Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xl232d19.5                           12 END     3          33       25                Unknown (protein for MGC:181855) [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-xl233p24.3                            7 PI      91        799     1260                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012783691 Xl3.1-XL038c13.3 - 9 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL038c13.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCCAAAAAGCTCCAGTCCACGCAATTACGACTCCGAGGACAGCGAGAGACGGCGAAACCACAACATACTAGAGCGACAAAGGCGCAATGATTTGCGCTCCAGTTTCCTGACTTTAAGGGACCATGTACCAGAACTCATTAAAAATGAGAAAGCCGCTAAAGTCGTCATCCTGAAAAAAGCCACTGAGTATGTTCATTCCCTGCACGCCGACGAACAGAAACTCTTACTGGAAAAAGAGAAACTGCAGCTCCGACAACAACAGTTGCTCAAGAAAATCGAACGCTTGCGGACTTGCTAAACTTTTATTTTCCAATTTCTCTTTTTTTTTTTAAGCTCTTTGCTGTTTTTTTGATATCGTTTGTTCGGTTTTCCTCTCCCTGAACTGTTGATGCCACTTTGCACATTTTTGGATTCTTTTAAGAAGAAGAGAAACATTTTTGACGTTAAGAATGTTGGTTTCATTTCATTCCAGTTAACTCCACAGTTTTGGGGGGCGGGGGAAACGTTGTTTTCTCTCTTGCGTTTTTGAACAACTGGATGATTCTTCGAGGTGTTGAGTAGACTGCCAAAATCATTTACTGTACACTTTTATATGGGTTTTTGTTTTTTTTAAAGACATTTTTTAGTTCTCCCAATCCCCTTAGAAGATTTTTATGCATTATTTCCGAGCTGCTGTTTTTTTTATTCCTCTACATTTTCTTTATGGTGCTCATATTTTTGGTAATGTTACTCCAGAGGACTAGCACTTATTACCTCTGGGTACATTTTTGTAAATACACACTGTTCATGCCATTTGCCTTTTTTTGTACTTATTCTCGGGCTAGCCAGGTAGCCCTCCCCCCACACTTACCAATAATTAGACTGGAAGCTCAGACCTAAGTACTTTAATTACCTCAATGTTTGAGGCGCATGTTTTGTATACAAATATATTGTTAATCTCTCGTTATGTACTGTACTAATTCTTACACTGCCTGTATACTTTAGTATGATCCTGATACATAACTAAATTTGATACTTATATTTTCGTATGAAAATGAGTTGTGAAAGTTTTGAGTAGATATTACTTCATCACTTTTTGAGCTATACACTTTTTTGTAAAGAAAATTATTATGTCTATTCCTTCTTGGTTTTTCTTAGCCTGTTCCTTTCTCGTTTTTTATGTCTTTTTTTTTTGTTCATGTTTCGGGCATAGAACTGGATCATTTCAGAGTTTGTGTGTTTCTGTTTTTTTTCTTTCCTTTTTCTCCTTTCCAAACAATG
                                                  Xl3.1-CHK-1012696974                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGCTCCAGTCCACGCAATTACGACTCCGAGGACAGCGAGAGACGGCGAAACCACAACATACTAGAGCGACAAAGGCGCAATGATTTGCGCTCCAGTTTCCTGACTTTAAGGGACCATGTACCAGAACTCATTAAAAATGAGAAAGCCGCTAAAGTCGTCATCCTGAAAAAAGCCACTGAGTATGTTCATTCCCTGCACGCCGACGAACAGAAACTCTTATTGGAAAAAGAGAAACTGCAGCTCCGACAACAACAGTTGCTCAAGAAAATCGAACGCTTGCGGACTTGCTAAACTTTTxxTTTCCAATTTCTCTTTTTTTTTTTAAGCTCTTTGCTGTTTTTTTGATATCGTTTGTTCGGTTTTCCTCTCCCTGAACTGTTGATGCCACTTTGCACATTTTTGGATTCTTTTAAGAAGAAGAGAAACATTTTTGACGTTAAGAATGTTGGTTTCATTTCATTCCAGTTAACTCCACAGTTTTGGGGGGCGGGGGAAACGTTGTTTTCTCTCTTGCGTTTTTGAACAACTGGATGATTCTTCGAGGTGTTGAGTAGACTGCCAAAATCATTTACTGTACACTTTTATATGGGTTTTTGTTTTTTTTAAAGACATTTTTTAGTTCTCCCAATCCCCTTxxxxxxTTTTTATGCATTATTTCCGAGCTGCTGTTTTTTTTATTCCTCTACATTTTCTTTATGGTGCTCATATTTTTGGTAATGTTACTCCAGAGGACTAGCACTTATTACCTCTGGGTACATTTTTGTAAATACACACTGTTCATGCCATTTGCCTTTTTTTGTACTTATTCTCGGGCTAGCCAGGTAGCCCTCCCCCCACACTTACCAATAATTAGACTGGAAGCTCAGACCTAAGTACTTTAATTACCTCAATGTTTGAGGCGCATGTTTTGTATACAAATATATTGTTAATCTCTCGTTATGTACTGTACTAATTCTTACACTGCCTGTATACTTTAGTATGATCCTGATACATAACTAAATTTGATACTTATATTTTCGTATGAAAATGAGTTGTGAAAGTTTTGAGTAGATATTACTTCATCACTTTTTGAGCTATACACTTTTTTGTAAAGAAAATTATTATGTCTATTCCTTCTTGGTTTTTCTTAGCCTGTTCCTTTCTCGTTTTTTATGTCTTTTTTTTTTGTTCATGTTTCGGGCATAGAACTGGATCATTTCAGAGTTTGTGTGTTTCTGTTTTTTTTCTTTCCTTTTTCTCCTTTCCAAACAATGTACATT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     4     4     2     4     4     4     3     4     3     4     3     4     3     4     3     4     3     4     1     3     1     3     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     4     2     4     3     5     5     6     5     6     5     6     4     5     3     5     4     5     4     5     4     5     4     5     5     6     5     6     5     6     5     6     5     6     5     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     3     4     2     4     3     4     2     4     2     4     2     4     2     4     3     3     2     3     2     3
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Dm ---- 2e-008     NP_649097.1 CG9648-PA [Drosophila melanogaster] --------------------------------============================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ce ---- 2e-009     NP_510223.1 helix Loop Helix containing protein, MAX-like bHLHZip transcription factorBIGMAX (mxl-3) [Caenorhabditis elegans] ================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ci ---- 6e-014     NP_001071767.1 transcription factor protein [Ciona intestinalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Sp ---- 5e-022     NP_999744.1 myc protein [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Bt ---- 6e-025     NP_001039539.1 myc proto-oncogene protein [Bos taurus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 1e-032     NP_997779.1 zgc:85706; v-myc myelocytomatosis viral related oncogene, neuroblastoma derived(avian); wu:fb57a02 [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 3e-042     NP_032735.3 neuroblastoma myc-related oncogene 1 [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 1e-042     NP_005369.2 v-myc myelocytomatosis viral related oncogene, neuroblastoma derived; OncogeneNMYC; v-myc avian myelocytomatosis viral related oncogene, neuroblastoma derived[Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================
                                                                                                                            PREDICTED - ?? ---- 8e-043     XP_874112.3 PREDICTED: similar to N-myc protein [Bos taurus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Cf ---- 4e-043     XP_540091.2 PREDICTED: similar to N-myc proto-oncogene protein [Canis familiaris] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 3e-044     NP_001026262.1 v-myc myelocytomatosis viral related oncogene, neuroblastoma derived [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 3e-047     NP_001006874.1 v-myc myelocytomatosis viral related oncogene, neuroblastoma derived [Xenopus tropicalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 8e-049     AAI67562.1 Unknown (protein for MGC:181855) [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-XL038c13.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAA---------------------------------------------------TGA------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------TGA---------TGA---------------------------------------------------ATG---------------TAA------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------TAG---------------------TAA---------------------------------------------TGA---------------------------------------------------------------------------------ATG---------------TAA---TGA---------------ATG---ATG------------------TAG------------------------------------------------------------------------------------------------------------------------ATG---------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                 ]
  5   1   1       add Emb4                            IMAGE:5514121.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAAACAAATGCTTGACAGTTAAGCATTTATTATTTGGAAATTGACCCAAACTGTTTCTAATCTGGGAGGCTTCTTGGTTAGAACATTCTAGAACTCTCCTAAACTGTGCTGTAATGTCTTGCGctctctctctctctctgatgtagatgatgatgaagatgaggaggaggaggaagaggatgacgaagaggaAGAAATCGACGTGGTCACAGTGGAGAAAAGGCGCAACTCCTCCAACAAATCTGTAACGTCCCTTACAATCACCGTTCGACCTAAGAACACCATCTTGGTGTCCTCGAAGACCGCGCAGAATGAGGTGATCCTCAAGCGATGCGCTCCAGTTCATCAGCAGCACAATTATGCCGCTCCCTCACCGTACGTGGAAACCGAAGAGGTGGCTCCACCTCAAAAGAAGCTGAGGAACGAATTGCCGCGCCTAGTGAAGAACGTGGTGCCAACCAAGCCAAAAAGCTCCAGTCCACGCAATTACGACTCCGAGGACAGCGAGAGACGGCGAAACCACAACATACTAGAGCGACAAAGGCGCAATGATTTGCGCTCCAGTTTCCTGACTTTAAGGGACCATGTACCAGAACTCATTAAAAATGAGAAAGCCGCTAAAGTCGTCATCCTGAANAAAGCCACTGAGTATGTTCATTCCCTGCACGCCGACGAACAGAAACTCTTACTGGANAAAGAAAACTGCAGCTCCCGACACACAGTTTGCTCAGAAATCGAACACTTGCNGACTTTGCTAGCTTTTATTTTCNATTNNCTCttttttttttttAGCC
  5   1   2      skin Egg1                               PBX0157D07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCCAAAAAGCTCCAGTCCTCGCAATTACGACTCTGAGGACAGCGAGAGACGGCGAAACCACAACATACTGGAGCGACAACGGCGCAATGACTTGAGGTCGAGTTTCCTGACGTTAAGGGACCATGTACCAGAACTCATTAAAAACGAGAAAGCCGCTAAAGTCGTCATCCTGAAAAAAGCCACTGACTACGTTCATTCCCTGCATGAGGACGAGCGGAAACTCTTATTGGAAAAAGAGAAACTGCAGCTCCGACAACAACAGTTGCTCAAGAAAATCGAACGCTTGCGGACTTGCTAAACTTTTTCCT
  5   1   1       add Tad2                            IMAGE:6931686.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGGGACCATGTACCAGAACTCATTAAAAATGAGAAAGCCGCTAAAGTCGTCATCCTGAAAAAAGCCACTGAGTATGTTCATTCCCTGCACGCCGACGAACAGAAACTCTTACTGGAAAAAGAAAAACTGCAGCTCCGACAACAACAGTTGCTCAAGAAAATCGAACACTTGCGGACTTGCTAAGCTTTTATTTTCCAATTTCTCtttttttttttAAGCTCTTTGCTGTTTTTTTGATATCGTTTGTTCGGTTTTCCTCTCCCTGAACTGTTGATGCCACTTTGCACATTTTTGGATTCTTTTAAGAAGAAGAGAAACATTTTTGACGTTAAGAATGTTGGTTTCATTTCATTCCAGTTAACTCCACAGTTTTggggggcgggggAAACGTTGTTTTCTCTCTTGCGTTTTTGAACAACTGGATGATTCTTCGAGGTGTTGAGTAGACTGCCAAAATCATTTACTGTACACTTTTATATGGGtttttgttttttttaaagacattttttAGTTCTCCCAATCCCCTTAGAAGATAAGTGGGTTGCAttttttttttttatttggttttgaagctgctgttttttttcattcctctccatttttctttatggtggctctttttttGGTGAATGTTACCGCAAGAGGGACTAGCCCCTTATTTCCCCTCTTGGGTACAAATTTTTGGAAAATAACCCTACTGGTTTCCATGGCCCATTGAAACCtttttttttttttggaaaatttttttCCCCCGGGGGCA
  5   1   2       bld Egg1                               PBX0122E02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCATTCCCTGCATGAGGACGAGCGGAAACTCTTATTGGAAAAAGAGAAACTGCAGCTCCGACAACAACAGTTGCTCAAGAAAATCGAACGCTTGCGGACTTGCTAAACtttttcctgtttttgttctttgccgtttttttttttGATATTGTTCATTTGGTTTTCCTCTCCCGGAACTGTTGATGCCACTTTGCACATTTTTGGATTCTTTAAAAAGAAGAGAAACAGTTTTGACGTTAAGAATGTTGGTTTCATTTCATTCCAGTTAACTCCTCAGCTCTGGGGGGATAAACAATGGTGTTTTCTCTCCTTGAGTTTTTGAACAACTGGATGATGCTTAGAGGTTTTGATTAGACTGCCAAAATCATTTACTGTACActtttatatggtttttgttttttaacgtaaaccttttttGTTCTCCTAAACCCTTAAAAGATAAGAGGAGGGTCGCATTTTTTATGCATTATTTCCGAGCTGCTGttttttttATTCCTCTACATTTTCTTTATGGTGCTCATATTTTTG
  3   1   2       bld Neu7      out                        XL038c13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTCGCATTTTTTATGCATTATTTCCGAGCTGCTGTTTTTTTTATTCCTCTACATTTTCTTTATGGTGCTCATATTTTTGGTAATGTTACTCCANAGGACTAGCACTTATTACCTNTGGGTACATTTTTGTAAATACACACTGTTCATGCCATTTGCCTTTTTTTGTACTTATTCTCGGGCTAGCCAGGTAGCCCTCCCCCCACACTTACCAATAATTAGACTGGAAGCTCAGACCTAAGTACTTTAATTACCTCAATGTTTNAGGCGCATGTTTTGTATACAAATATATTGTTAATCTCTCGTTATGTACTGTACTAATTCTTACACTGCCTGTATACTTTAGTATGATCCTGATACATAACTAAATTTGATACTTATATTTTCGTATGAAAATGAGTTGTGAAAGTTTTGAGTAGATATTACTTCATCACTTTTTGAGCTANACACTTTTTTGTAAAGAAAATTATTATGTCTATTCCTTCTTGGTTTTTCTTAGCCTGNTCCNTTCTCGTTTTTTATGTCnTTTTTTTTTGTTCATGTTTCGGGCATAGAACTGGATCATTTCAGAGTTTGTGTGTTTCTGTTTTTTTTCTTTCCTTTTTCTCCTTTCCAAACAATGTACATTTTTAGTGNCTTTATCTATTAGCACTTTAAATACCTCA
  3   1   2       bld Tbd7      out                        XL059i23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCGCATTTTTTATGCATTATTTCCGAGCTGCTGTTTTTTTATTCCTCTACATTTTCTTTATGGTGCTCATATTTTTGGTAATGTTACTCCAGAGGACTAGCACTTATTACCTCTGGGTACATTTTTGTAAATACACACTGTTCATGCCATTTGCCTTTTTTTGTACTTATTCTCGGGCTAGCCAGGTAGCCCTCCCCCCACACTTACCAATAATTAGACTGGAAGCTCAGACCTAAGTACTTTAATTACCTCAATGTTTGAGGCGCATGTTTTGTATACAAATATATTGTTAATCTCTCGTTATGTACTGTACTAATTCTTACACTGCCTGTATACTTTAGTATGATCCTGATACATAACTAAATTTGATACTTATATTTTCGTATGAAAATGAGTTGTGAAAGTTTTGAGTAGATATTACTTCATCACTTTTTGAGCTATACACTTTTTTGTAAAGAAAATTATTATGTCTATTCCTTCTTGGTTTTTCTTAGCCTGTTCCTTTCTCGTTTTTTATGTCTTTTTTTTTGTTCATGTTTCGGGCATAGAACTGGATCATTTCAGAGTTTGTGTGTTTCTGTTTTTTTTCTTTCCTTTTTCTCCTTTCCAAACAATGTACATTTTTAGTGNCTNTATNCTATTAGCACTNTCNAATACCTCA
  5   1   2      seed Egg1                               PBX0021A07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCGAATCtttttttttATTCCTCTACATTTTCTTTATGGTGCTCATATTTTTGGTAATGTTACTCCACAGGACTAGCACTTATTACCTCTGGGTACATTTTTGTAAATACACACTGTTCATGCCATTTGCCTTTTTTTGTACTTATTCTCGGGCTAGCCAGGTAGCCCTCCCCCCACACTTACCAATAATTAGACTGGAAGCTCAGACCTAAGTACTTTAATTACCTCAATGTTTGAGGCGCATGTTTTGTATACAAATATATTGTTAATCTCTCGTTATGTACTGTACTAATTCTTACACTGCCTGTATACTTTAGTATGATCCTGATACATAACTAAATTTGATACTTATATTTTCGTATGAAAATGAGTTGTGAAAGTTTTGAGTAGATATTACTTCATCACTTTTTGAGCTATACACTTTTTTGTAAAGAAAATTATTATGTCTAT
  5   1   2       bld Egg1                               PBX0024A07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTTATTCCTCTACATTATCTTTATGGTGCTCATATTTTTGGTAATGTTACTCCAGAGGACTAGCACTTATTACCTCTGGGTACATTTTTGTAAATACACACTGTTCATGCCATTTGCCTTTTTTTGTACTTATTCTCGGGCTAGCCAGGTAGCCCTCCCCCCACACTTACCAATAATTAGACTGGAAGCTCAGACCTAAGTACTTTAATTACCTCAATGTTTGAGGCGCATGTTTTGTATACAAATATATTGTTAATCTCTCGTTATGTACTGTACTAATTCTTACACTGCCTGTATACTTTAGTATGATCCTGATACATAACTAAATTTGATACTTATATTTTCGTATGAAAATGAGTTGTGAAAGTTTTGAGTAGATATTACTTCATCACTTTTTGAGCTATACACTTTTTTGTAAAGAAAATTATTATGTCTATTCCTTCTTGGTTTTTCTTAGCCTGTTCCTTTCTCGTTTCTTATGTCtttttttttttgttcatgtttcgggcatagaactggatcatgaaaaagaaaaaaaaGATTC
  3   1   2       bld Tbd7      out                        XL082l20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTCATGCCATTTGCCTTTTTTTGTACTTATTCTCGGGCTAGCCAGGTAGCCCTCCCCCCACACTTACCAATAATTAGACTGGAAGCTCAGACCTAAGTACTTTAATTACCTCAATGTTTGAGGCGCATGTTTTGTANACAAATANATTGTTAATCTCTCGTTATGTACTGNACTAATTCTAACNCTGCCTGTATACTTTAGTATGATCCTGATACATAACTAAATTTGATACTTATATTTTCGTATGAAAATGAGTTGTGAAAGTTTTGAGTAGATATTACTTCATCACTTTTTGAGCTATACACTTTTTTGTAAAGAAAATTATTATGTCTATTCCTTCTTGGTTTTTCTTAGCCTGNTCCTTTCTCGTTTTTTAnGTCTTTTTTTTTTGTTCATGTTTCGGGCATAGAACTGGATCATTTCAGAGTTTGTGTGTTTCTGTTTTTTTTCTTTCCTTTTTCTCCTTTCCAAACAATGTACATTTTTAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)