Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   0.0    0Xl3.1-xl307d09.5                            7 END     1          12       14                (no blast hit)
     2   2.0    0Xl3.1-IMAGE:5084120.5                       6 END     1          12       16                hypothetical protein LOC100158527 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012783943 Xl3.1-xl260l09.5 - 8 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl260l09.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAAGCCCAGCTCCAAAGCCAGAACTTCGCATTGGAGAGAAGAAATTAACTCCAACGAAAACAGAAGAGAAAGATGAAAAGCCATTGTTGGACCTTAAACCTCCCAAACCCGCAGCTCCTCAGGTACCACCGAAGAAACCAAGTCTTGTAAGCAAAAGTAACAGCCTCCTAAAACCAGCAGTAATCCCTCCCAAGCGTCCAGAAAAGCCGGCCTTTCCTTCACCAACCTCCAAGCCTAATGGAGATTTACTTCTCATCCGCCCCAAGCCAGAATCAGAGACTCTTAATAAGGCAAAGACAGAGCTGGACCAACAGGTTCTAAGTCGACCAAAGTCGACAGAAGCGGAACTACATAATAAAGCGAAAACGGACCTCGAACAGATCCTGAGCCGACCAAAATCAGAAGTGGAACCTCATAGTAAGACAAAAACTGATCTGGAACAGATTCTGAACAAGCCAAAGTCAGAGGCGGAACCTCTTAATAAAACGAAGATGGATCTAGAACAGATCCTGAGCAGACCAAAGTCCAACGGGGAACAACATAACAAAACAAAGATGGACCTGGAACATATTCTGAGCAGAACGAAGTCAGTGGAAGTAGAGCCGGCAGCTAAAAGCCCCAGAGACGAGGTGGACTTTTTTGGGGATGTCATACCTACCTCAAACCATTTATCCCACCCAACTGCGAACAGACCAAAGATGCAAGGGAAGAGGCTACCTGGTCGCTTTAATGGACCCAACGCTCAAAGCAAAGATTTAACAGATTCTGTCAAAGTGCTTAAAGAAGAGGAGAATGAAAGTGCCAAAGTAAAGACACCTGAAGTCAAAAAGCCATTGGCTCCCAGCATTGGTACATCTCCACTCCCGGGCTTTATTCCCGGGTGTCAAAACCCGCCCCCCCCGCCGGTCCCATTACCTACTGAGCTGGAGGCGAAATCAGATGTGACCGACAGTAAGAGGAGTGAAAAGAGTGAAATGGACGACCTTAAAGCCCAAACCTTTAAAGCCCTCAGCATTGTGCATGCACTTAGAAAAGAACATAGGAAAGAGATGGATCACCTAAAGAAACANTTAGACGAGGAACGATTGCTACGGACCCATTTAGAGACCGAGGTTGACAAGCTGAAGAAGGCGGTCCAGTTAACATGAGGC
                                                  Xl3.1-CHK-1012698115                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAGCTCCAAAGCCAGAACTTCGCATTGGAGAGAAGAAATTAACTCCAACGAAAACAGAAGAGAAAGATGAAAAGCCATTGTTGGACCTTAAACCTCCCAAACCCGCAGCTCCTCAGGTACCACCGAAGAAACCAAGTCTTGTAAGCAAAAGTAACAGCCTCCTAAAACCAGCAGTAATCCCTCCCAAGCGTCCAGAAAAGCCGGCCTTTCCTTCACCAACCTCCAAGCCTAATGGAGATTTACTTCTCATCCGCCCCAAGCCAGAATCAGAGACTCTTAATAAGGCAAAGACAGAGCTGGACCAACAGGTTCTAAGTCGACCAAAGTCGACAGAAGCGGAACTACATAATAAAGCGAAAACGGACCTCGAACAGATCCTGAGCCGACCAAAATCAGAAGTGGAACCTCATAGTAAGACAAAAACTGATCTGGAACAGATTCTGAACAAGCCAAAGTCAGAGGCGGAACCTCTTAATAAAACGAAGATGGATCTAGAACAGATCCTGAGCAGACCAAAGTCCAACGGGGAACAACATAACAAAACAAAGATGGACCTGGAACATATTCTGAGCAGAACGAAGTCAGTGGAAGTAGAGCCGGCAGCTAAAAGCCCCAGAGACGAGGTGGACTTTTTTGGGGATGTCATACCTACCTCAAACCATTTATCCCACCCAACTGCGAACAGACCAAAGATGCAAGGGAAGAGGCTACCTGGTCGCTTTAATGGACCCAACGCTCAAAGCAAAGATTTAACAGATTCTGTCAAAGTGCTTAAAGAAGAGGAGAATGAAAGTGCCAAAGTAAAGACACCTGAAGTCAAAAAGCCATTGGCTCCCAGCATTGGTACATCTCCACTCCCGGGCTTTATTCCCGGGTxxxAAxxCxCxCCCCCCxxxCCGGTCCCATTACCTACTGAGxxGxAxGCGAAAxxxxAxGTGACCGACAGTAAGAGGAGTGAAAAGAGTGAAATGGACGACCTTAAAGCCCAAAxxxxTAAAGCCCxxAxxATTGTGCATGCACTTAGAAAAGAACATAGGAAAGAGATGGATCACCTAAAGAAAxAGTTAGACGAGGAACGATTGTTACGGACCCATTTAGAGACCGAGGTTGACAAGCTGAAGAAGGCGGTCCAGTTAACATGAGGCGGCCAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     5     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     3     3     3     3     2     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     3     1     1     2     2     1     1     1     1     2     2     3     3     3     3     2     2     2     2
                                                                       ...PREDICTED - Sp ---- 6e-007     XP_001179106.1 PREDICTED: similar to UNC-89 [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 8e-008     NP_652705.2 sallimus CG1915-PC, isoform C [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Os ---- 4e-008     NP_001054961.1 Os05g0225800 [Oryza sativa (japonica cultivar-group)] --------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 4e-009     NP_001020990.1 UNCoordinated family member (unc-89) [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Bt ---- 7e-014     NP_001121972.1 SH3-domain kinase binding protein 1 [Bos taurus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 8e-016     NP_001025976.1 SH3-domain kinase binding protein 1 [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                        PROTEIN --- Dr ---- 3e-020     NP_001008583.2 CD2-associated protein [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 3e-038     XP_612512.4 PREDICTED: CD2-associated protein, partial [Bos taurus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 2e-041     NP_036252.1 CD2-associated protein [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 6e-042     NP_033977.3 CD2-associated protein [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 9e-043     XP_532162.2 PREDICTED: similar to CD2-associated protein [Canis familiaris] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Xt ---- 2e-179     NP_001121435.1 hypothetical protein LOC100158527 [Xenopus tropicalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Xl ---- 0          NP_001086432.1 hypothetical protein LOC445851 [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-xl260l09.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATG------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                    ]
  3   1   2       bld Tad1      out                   IMAGE:6879586.3p                                                                                                                                                                                                                                                                                                                                                                                                TTTATTGCCAATAAAATGTAAGTGGATTAAGAATATTATCGCTAGTATGGGGAAAGTACACCTGGGTCTATTGGGCTGTGGAATGCGTCTCGTTCAAGTAGAATGTGAATCCCTGGATTGGCCTTCCCGCCATTTTAAGCGCGACAGGTTGGATTCACAAAAGAAGGGGTTCTTGTGGTTATTGTGGCTTTAGGGGTAACATTTTCTAAAAGAAAGGGGTTCGTGGGGAAACTTCAAGGGAGTTAGAATTTCCCAGGCGCCCTGAGGCCCAGAAGTGAAAAAAAGCCCAGAAAAAGGCCATTGGCCAGTTTCAGGCCATCAAGGTAGCAATGGTTTTTGGGGTCAACCAAGTTCGGATGGTTTCAAGAACGGGGACAGACAGCAAACGAAAAGTTAAGGAGATGTGCAGAGCCCTGTTTAACTATGAATCTGTGAACGAGGATGAACTTTCTTTTAAGGAAGGGGATATTATTTGCCTCACTAGTAAAGATACTGGTGACCCAGGCTGGTGGAAAGGAGAACTGAATGGTAAGGAAGGCGTTTTCCCCGACAACTTTGTTGCTCTAATACAAGAGTCCGAAAAAGAGAAGCCGAGGAAACCTCCGCCTCCCATTAAAAGCCCAGCAGCACCAAAGCCAGAACTTCGCATCGGAGAGAGAAAATTAACTCCAGTAAAAACAGAAGAGAAAGATGAAAAGCCATTGTTGGACCTTAAACCTCCCAAACCTGCAGCTCCTCAGGTACCACCAAAGAAACCAAGTTTTGCAAGCAAGAGTAATAGTCTCCTGAAACCAGCAGTGATCCCTCCCAAGCGTCCAGAAAAGCCGGCCTTTGCATCACCAACCTCCAAGCCTAATGGAGATTTACTGTTTAGTCGCCCCAGGCCAGAATCAGAAGCTCTTAATAAGGCAAAGACAGAGCTGGACCAGCAGGTTCTAAGTCGACCAAAATCAGCAGAAGCATAACCCCTTTTTTTGAAAACCCTGACATGGTTATTCATTTCTTTTCTTTGGTGTTTGGTGTGTGTTTGAGGTTGGCT
  5   1   2       bld Ga15      in                       XL423c24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGCGACCCAGGCTGGTGGAAAGGAGAATTTAATGGGAAGGAAGGCGTTTTCCCCGACAACTTTGTGGCAATAATACAAGACTCTGAAAAAGAGAAGCCAAGGAAACCTCCGCCTCCCATTAAAAGCCCAGCTCCAAAGCCAGAACTTCGCATTGGAGAGAAGAAATTAACTCCAACGAAAACAGAAGAGAAAGATGAAAAGCCATTGTTGGACCTTAAACCTCCCAAACCCGCAGCTCCTCAGGTACCACCGAAGAAACCAAGTCTTGTAAGCAAAAGTAACAGCCTCCTAAAACCAGCAGTAATCCCTCCCAAGCGTCCAGAAAAGCCGGCCTTTCCTTCACCAACCTCCAAGCCTAATGGAGATTTACTTCTCATCCGCCCCAAGCCAGAATCAGAGACTCTTAATAAGGCAAAGACAGAGCTGGACCAACAGGTTCTAAGTCGACCAAAGTCGACAGAAGCGGAACTACATTATAAAGCGAAAACGGACCTCGAACAGATCCTGAGCCGACCAAAATCAGAAGTGGAACCTCATAGTAAGACAAAAACTGATCTGGAACAGATTCTGAACAAGCCAAAGTCAGAGGCGGAACCTCTTAATAAAACGAAGATGGATCTAGAACAGATCCTGAGCAGACCAAAGTCCAACGGGGAACAACATAACAAAACAAAGATGGACCTGGAACATATTCTGAGCAGAACGAAGTCAGTGGAAGT
  5   1   2      seed DMZ       in                         xl260l09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAAGCCCAGCTCCAAAGCCAGAACTTCGCATTGGAGAGAAGAAATTAACTCCAACGAAAACAGAAGAGAAAGATGAAAAGCCATTGTTGGACCTTAAACCTCCCAAACCCGCAGCTCCTCAGGTACCACCGAAGAAACCAAGTCTTGTAAGCAAAAGTAACAGCCTCCTAAAACCAGCAGTAATCCCTCCCAAGCGTCCAGAAAAGCCGGCCTTTCCTTCACCAACCTCCAAGCCTAATGGAGATTTACTTCTCATCCGCCCCAAGCCAGAATCAGAGACTCTTAATAAGGCAAAGACAGAGCTGGACCAACAGGTTCTAAGTCGACCAAAGTCGACAGAAGCGGAACTACATAATAAAGCGAAAACGGACCTCGAACAGATCCTGAGCCGACCAAAATCAGAAGTGGAACCTCATAGTAAGACAAAAACTGATCTGGAACAGATTCTGAACAAGCCAAAGTCAGAGGCGGAACCTCTTAATAAAACGAAGATGGATCTAGAACAGATCCTGAGCAGACCAAAGTCCAACGGGGAACAACATAACAAAACAAAGATGGACCTGGAACATATTCTGAGCAGAACGAAGTCAGTGGAAGTAGAGCCGGCAGCTAAAAGCCCCAGAG
  5   1   2       bld Ga12                                 XL194b01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGAAGAGAAAGATGAAAAGCCATTGTTGGACCTTAAACCTCCCAAACCCGCAGCTCCTCAGGTACCACCGAAGAAACCAAGTCTTGTAAGCAAAAGTAACAGCCTCCTAAAACCAGCAGTAATCCCTCCCAAGCGTCCAGAAAAGCCGGCCTTTCCTTCACCAACCTCCAAGCCTAATGGAGATTTACTTCTCATCCGCCCCAAGCCAGAATCAGAGACTCTTAATAAGGCAAAGACAGAGCTGGACCAACAGGTTCTAAGTCGACCAAAGTCGACAGAAGCGGAACTACATAATAAAGCGAAAACGGACCTCGAACAGATCCTGAGCCGACCAAAATCAGAAGTGGAACCTCATAGTAAGACAAAAACTGATCTGGAACAGATTCTGAACAAGCCAAAGTCAGAGGCGGAACCTCTTAATAANACGAAGATGGATCTAGAACAGATCCTGAGCAGACCAAAGTCCAACGGGGAACAACATAACAAAACAAAGATGGACCTGGAACATATTCTGAGCAGAACGAAGTCAGTGGAAGTAGAGCCGGCAGCTAAAAGCCCCAGAGACGAGGTGGACTTTTTTGGGGATGCGATACCTACCTCAAACCATTTATCCCACCCAACTGCGAACA
  5   1   2       bld Emb1                            IMAGE:6865748.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAACCTCCAAGCCTAATGGAGATTGGCTGTCTCATCCGCCCCAAGCCAGAATCAGAGACTCTTAATAAGGCAAAGACAGAGCTGGACCAACAGGTTATAAGTCGACCAAAGTCGACAGAAGCGGAACTACATAATAAAGCGAAAACGGACCTCGAACAGATCCTGAGCCGACCAAAATCAGAAGTGGAACCTCATAGTAAGACAAAAACTGATCTGGAACAGATTCTGAACAAGCCAAAGTCAGAGGCGGAACCTCTTAATAAAACGAAGATGGATCTAGAACAGATCCTGAGCAGACCAAAGTCCAACGGGGAACAACATAACAAAACAAAGATGGACCTGGAACATATTCTGAGCAGAACGAAGTCAGTGGAAGTAGAGCCGGCAGCTAAAAGCCCCAGAGACGAGGTGGACTTTTTTGGGGATGTCATACCTACCTCAAACCATTTATCCCACCCAACTGCGAACAGACCAAAGATGCAAGGGAAGAGGCTACCTGGTCGCTTTAATGGACCCAACGCTCAAAGCAAAGATTTAACAGATTCTGTCAAAGTGCTTAAAGAAGAGGAGAATGAAAGTGCCAAAGTAAAGACACCTGAAGTCAAAAAGCCATTGGGTCCCAGCATTGGTACATCTCCACTCCCGGGCTTTATTCCCGGGTGTCAAAACCCGCCCCCCAGTCCGCCGGGTCCCCTTTACCTACTGGAGGCGAAAGTGAAAATCGGATGCGAACCGGACGGTAGGAAGGAGTGGAAAAGGAGGGGAAATGGAAGGACCTTTAAAGCCCCAAAATAAAGTGGAACCTGGCTCAAGAATTGGGGGCATGGCA
  3   1   2       add DMZ       in                         xl260l09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGTCNGAGGCGGAACCTCTTAATNAAANGAAGATGGATCTAGAACAGATCCTGAGCAGACCAAAGTCCAACGGGGAACNACATNACAAAACAAAGATGGACCTGGAACATATTCTGAGCAGAACGAAGTCAGTGGAAGTAGAGCCGGCAGCTAAAAGCCCCAGAGACGAGGTNGACTTTTTTGGGGATGTGATACCTNCCTCAAACCATTTATCCCACCCAACTGCGAACAGACCAAAGATGCAAGGGAAGAGGCTACCTGGTCGCTTTAATGGTCCCANCGCTCAAAGCAAAGATTTAACAGATTCTGTCAAAGTGCTTAAAGAAGAGGAGAATGAAAGTGCCAAAGTAAAGACACCTGAAGTCAAAAAGCCATTGGCTCCCAGCATTGGTACATCTCCACTCCCGANTTCATTCCNTGTGTCAAAACCCGCCNCCAGTCCGCCGGTCCCATTACCTACTGAGGCGAAAGTGNAATCAGATGTGACCGACAGTAAGAGGAGTGAAAAGAGTGAAATGGACGACCTTAAAGCCCAAATTAGTGNCCTGCTCAGCATTGTGCATGCACTTAGAAAAGAACATAGGAAAGAGATGGATCACCTAAAGAAACANTTAGACGAGGAACGATTGCTACGGACCCATTTAGAGACCGAGGTTGACAAGCTGAAGAAGGCGGTCCAGTTAACATGAGGCGGCCAT
  5   1   0       add Neu7      out                        XL009c22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GACGATCTCAAAGCCCAAATTAGTGAACTCCTTAGCATTGTGGATGCCGTTAGAAAAGAACATAGGAAAGAGCTGGATCACCTAAAGAAAGAGTTAGAAGAGGAACGGTTGTTACGGACCAATTTAGAGACCGAGGTTGACAAGCTGAAGAAGGCGGTCCCGTTAACATGAGGAGCCAATCGTTTTTATGCCACCGATATTGATTAAAGTCCGTGTCAGACACTTAACGTTGTCTCCTCTTTTCCTCGAGTTCACGGAATCAACAAACACTCTGGCACTTTCCTTGGTTGGAATTAAAGAGGCCGGATCTTCCTACTGTGCTGGAGCCGAGGCCTCGTACAACGGTTTTGCTTCAAGATACTACTGAGTTTATGTACAAAGCGGAGATTCTGTACGAATTTTATCAAATACTTGTCttttttttttcctttttAAATGCTTTCAATNCAG
  3   1   0       add Ga15      in                       XL423c24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AACATGGGAAAGAGANGGATCNCCTNAAGAAACAGTTAGACGAGGAACGATTGCTNCGGACCCATTTAGAGACCGAGGTTGACAAGCTGAAGAAGGCGGTCCAGTTAACATGAGGCGGCCATTTTTTTACCCCNCCAATCTAGATTAAAGTCCGTGTCAGATATTTAACGCCGTCTCCTNTTCTCCTCGAGTTCACGGAAGCATGGTCGAGCCCTACTCTGGCGCTTACCTTCGTTGCTTTGCCAATGGAATTAAAGAGGCCTTATGTTCTTACTGTGCTGGAGTGATGCAGGCCTAGTACAATGGTTTTGCTTCGAGATACTACTGAGTTTATGTACAAAGCTGGGATTCTGTACGAATTTTACTTGTGTAATTTTTTTTTTAAAGCTCTGAATACGGTGATATATATCTTTAGAAATAATCTGTAATATAGTCTAACGGGGAATANCAGTAGCCTTATCTTCANCGGCGAAAACCATCATGTTTTGTAAATTTTTGACTTCTTATCCAGGGGTTACA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)