Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-xl221n06.3                            2 PI      100         1      105                homeobox protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 96%

 1012783148 Xl3.1-IMAGE:4683538-IMAGp.5 - 6 ESTs
                                                                       ....0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:4683538-IMAGp.5     AACGTGGGCTACAGAGAAAATGAGAATAATCTGGGATTTTGATGCCTAAATACTCTGGTGGGCCGCTGAAAATCTCCCAGTGCCCTGGTTTTCTTTAGAGAAAAGACTTTCTGGAACATTTGCCTTTGGAAACACACGGTTTGTGAAGGAGGGACACCATTTCTGGGGAAAATGCAGCAATCTCCATTGGGTTCTCATTTTGTGTTAAGAACTAAGACTGGATGGCAAAGAGATGTGACTCCAGTGACTCACAAGAGGTCGGACCAGGGAGGCCATTGGAGGAGGAACGCCACGTGACAGAGGGGTGCCAATGTTATTCTTTACGGGTGTCAAGACCCTGTCAGTTTGTGAAATAAATATTGGGAAACAACGAAATGCAAAAAGCGACCTACTACGACAGCTCTGCGATCTATGGTGGATATCCCTACCAAGGAGCAAATGGTTTCACTTATAATGCAAGTCAGCAGCAATATCCTCCTTCCTCGTCTCTGCTGGAAAGTGAATATCATCGACCTGCCTGCTCCCTGCAGTCACCTGGTAGCGCGGTGCCCCATCTCAAGGCCAATGACATCAACGAAAGTTGTATGAGAAGCATTAACAGTCAATCAAGCCAAGCCCAGATCATTCCCGAGCAGCAGCCTACACCACAAGGGCCGCCACCCTCTGTGTCCCCACCACAAACCACCAGCAATGCAGCCACAGCCTCCTCCAACAAGGCCACAAGCATCAACTCACCTACCATGTCAAAGAAGATTTTTCCTTGGATGAAAGATTCCCGGCAGAACATAAAACAGAAAGCGGGCAGCTCCAGTTCAG
                                                  Xl3.1-CHK-1012702732           GGCTACAGAGAAAATGAGAATAATCTGGGATTTTGATGCCTAAATACTCTGGTGGGCCGCTGAAAATCTCCCAGTGCCCTGGTTTTCTTTAGAGAAAAGACTTTCTGGAACATTTGCCTTTGGAAACACACGGTTTGTGAAGGAGGGACACCATTTCTGGGGAAAATGCAGCAATCTCCATTGGGTTCTCATTTTGTGTTAAGAACTAAGACTGGATGGCAAAGAGATGTGACTCCAGTGACTCACAAGAGGTCGGACCAGGGAGGCCATTGGAGGAGGAACGCCACGTGACAGAGGGGTGCCAATGTTATTCTTTACGGGTGTCAAGACCCTGTCAGTTTGTGAAATAAATATTGGGAAACAACGAAATGCAAAAAGCGACCTACTACGACAGCTCTGCGATCTATGGTGGATATCCCTACCAAGGAGCAAATGGTTTCACTTATAATGCAAGTCAGCAGCAATATCCTCCTTCCTCGTCTCTGCTGGAAAGTGAATATCATCGACCTGCCTGCTCCCTGCAGTCACCTGGTAGCGCGGTGCCCCATCTCAAGGCCAATGACATCAACGAAAGTTGTATGAGAAGCATTAACAGTCAATCAAGCCAAGCCCAGATCATTCCCGAGCAGCAGCCTACACCACAAGGGCCGCCACCCTCTGTGTCCCCACCACAAACCACCAGCAATGCAGCCACAGCCTCCTCCAACAAGGCCACAAGCATCAACTCACCTACCATGTCAAAGAAGATTTTTCCTTGGATGAAAGATTCCCGGCAGAACATAAAACAGAAAGCxGGxAGCTCCAGTTCAGGTAATC
                                                      consensus depths          2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     4     2     4     2     4     2     4     2     4     2     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     6     6     6     6     6     6     5     6     4     6     4     6     4     6     3     4
                                               BLH ATG     374     525     
                                               BLH MIN     374      46     
                                               BLH MPR     374      46     
                                               BLH OVR     374     850     
                                               CDS MIN     374      46     
                                               ORF LNG     374      19     
                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Dr ==== 4e-029     NP_571192.2 homeo box B3a [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Mm ==== 4e-042     NP_034582.1 homeobox A3 protein [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Hs ==== 2e-043     NP_705895.1 homeobox A3 protein isoform a [Homo sapiens] =================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Bt ==== 1e-043     NP_001070293.1 homeobox A3 [Bos taurus] ==================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Cf ==== 9e-046     XP_539485.2 PREDICTED: similar to homeobox A3 protein isoform a isoform 1 [Canis familiaris] =============================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Gg ==== 5e-055     NP_989879.1 homeodomain protein HOXD-3 [Gallus gallus] ===================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xt ==== 2e-075     NP_001120901.1 homeobox A3 [Xenopus tropicalis] ==========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xl ==== 9e-082     NP_001080293.1 homeo box A3 [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================
                                           Xl3.1-IMAGE:4683538-IMAGp.5                         TGA---TAA------------ATG---------------------------------------------------TAG---------------------------------------------TGA------------------------------------------------------------------TAA------ATG---------------------------------------------------------------------------------------------------------------------------------TAA------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                           [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                    ...
  5   1   2      seed Emb4 5g                IMAGE:4683538-IMAGp.IMAGp GAGGAACGTGGGCTACAGAGAAAATGAGAATAATCTGGGATTTTGATGCCTAAATACTCTGGTGGGCCGCTGAAAATCTCCCAGTGCCCTGGTTTTCTTTAGAGAAAAGACTTTCTGGAACATTTGCCTTTGGAAACACACGGTTTGTGAAGGAGGGACACCATTTCTGGGGAAAATGCAGCAATCTCCATTGGGTTCTCATTTTGTGTTAAGAACTAAGACTGGATGGCAAAGAGATGTGACTCCAGTGACTCACAAGAGGTCGGACCAGGGAGGCCATTGGAGGAGGAACGCCACGTGACAGAGGGGTGCCAATGTTATTCTTTACGGGTGTCAAGACCCTGTCAGTTTGTGAAATAAATATTGGGAAACAACGAAATGCAAAAAGCGACCTACTACGACAGCTCTGCGATCTATGGTGGATATCCCTACCAAGGAGCAAATGGTTTCACTTATAATGCAAGTCAGCAGCAATATCCTCCTTCCTCGTCTCTGCTGGAAAGTGAATATCATCGACCTGCCTGCTCCCTGCAGTCACCTGGTAGCGCGGTGCCCCATCTCAAGGCCAATGACATCAACGAAAGTTGTATGAGAAGCATTAACAGTCAATCAAGCCAAGCCCAGATCATTCCCGAGCAGCAGCCTACACCACAAGGGCCGCCACCCTCTGTGTCCCCACCACAAACCACCAGCAATGCAGCCACAGCCTCCTCCAACAAGGCCACAAGCATCAACTCACCTACCATGTCAAAGAAGATTTTTCCTTGGATGAAAGATTCCCGGCAGAACATAAAACAGAAAGCGGGCAG
  5   1   2       bld Emb4 5g                         IMAGE:4683538.5p     AACGTGGGCTACAGAGAAAATGAGAATAATCTGGGATTTTGATGCCTAAATACTCTGGTGGGCCGCTGAAAATCTCCCAGTGCCCTGGTTTTCTTTAGAGAAAAGACTTTCTGGAACATTTGCCTTTGGAAACACACGGTTTGTGAAGGAGGGACACCATTTCTGGGGAAAATGCAGCAATCTCCATTGGGTTCTCATTTTGTGTTAAGAACTAAGACTGGATGGCAAAGAGATGTGACTCCAGTGACTCACAAGAGGTCGGACCAGGGAGGCCATTGGAGGAGGAACGCCACGTGACAGAGGGGTGCCAATGTTATTCTTTACGGGTGTCAAGACCCTGTCAGTTTGTGAAATAAATATTGGGAAACAACGAAATGCAAAAAGCGACCTACTACGACAGCTCTGCGATCTATGGTGGATATCCCTACCAAGGAGCAAATGGTTTCACTTATAATGCAAGTCAGCAGCAATATCCTCCTTCCTCGTCTCTGCTGGAAAGTGAATATCATCGACCTGCCTGCTCCCTGCAGTCACCTGGTAGCGCGGTGCCCCATCTCAAGGCCAATGACATCAACGAAAGTTGTATGAGAAGCATTAACAGTCAATCAAGCCAAGCCCAGATCATTCCCGAGCAGCAGCCTACACCACAAGGGCCGCCACCCTCTGTGTCCCCACCACAAACCACCAGCAATGCAGCCACAGCCTCCTCCCACAAGGCCACAAGCATCAACTCACCTACCATGTCAAAGAAGATTTTTTCCTTGGATGAAAGATTCCCCGGCCNGAACCTTAAAACAGAAAGCGGGGCAGGCTCCAGTTTCCAGGTGAGAAGCTTGTGCAGGGAGACCAAAAAGccccccccGGGGCCATTTCCT
  5   1   2       bld Neu5 5g                            Neu5-77K7A.5p                                                                                                          TGTGCCTGGTGCTTGGAGGTGATAGCGCAGGAGAAGTGCTGCTTTAGCCACAGCACCTTGCCCAGGAATTAGTTGGAGATCAACCCAGATTTGTTGGTTCTGGAGCCCAACTGGGGTGTAGTGTGTTGTGTTCCGCGTCAGTCGTCAGAAACTAAGGTCGGACCAGGGAGGCCATTGGAGGAGGAACGCCACGTGACAGAGGGGTGCCAATGTTATTCTTTACGGGTGTCAAGACCCTGTCAGTTTGTGAAATAAATATTGGGAAACAACGAAATGCAAAAAGCGACCTACTACGACAGCTCTGCGATCTATGGTGGATATCCCTACCAAGGAGCAAATGGTTTCACTTATAATGCAAGTCAGCAGCAATATCCTCCTTCCTCGTCTCTGCTGGAAAGTGAATATCATCGACCTGCCTGCTCCCTGCAGTCACCTGGTAGCGCGGTGCCCCATCTCAAGGCCAATGACATCAACGAAAGTTGTATGAGAAGCATTAACAGTCAATCAAGCCAAGCCCAGATCATTCCCGAGCAGCAGCCTACACCACAAGGGCCGCCACCCTCTGTGTCCCCACCACAAACCACCAGCAATGCAGCCACAGCCTCCTNCAACAAGGCCACAAGCATCAACTCACCTACCATGTCAAAGAAGATTTTTCCTTGGATGAAAGATTCCCGGCAGAACATAAAACAGAAAGCGGGCAGCTTCAGTTCAAGTGA
  5   1   2       bld Emb9 5x3  out                   IMAGE:7973878.5p                                                                                                                                                                                  CGGATTCCCGGGATGGGAAGGTCTGCTGCACTTATTCAGAATGTGTTTAACTCCAATTTCTGGGCAAATGTGAATTAGCCGGAGGTCGGACCAGGGAGGCCATTGGAGGAGGAACGCCACGTGACAGAGGGGTGCCAATGTTATTCTTTACGGGTGTCAAGACCCTGTCAGTTTGTGAAATAAATATTGGGAAACAACGAAATGCAAAAAGCGACCTACTACGACAGCGCTGCGATCTATGGCGGATATCCCTACCAAGGAGCAAATGGTTTCACTTATAATGCAAGTCAGCAGCAATATCCTCCTTCCTCATCTCTGCTGGAAAGTGAATATCATCGACCTGCCTGCTCCCTGCAGTCACCTGGCAGCGCGGTGCCCCATCTCAAGGCCAATGACATCAATGAAAGTTGTATGAGAAGTATCAGCAGTCAATCAAGTCAAGCCCCGGTCATTCCCGAGCAGCAGCCCACACCACAAGGGCCGCCACCCTCTGTGTCCCCACCACAAACCACCAGCAATGCAGCCACAGCCTCCTCCAACAAGGCCACAGGCATCAACTCACCTACCATGTCAAAGCAGATTTTCCCTTGGATGAAAGAGTCCCGGCAGAACACAAAGCAGAAAGCTGGTAGCTCCAGTTCAGGTAATCTCTTGCCCTGCACGGGCACTGTCAGCTGCAGGGTTATTCAGGNAGTGCACGGGACAGCAGCTGTATGCTTTGCCTGAAAGAGTTAAACTCTACTGGAGGTTTATTTACCATGTCTGCTGAAAGGAGACAGCTATGTGCATCTAGCTCTTGGTGCCAATCTTGTAATATCCTGACAGACTGTACCGTCTGCACTATCGGCGCAAAAGATTATTGTCCC
  5  -1   2      skin Neu7                                 XL047f17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGAATATCATCGACCTGCCTGCTCCCTGCAGTCACCTGGCAGCGCGGTGCCCCATCTCAAGGCCAATGACATCAATGAAAGTTGTATGAGAAGTATCAGCAGTCAATCAAGTCAAGCCCCGGTCATTCCCGAGCAGCAGCCCACACCACAAGGGCCGCCACCCTCTGTGTCCCCACCACAAACCAACAGCAATGCAGCCACAGCCTCCTCCAACAAGGCCACAGGCATCAACTCACCTACCATGTCAAAGCAGATTTTCCCTTGGATGAAAGAGTNCCCGGCAGAACACAAAGCAGAAAGCTGCNNCGTGCCG
  5   1   2       bld Lu1       out                   IMAGE:4057315.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCAACGAAAGTTGTATGAGAAGCATTAACAGTCAATCAAGCCAAGCCCAGATCATTCCCGAGCAGCAGCCTACACCACAAGGGCCGCCACCCTCTGTGTCCCCACCACAAACCACCAGCAATGCAGCCACAGCCTCCTCCAACAAGGCCACAAGCATCAACTCACCTACCATGTCAAAGAAGATTTTTCCTTGGATGAAAGATTCCCGGCAGAACATAAAACAGAAAGCGGGCAGCTCCAGTTCAGGTGAGAGCTGTGCAGGAGACAAAAGCCCCCCGGGGCAATCCTCTTCCAAGAGGGCCCGTACTGCTTACACGAGTGCTCAGCTGGTAGAACTGGAAAAGGAGTTCCACTTTAACAGATACCTGTGCCGACCCCAAAAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)