025     NP_001071829.1 mitogen-activated protein kinase kinase kinase [Ciona intestinalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Ce ---- 2e-026     NP_001021445.1 DAP (Death Associated Protein kinase) Like Kinase family member (dlk-1) [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Dm ---- 1e-026     NP_788541.1 CG8789-PC, isoform C [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Os ---- 1e-030     NP_001053834.1 Os04g0610900 [Oryza sativa (japonica cultivar-group)] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 6e-032     XP_647094.1 protein kinase, TKL group [Dictyostelium discoideum AX4] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED = Xt ==== 1e-045     NP_001107441.1 hypothetical protein LOC100135289 [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Sp ---- 4e-048     XP_001192524.1 PREDICTED: similar to Mos [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Dr ---- 4e-072     NP_991143.1 v-mos Moloney murine sarcoma viral oncogene homolog [Danio rerio] -----------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Hs ---- 5e-085     NP_005363.1 v-mos Moloney murine sarcoma viral oncogene homolog; Oncogene MOS, Moloneymurine sarcoma virus [Homo sapiens] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Cf ---- 3e-085     XP_544088.2 PREDICTED: similar to Proto-oncogene serine/threonine-protein kinase mos (c-mos) (Oocyte maturation factor mos) [Canis familiaris] ---------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Mm ---- 3e-085     NP_064405.2 Moloney sarcoma oncogene [Mus musculus] -------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Bt ---- 2e-087     XP_590874.2 PREDICTED: similar to Proto-oncogene serine/threonine-protein kinase mos (c-mos) (Oocyte maturation factor mos) [Bos taurus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Gg ---- 1e-091     NP_001026687.1 v-mos Moloney murine sarcoma viral oncogene homolog [Gallus gallus] ---=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- ?? ---- 0           proto oncogene c-mos [Xenopus sp.]  -------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Xl ---- 0          NP_001081563.1 c-mos oncogene [Xenopus laevis] ---------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6859906.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------TAG---------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------------------------ATG---TGA------------------------------------------------------------------------------------ATG---------------------------------------------TGA---------TGA---TAA------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   2       bld Egg4 5g                IMAGE:3744911-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTCCGTTTCAGCGAGTCACACAGCAATGCCTTCCCCAATCCCCGTGGAGCGTTTCCTGCCGCGGGACCTGTCCCCGTCCATAGACCTGAGGCCATGCAGCAGTCCGCTGGAGCTGAGTCATCGCAAGTTACCGGGCGGTCTCCCCGCCTGTAGCGGCCGCCGCCGCCTCCTCCCTCCCCGCCTGGCCTGGTGCAGCATTGACTGGGAGCAGGTGCTGCTGTTGGAGCCATTGGGTTCCGGAGGCTTCGGCTCAGTCTACCGGGCCACGTATAGAGGGGAGACTGTGGCGCTGAAGAAGGTAAAACGCTCCACCAAGAACAGTTTGGCTTCCCGGCAGAGCTTCTGGGCCGAACTGAACGCAGCCCGACTCCGGCATCCGCATGTGGTGCGAGTAGTGGCCGCCAGCGCCTCCTGCCCCGGGGACCCGGGCTGCCCTGGCACCATCATCATGGAATACACCGGCACCGGAACCCTCCACCAGCGCATATACGGGCGCTCCCCGCCGCTCGGAGCCGATATCTGCATGCGCTATGCCCGACACGTCGCCGACGGACTGCGCTTCCTGCACCGGGACGGGGTGGTGCACCTGGATCTGAAGCCGGCCAATGTGCTGCTCGCCCCGGGGGACCTGTGTAAGATCGGCGACTTCGGCTGCTCTCAGAGGCTCCGCGAGGGGGATGAGGCCGCTGGAGGGGAACCGTGTTGCACCCAAACTCCGCCACGTGGGGGGGAACCTACACTCACCGAGCCCCGGAGCTGCTCAAGGGAGAGCCCCGTCACTGCCAAAGCCGACATCTACTCGTT
  5   1   2       bld Egg4 5x3  out                   IMAGE:3744911.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCGAGTCACACAGCAATGCCTTCCCCAATCCCCGTGGAGCGTTTCCTGCCGCGGGACCTGTCCCCGTCCATAGACCTGAGGCCATGCAGCAGTCCGCTGGAGCTGAGTCATCGCAAGTTACCGGGCGGTCTCCCCGCCTGTAGCGGCCGCCGCCGNCTCCTCCCTCCCCGGCTGGCCCTGGTGCAGCATTGACTGGGAGCAGGTGCTGCTGTTGGAGCCATTGGGTTCCGGAGGCTTCGGCTCAGTCTACCGGGCCACGTATAGAGGGGAGACTGTGGCGCTGAAGAAGGTAAAACGCTCCACCAAGAACAGTTTGGCTTCCCGGCAGAGCTTCTGGGCCGAACTGAACGCAGCCCGACTCCGGCATCCGCATGTGGTGCGAGTAGTGGCCGCCAGCGCCTCCTGCCCCGGGGACCCGGGCTGCCCTGGCACCATCATCATGGAATACACCGGCACCGGAACCCTCCACCAGCGCATATA
  5   1   2       bld Egg6                            IMAGE:4435252.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGTCATCGCAAGTTACCGGGCGGTCTCCCCGCCTGTAGCGGCCGCCGCCGCCTCCTCCCTCCCCGCCTGGCCTGGTGCAGCATTGACTGGGAGCAGGTGCTGCTGTTGGAGCCATTGGGTTCCGGAGGCTTCGGCTCAGTCTACCGGGCCACGTACAGAGGGGAGACGGTGGCGCTGAATAAGGTAAAACGCTCCACCAAGAACAGTTTGGCTTCCCGGCAGATCTTCTGGGCCGAACTGAACGCAGCCCGACTCCGGAATCCGCATGTGGTGCGAGTAGTGGCCGCCAGCGCCTCCTGCCCCGGGGACCCGGGCTGCCCCGGCACCATCATCATGGAATACACCGGCACCGGAACCCTCCACCAGCGCATATACGGGCGCTCCCCGTCGCTCGGGGCCGAGATCTGCATGCGCTATGCCCGACACGTCGCCGACGGACTGCGCTTCCTGCACCGGGACGGGGTGGTGCACCTGCATCTGAAGTCGGCCAATGTGCTGCTCGCCCCGGTGGACCTGTGTAAGATCAGCGACTTCGGCTGCTCTCAGAGGATGCGCGAGGGGGATGAGGCCGCTGGAGGG
  3  -1   2      seed Ov1       out                   IMAGE:8327881.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGCCTCCTCCCTCCCCGCCTGGCCTGGTGCAGCATTGACTGGGAGCAGGTGCTGCTGTTGGAGCCATTGGGTTCCGGAGGCTTCGGCTCAGTCTACCGGGCCACGTACAGAGGGGAGACGGTGGCGCTGAAGAAGGTAAAACGCTCCACCAAGAACAGTTTGGCTTCCCGGCAGAGCTTCTGGGCCGAACTGAACGCAGCCCGACTCCGGCATCCGCATGTGGTGCGAGTAGTGGCCGCCAGCGCCTCCTGCCCCGGGGACCCGGGCTGCCCCGGCACCATCATCATGGAATACACCGGCACCGGAACCCTCCACCAGCGCATATACGGGCGCTCCCCGCCGCTCGGGGCCGAGATCTGCATGCGCTATGCCCGACACGTCGCCGACGGACTGCGCTTCCTGCACCGGGACGGGGTGGTGCACCTGGATCTGAAGCCGGCCAATGTGCTGCTCGCCCCGGGGGACCTGTGTAAGATCGGCGACTTCGGCTGCTCTCAGAGGCTGCGCGAGGGGGATGAGGCCGCTGGAGGGGAACCGTGTTGCACCCAACTCCGCCACGTGGGGGGAACCTACACTCACCGAGCCCCGGAGCTGCTNCAGGGAGAGCCCGTCACTGCCCAAGCCGACATTTACTCGTTTGCTATCACCCTCTGGCAGATGGTGAGCCGG
  3  -1   2       bld Egg3      out                   IMAGE:3377582.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGGGAGCAGGTGCTGCTGTTGGAGCCATTGGGTTCCGGAGGCTTCGGCTCAGTCTACCGGGCCACGTACAGAGGGGAGACGGTGGCGCTGAAGAAGGTAAAACGCTCCACCAAGAACAGTTTGGCTTCCCGGCAGAGCTTCTGGGCCGAACTGAACGCAGCCCGACTCCGGCATCCGCATGTGGTGCGAGTAGTGGCCGCCAGCGCCTCCTGCCCCGGGGACCCGGGCTGCCCCGGCACCATCATCATGGAATACACCGGCACCGGAACCCTCCACCAGCGCATATACGGGCGCTCCCCGCCGCTCGGAGCCGATATCTGCATGCGCTATGCCCGACTTCGGCTGCTCTCAGAGGCTGCGCGAGGGGGATGAGGCCGCTGGAGGGGAACCGTGTTGCACCCAACTCCGCCACGTGGGGGGAACCTACACTCACCGAGCCCCGGAGCTGCTCAAGGGAGAGCCCGTCACT
  5   1   2       bld Oo1                             IMAGE:6859906.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGGCTTCGGCTCAGTCTACCGGGCCACGTATAGAGGGGAGACGGTGGCGCTGAAGAAGGTAAAACGCTCCACCAAGAACAGTTTGGCTTCCCGGCAGAGCTTCTGGGCCGAACTGAACGCAGCCCGACTCCGGCATCCGCATGTGGTGCGAGTAGTGGCCGCCAGCGCCTCCTGCCCCGGGGACCCGGGCTGCCCCGGCACCATCATCATGGAATACACCGGCACCGGAACCCTCCACCAGCGCATATACGGGCGCTCCCCGCCGCTCGGAGCCGATATCTGCATGCGCTATGCCCGACACGTCGCCGACGGACTGCGCTTCCTGCACCGGGACGGGGTGGTGCACCTGGATCTGAAGCCGGCCAATGTGCTGCTCGCCCCGGGGGACCTGTGTAAGATCGGCGACTTCGGCTGCTCTCAGAGGCTGCGCGAGGGGGATGAGGCCGCTGGAGGGGAACCGTGTTGCACCCAACTCCGCCACGTGGGGGGAACCTACACTCACCGAGCCCCGGAGCTGCTCAAGGGAGAGCCCGTCACTGCCAAAGCCGACATCTACTCGTTCGCTATCACCCTGTGGCAGATGGTGAGCCGGGAGCTGCCCTACACCGGGGACCGACAGTGCGTTCTCTATGCGGTAGTGGCCTATGATCTACGGNCGGAGATAGGCCCGGTGTTCAGTCACACGGGAGAAGGCAGAGCCACCANGACCATTTGTGCAGAGCTGCCTGGGCTGCGCGAACCTCAAGAAGAGACCCCAATGCCCGAGCAACCTGCTTGGGAGAAGACTGGGAACAAGGAATGGTGCCATgggggcaccgggggggggACCTTCCGGCCCCTGGCAGCCCCTGGAAATCTAAAGGGGAACCCCCCTTCCTTTTTCGGGGAAACTTGGGTCCTAATAAGCGGCCCCCAGAAACACCGGGGGAAG
  5   1   2       bld Ooc1      in                     Ooc1-db27g01.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGTCGACCCACGCGTCCGACTGAACGCAGCCCGACTCCGGCATCCGCATGTGGTGCGAGTAGTGGCCGCCAGCGCCTCCTGCCCCGGGGACCCGGGCTGCCCCGGCACCATCATCATGGAATACACCGGCACCGGAACCCTCCACCAGCGCATATACGGGCGCTCCCCGCCGCTCGGGGCCGAGATCTGCATGCGCTATGCCCGACACGTCGCCGACGGACTGCGCTTCCTGCACCGGGACGGGGTGGTGCACCTGGATCTGAAGCCGGCCAATGTGCTGCTCGCCCCGGGGGACCTGTGTAAGATCGGCGAATTCGGCTGCTCTCAGAGGCTGCNCGAGGGGGATGAGGCCGCTGGAGGGGAACCGTGTTGCACCCAACTCCGCCACGTGGGGGGAACCTACACTCACCGAGCCCCGGAGCTGCTCAAGGGAGAGCCCGTCACTGCCAAAGCCGACATCTACTCGTTTGCTATCACCCTCTGGCAGATGGTGAGCCGGGAGCTGTCCTACACCGGGGACCGACAGTGCGTTCTCTATGCGGTAGTGGGCTATGATCTACTGACGGAGATGGGCGCTGTGATCAGTCACACGGATGAAGGCAGAGCCGACAGCATCATTGTG
  5   1   2       bld Oo1                             IMAGE:5083924.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGGGACGGGGTGGTGCACCTGGATCTGAAGCCGGCCAATGTGCTGCTCGCCCCGGGGGACCTGTGTAAGATCGGCGACTTCGGCTGCTCTCAGAGGCTGCGCGAGGGGGATGAGGCCGCTGGAGGGGAACCGTGTTGCACCCAACTCCGCCACGTGGGGGGAACCTACACTCACCGAGCCCCGGAGCTGCTCAAGGGAGAGCCCGTCACTGCCAAAGCCGACATCTACTCGTTCGCTATCACCCTGTGGCAGATGGTGAGCCGGGAGCTGCCCTACACCGGGGACCGACAGTGCGTTCTCTATGCGGTAGTGGCCTATGATCTACGGCCGGAGATAGGCCCGTTGTTCAGTCACACGGAGGAAGGCAGAGCCACCAGGACCATTGTGCAGAGCTGCTGGGCTGCGCGACCTCAGGAGAGACCCAATGCCGAGCAACTGCTGGAGAGACTGGAGCAGGAATGTGCCATGTGCACGGGGGGACCTCCGTCCTGCAGCCCTGAATCTAATGCACCCCCTCCTCTCGGCACTGGTCTATAGCGCCCAGAACAGGGAGCCAATCAGCACTGTGCCACAGGACATATAAAGCCAGACCAGCGATCTCATCATTAATGTGTTGGGGGGACACATGCCCAGGGCAGCATCACAGGCTTCCACTCCACTGAATCCCAGCTCAGTCGTGCACTAGTGAGGGAGCATCACTCCTTGTCCTATCCGCTTGCCCAGATGATCTGAAATAGTGGCCAGGATCTCTTACATGCCTGGGCCTTGCAATTTGCCCGGCACTATCTTCCTTCTTATCAATTGAAAACTTTAAAGATGAGATGTCATTGGGTCGCTTTTTCCCTGTGCCTGAGACATTTTGGTCTGTGGATTTAGACAATGGACAAT
  3   1   2       bld Ooc1      in                     Ooc1-db27g01.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCTCAGGAGAGACCCAATGCAGAGCAACTGCTGGAGAGACTGGAGCAGGTATGTCCCATGTGCACGGGGGGACCTCAGTCATGCAGACCTGAATCTAATGCACCCCCTCCTCTCGGCATTGGTCTATAGCGCCCAGAACAGGGAGCCAATCAGCACTGTGCCACAGGACATATAAAGCCAGACCAGCGATCTCATCATTAATGTGCTGGGGGGACACATGCCCAGGGCAGCATCACAGGCTTCCACTCCACTGAATCCCAGCTCAGTCGTGCACTAGTGAGGGAGCATCACTCCTTGTCCTATCCACTTGCCCAGATGATCTGAAATAGTGGCCAGGATCTCTTACATGCCTGGGCCTTGCAATTTGCCCGGCACTATCTTCCTTCTTATCAATTGAAAACTTTAAAGATGAGATGTCATTGGTCGCTTTTTCCTGTGCATGAGACATTTGGTCTGTGATTTAGACAATGACAATAATGTCAGCGGGGAGAGCTTTGCTTTTGCACGGCCAAACTTTACATTGCTTTAGCCATAGAGGGTTTTTGTGTGTGACTTGTGGCACTCTGTAACATATATATACGTTTTGCACTTTTAAAAA
  5  -1   2       bld Egg1                               PBX0076D06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGCACCCCCTCCTCTCGGCACTGGTCTATAGCGCCCAGAACAGGGAGCCAATCAGCACTGTGCCACAGGACATATAAAGCCAGACCAGCGATCTCATCATTAATGTGCTGGGGGGACACATGCCCAGGGCAGCATCACAGGCTTCCACTCCACTGAATCCCAGCTCAGTCGTGCACTAGTGAGGGAGCATCACTCCTTGTCCTATCCACTTGCCCAGATGATCTGAAATAGTGGCCAGGATCTCTTACATGCCTGGGCCTTGCAATTTGCCCGGCACTATCTTCCTTCTTATCAATTGAAAACTTTAAA
  5   1   2      skin Egg1                            IMAGE:4678820.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCACTGGTCTATAGCGCCCAGAACAGGGAGCCAATCAGCACTGTGCCACAGGACATATAAAGCCAGACCAGCGATCTCATCATTAATGTGTTGGGGGGACACATGCCCAGGGCAGCATCACAGGCTTCCACTCCACTGAATCCCAGCTCAGTCGTGCACTAGTGAGGGAGCATCACTCCTTGTCCTATCCGCTTGCCCAGATGATCTGAAATAGTGGCCAGGATCTCTTACATGCCTGGGCCTTGCAATTTGCCCGGCACTATCTTCCTTCTTATCAATTGAAAACTTTAATTATGAGATGCCATTGGTCGCTTTTTCCTGTGCCTGAGACATTTGGTCTGTGATTTAGACAATGACAATAATGTCAGCGGGGAGAGCTTTGCTTTTGCACGGCCAAACTTTACATTGCTTTAGCCATAGAGGGTTTTTCTGTGTGACTTGTGGCACTCTGTAACatatatatatataCGTTTTGCACTTTTCATTGTCTGCTTTCTTTTAATG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)