Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 57%

 1012783371 Xl3.1-IMAGE:8527381.5 - 5 ESTs
                                                                       .........-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8527381.5                                        AATGTCATGTCCCAACAATGTGACTCCTAACTCGTTTTTGATGGACTCGTTGGCCGGTAGCTGCAGAGGAGACAATTATTCCACCAGCCCAGGGATGTATCTGCAGACTGGGAGCGAATTCAGCTGTGGGATGATGAGAAACTGTGGAATTGTCCCGTCTCTTTCCAAAAGGGACGATGTGAATAACCCTGGCTTGTCTCTCAACACCTACCCATCTTACCTTTCTCAACTGGACAATTGGTGTGACCCTAAAAATACTTACAGGATTGAACAACCTGTTGCAAGGCAGCTCTCCTCTTGCTCTTTCCCTACCAATGTCAAGGAGGAAAATGTGTGTTGTATGTACAACACTGATAAAAGAGCGAAAAATGCCACCGAGGCTGCCCTCTACCCAAACCAGATGCCAGAGACTCGCCCAAGTGACCATGAAGTTCCTGTCCCCAGTTACTACCGAGCCACTCAAGGTTACCCAATGGACAAGACCCCCAGCTGTCACAGCACAGGCGACTTTGAGACAAGTTTTGAGAATAGGACGAGTGTTAACGCCAGAAGTGAGATCTTGGAGCAACAACAAGCTGTTGGAAAGGGAGGGTTCCCCGAAAATACCAAGACAGATAACCAGACCCTGGCCCACCACCTTAGCACCAGCTCCAGCTCTTCCAGTGATATAAAGACAGAGAAAAGTCTCTCAGCTCCCCAGCTGCCACCCTCAGAAGGGGA
                                                  Xl3.1-CHK-1012704777                                              ATGTCCCAACAATGTGACTCCTAACTCGTTTTTGATGGACTCGTTGGCCGGTAGCTGCAGAGGAGACAATTATTCCACCAGCCCAGGGATGTATCTGCAGACTGGGAGCGAATTCAGCTGTGGGATGATGAGAAACTGTGGAATTGTCCCGTCTCTTTCCAAAAGGGACGATGTGAATAACCCTGGCTTGTCTCTCAACACCTACCCATCTTACCTTTCTCAACTGGACAATTGGTGTGACCCTAAAAATACTTACAGGATTGAACAACCTGTTGCAAGGCAGCTCTCCTCTTGCTCTTTCCCTACCAATGTCAAGGAGGAAAATGTGTGTTGTATGTACAACACTGATAAAAGAGCGAAAAATGCCACCGAGGCTGCCCTCTACCCAAACCAGATGCCAGAGACTCGCCCAAGTGACCATGAAGTTCCTGTCCCCAGTTACTACCGAGCCACTCAAGGTTACCCAATGGACAAGACCCCCAGCTGTCACAGCACAGGCGACTTTGAGACAAGTTTTGAGAATAGGACGAGTGTTAACGCCAGAAGTGAGATCTTGGAGCAACAACAAGCTGTTGGAAAGGGAGGGTTCCCCGAAAATACCAAGACAGATAACCAGACCCTGGCCCACCACCTTAGCACCAGCTCCAGCTCTTCCAGTGATATAAAGACAGAGAAAAGTCTCCCAGCTCCCCAGCTGCCACCCTCAGAAGGGGACAGGAG
                                                      consensus depths                                             4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     5     5     4     4     4     4     4     4     4     4     4     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3
                                               BLH ATG       4      95                                        
  5   1   2       bld Emb4 5g                         IMAGE:4970594.5p CCACTGGCTGTAGTATTCCTCTTTAAAACCCTGTCTGAAAATGTCATGTCCCAACAATGTGACTCCTAACTCGTTTTTGATGGACTCGTTGGCCGGTAGCTGCAGAGGAGACAATTATTCCACCAGCCCAGGGATGTATCTGCAGACTGGGAGCGAATTCAGCTGTGGGATGATGAGAAACTGTGGAATTGTCCCGTCTCTTTCCAAAAGGGACGATGTGAATAACCCTGGCTTGTCTCTCAACACCTACCCATCTTACCTTTCTCAACTGGACAATTGGTGTGACCCTAAAAATACTTACAGGATTGAACAACCTGTTGCAAGGCAGCTCTCCTCTTGCTCTTTCCCTACCAATGTCAAGGAGGAAAATGTGTGTTGTATGTACAACACTGATAAAAGAGCGAAAAATGCCACCGAGGCTGCCCTCTACCCAAACCAGATGCCAGAGACTCGCCCAAGTGACCATGAAGTTCCTGTCCCCAGTTACTACCGAGCCACTCAAGGTTACCCAATGGACAAGACCCCCAGCTGTCACAGCACAGGCGACTTTGAGACAAGTTTTGAGAATAGGACGAGTGTTAACGCCAGAAGTGAGATCTTGGAGCAACAACAAGCTGTTGGAAAGGGAGGGTTCCNCGAAAATACCAAGACAGATAACCAGACCCTGGCCCACCACCTTAGCACCAGCTCCAGCTCTTCCAGTGATATAAAGACAGAGAANAGTCTCTCAGCTCCCCAGCTGCCACCCTCAGAAGGGGACAGGAGCTCAGCAGAACCAGACACAGCACGACAATCTGACCCGA
  5   1   2       bld Neu5 5g                           Neu5-82N15A.5p                            CCACGCGTCCGAAATGTCATGTCCCAACAATGTGACTCCTAACTCGTTTTTGATGGACTCGTTGGCCGGTAGCTGCAGAGGAGACAATTATTCCACCAGCCCAGGGATGTATCTGCAGACTGGGAGCGAATTCAGCTGTGGGATGATGAGAAACTGTGGAATTGTCCCGTCTCTTTCCAAAAGGGACGATGTGAATAACCCTGGCTTGTCTCTCAACACCTACCCATCTTACCTTTCTCAACTGGACAATTGGTGTGACCCTAAAAATACTTACAGGATTGAACAACCTGTTGCAAGGCAGCTCTCCTCTTGCTCTTTCCCTACCAATGTCAAGGAGGAAAATGTGTGTTGTATGTACAACACTGATAAAAGAGCGAAAAATGCCACCGAGGCTGCCCTCTACCCAAACCAGATGCCAGAGACTCGCCCAAGTGACCATGAAGTTCCTGTCCCCAGTTACTACCGAGCTCTCAAGGTTACCCAATGGACAAGACCCCCAGCTGTCACAGCACAGGCGACTTTGAGACAAAGTTTTGAGAATAGGACAT
  5   1   2       add Emb4 5g                         IMAGE:5542858.5p                              CCACGCGTCCGATGTCATGTCCCAACAATGTGACTCCTAACTCGTTTTTGATGGACTCATTGGCCGGCAGCTGCAGAGGAGACAATTATTCCACCAGCCCAGGGATGTATATGCAGACTGGGAACGAATTCAGCTGTGGGATGATGAGAAACTGTGGAATTGTCCCGTCTCTTTCAAAAAGGGATGATGTGAATAACCCTGGCTTGTCTCTCAACACCTACCCATCTTACCTTTCTCAACTGGACAATTGGTGTGACCCCAAAAATACTTACAGGATTGAACAACCTGTTGCCAGGCAGCTCTCCTCCTGCTCTTTCCCCACCAATGTCAAGGAGGAAAATGTGTGTTGTATGTACAATACTGATAAAAGAGCGAAAAACGCCACCGAGGCTGCCCTCTACCCAAACCAGATGCCAGAGACTCGCCCAAGTGACCATGAAGTTCCTGTCCCCAGTTACTACCGAGCCACTCAAGGTTACCCAATGGACAAGACCCCCAGCTGTCACAGCACTGGCGACTTTGAGACAAGTTATGAGAATAGGACGAGTGTTAACGCCAGAAGTGAGATCTTAGAGCAACAACAAGCTGTGGGGAAAGGGGGGGTTCCCCGAAAATACCAAGACAGATAACCAGTTCCCTGGCCACCAACCTTTAGCACCAAACTCCAGCTTCTGCCCAGTGGATATAAAGAACAGAGAAAAGTCTCCCAAGCTCCCAAGGCTGCCACCCCTCCGGAATGGGGACAAAGNAGGCCCAGGTTAAGAACCCCAGAACCCCCGGCCACCCGAACAATTTCCTGGACCCCCGGAAGCCAAAGAAGAGGGAATTATTAAAGGGGCAAGAAAAAACGCCCTGGCCAGGGGAAAAATTTGGGTCCTGGAACAAGGCTCC
  5   1   2      seed Tbd7 5g                              XL096c19.5p                                  GCTGAAAATGTNATGTCCCAACAATGTGACTCCTAACTCGTTTTTGATGGACTCGTTGGCCGGTAGCTGCAGAGGAGACAATTATTCCACCAGCCCAGGGATGTATCTGCAGACTGGGAGCGAATTCAGCTGTGGGATGATGAGAAACTGTGGAATTGTCCCGTCTCTTTCCAAAAGGGACGATGTGAATAACCCTGGCTTGTCTCTCAACACCTACCCATCTTACCTTTCTCAACTGGACAATTGGTGTGACCCTAAAAATACTTACAGGATTGAACAACCTGTTGCAAGGCAGCTCTCCTCTTGCTCTTTCCCTACCAATGTCAAGGAGGAAAATGTGTGTTGTATGTACAACACTGATAAAAGAGCGAAAAATGCCACCGAGGCTGCCCTCTACCCAAACCAGATGCCAGAGACTCGCCCAAGTGACCATGAAGTTCCTGTCCCCAGTTACTACCGAGCCACTCAAGGTTACCCAATGGACAAGACCCCCAGCTGTCACAGCACAGGCGACTTTGAGACAAGTTTTGAGAATAGGACGAGTGTTAACGCCAGAAGTGAGATCTTGGAGCAACAACAAGCTGTTGGAAAGGGAGGGTT
  5   1   2       bld Int2 5g                         IMAGE:8527381.5p                                      GAAATGTCATGTCCCAACAATGTGACTCCTAACTCGTTTTTGATGGACTCGTTGGCCGGTAGCTGCAGAGGAGACAATTATTCCACCAGCCCAGGGATGTATCTGCAGACTGGGAGCGAATTCAGCTGTGGGATGATGAGAAACTGTGGAATTGTCCCGTCTCTTTCCAAAAGGGACGATGTGAATAACCCTGGCTTGTCTCTCAACACCTACCCATCTTACCTTTCTCAACTGGACAATTGGTGTGACCCTAAAAATACTTACAGGATTGAACAACCTGTTGCAAGGCAGCTCTCCTCCTGCTCTTTCCCTACCAATGTCAAGGAGGAAAATGTGTGTTGTATGTACAACACTGATAAAAGAGCGAAAAATGCCACCGAGGCTGCCCTCTACCCAAACCAGATGCCAGAGACTCGCCCAAGTGACCATGAAGTTCCTGTCCCCAGTTACTACCGAGCCACTCAAGGTTACCCAATGGACAAGACCCCCAGCTGTCACAGCACAGGCGACTTTGAGACAAGTTTTGAGAATAGGACGAGTGTTAACGCCAGAAGTGAGATCTTGGAGCAACAACAAGCTGTTGGAAAGGGAGGGTTCCCCGAAAATACCAAGACAGATAACCAGACCCTGGCCACCAACCTTAGCACCAGCTCCAGCTCTTCCAGTGATATAAAGACAGAGAAAAGTCTCCCAGCTCCCAAGCTGCCACCCTCAGAAGGGGACAAGGAGCTCA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)