Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-rxlk76g21ex.3                         3 END     2          28       66                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL515o10ex.5                          2 PI      91        579      954                Foxn3 protein [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012784520 Xl3.1-rxlk155c11ex.3 - 7 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xl3.1-rxlk155c11ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGGTGCATAGATCCTGAATATAGACAAAACCTGATACAAGCCTTGAAAAAGACCCCCTATCATCCCTACTCACATGTTTTCAACACCCCACCCACATCTCCTCAGGCATATCAAAGCACATCAGTCCCACCCCTTTGGCCAGGAAGCACCTTCTTTAAGAAAAATGGAGCCTTACTTCAAGTTTCTCCGGGTGTGATACAAAATGGAGCCAGAGTGTTGAACAGAGGAATCTTCCCAGGTGTCCGACCTTTGCCAATTAATCCTATTGGAGCAATGGCTGCCTCAGTCAGAAATGGGATTGCAAATTGCCGAACGAGAATGGAGAGTGAGCCGTCGTGTGGATCTCCCTTAGTTAGCAGTGATCCCAAAGATGACCACAACTACAGCAGCGCCAAATCTGCTAACAAGAGGAGCTCATCGCCCAGTGACTCCATCTCATCCTCCTCTGCCGACGATCACTACGAATTTGCAGCCAAAGTCTGCAGAGAAGGCAGTGATATCAGCTTCCAGAGCCACGAGAGCTTCAGCGAGACAGAGGAAGAGGACAAGAAACAGATAAAGAAAGAGTTGAAGGAGCCCCTTGTTGAGAGTGGCTACTCTTCCCAACACAAGAAAAAGCAGCATTTACTAAAACTTCGGAGGATCCCCAGTGATGCCCTTCCTCTGAAAAAGAGACGCACAGAAAAACCACCTGAGAGTGATGATGAAGAGATGAAAGAGGCAGCTGGGTCTCTCTTGCATTTGGCAGGAATTCGCTCTTGTTTGAATAACATCACCAATCGGACGGCAAAGGGACAGAAAGAGCAAAAGGACAAAGAGACCACAAAAAATTAGTGCAAATCATAGATCTGTTTGGATTTTAAAATCATTTCTTTCAGCACGTCAGGTGAATTCTAATGATTTTGTGGCAATAGCAACATTTTTCCCCTTTATTTTTATTTTGGTGTTTCTTTTGGACCCTTGAAATGTTTATTTTTTAAAGG
                                                  Xl3.1-CHK-1012700676                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CATAGATCCTGAATATAGACAAAACCTGATACAAGCCTTGAAAAAGACCCCCTATCATCCCTACTCACATGTTTTCAACACCCCACCCACATCTCCTCAGGCATATCAAAGCACATCAGTCCCACCCCTTTGGCCAGGAAGCACCTTCTTTAAGAAAAATGGAGCCTTACTTCAAGTTTCTCCGGGTGTGATACAAAATGGAGCCAGAGTGTTGAACAGAGGAATCTTCCCAGGTGTCCGACCTTTGCCAATTAATCCTATTGGAGCAATGGCTGCCTCAGTCAGAAATGGGATTGCAAATTGCCGAACGAGAATGGAGAGTGAGCCGTCGTGTGGATCTCCCTTAGTTAGCAGTGATCCCAAAGATGACCACAACTACAGCAGCGCCAAATCTGCTAACAAGAGGAGCTCATCGCCCAGTGACTCCATCTCATCCTCCTCTGCCGACGATCACTACGAATTTGCAGCCAAAGTCTGCAGAGAAGGCAGTGATATCAGCTTCCAGAGCCACGAGAGCTTCAGCGAGACAGAGGAAGAGGACAAGAAACAGATAAAGAAAGAGTTGAAGGAGCCCCTTGTTGAGAGTGGCTACTCTTCCCAACACAAGAAAAAGCAGCATTTACTAAAACTTCGGAGGATCCCCAGTGATGCCCTTCCTCTGAAAAAGAGACGCACAGAAAAACCACCTGAGAGTGATGATGAAGAGATGAAAGAGGCAGCTGGGTCTCTCTTGCATTTGGCAGGAATTCGCTCTTGTTTGAATAACATCACCAATCGGACGGCAAAGGGACAGAAAGAGCAAAAGGACAAAGAGACCACAAAAAATTAGTGCAAATCATAGATCTGTTTGGATTTTAAAATCATTTCTTTCAGCACGTCAGGTGAATTCTAATGATTTTGTGGCAATAGCAACATTTTTCCCCTTTATTTTTATTTTGGTGTTTCTTTTGGACCCTTGAAATGTTTATTTTTTAAAGGAGATTG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     3     2     4     2     4     2     4     2     4     2     4     2     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     4     6     4     6     4     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     6     7     6     7     6     7     6     7     6     7     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     3     5     3     4     3     4     3     4     3     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     3     4     3     4     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Sp ---- 2e-009     XP_001182399.1 PREDICTED: similar to forkhead transcription factor N2/3 [Strongylocentrotus purpuratus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ci ---- 1e-014     NP_001071716.1 transcription factor protein [Ciona intestinalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Bt ---- 1e-031     XP_600009.2 PREDICTED: similar to T-cell leukemia virus enhancer factor [Bos taurus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Dr ---- 3e-043     NP_001116217.1 checkpoint suppressor 1 [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Mm ---- 1e-118     NP_899009.2 checkpoint suppressor 1 [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Hs ---- 7e-125     NP_005188.2 checkpoint suppressor 1 [Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Cf ---- 3e-127     XP_868437.1 PREDICTED: similar to checkpoint suppressor 1 isoform 2 [Canis familiaris] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Gg ---- 1e-133     XP_421312.2 PREDICTED: similar to Checkpoint suppressor 1 [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Xt ---- 3e-158     AAI60425.1 Foxn3 protein [Xenopus tropicalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Xl ---- 4e-159     CAJ38820.1 forkhead box protein FoxN3b [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xl3.1-rxlk155c11ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATG------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------TAG---------TAG------------------------------------------------TAATGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  5   1   2      seed FaBN                            IMAGE:8076624.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAAGGTTCTCTGTGGTGCATAGATCCTGAATATAGACAAAACCTGATACAAGCCTTGAAAAAGACCCCCTATCATCCCTACTCACATGTTTTCAACACCCCACCCACATCTCCTCAGGCATATCAAAGCACATCAGTCCCACCCCTTTGGCCAGGAAGCACCTTCTTTAAGAAAAATGGAGCCTTACTTCAAGTTTCTCCGGGTGTGATACAAAATGGAGCCAGAGTGTTGAACAGAGGAATCTTCCCAGGTGTCCGACCTTTGCCAATTAATCCTATTGGAGCAATGGCTGCCTCAGTCAGAAATGGGATTGCAAATTGCCGAACGAGAATGGAGAGTGAGCCGTCGTGTGGATCTCCCTTAGTTAGCAGTGATCCCAAAGATGACCACAACTACAGCAGCGCCAAATCTGCTAACAAGAGGAGCTCATCGCCCAGTGACTCCATCTCATCCTCCTCTGCCGACGATCACTACGAATTTGCAGCCAAAGTCTGCAGAGAAGGCAGTGATATCAGCTTCCAGAGCCACGAGAGCTTCAGCGAGACAGAGGAAGAGGACAAGAAACAGATAAAGAAAGAGTTGAAGGAGCCCCTTGTTGAGAGTGGCTACTCTTCCCAACACAAGAAAAAGCAGCATTTACTAAAACTTCGGAGATCCCCAGTGATGCCTTTCCTCTGAAAAAGAGACGCACAGAAAAACCACCTGAGAGTGATGATGAAGAGATGAAAGAGGCAGCT
  5   1   2       bld Ga18      out                     xlk126a10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCTCTGTGGTGCATAGATCCTGAATATAGACAAAACCTGATACAAGCCTTGAAAAAGACCCCCTATCATCCCTACTCACATGTTTTCAACACCCCACCCACATCTCCTCAGGCATATCAAAGCACATCAGTCCCAACCCTTTGGCCAGGAAGCACCTTCTTTAAGAAAAATGGAGCCTTACTTCAAGTTTCTCCGGGTGTGATACAAAATGGAGCCAGAGTGTTGAACAGAGGAATCTTCCCAGGTGTCCGACCTTTGCCAATTAATCCTATTGGAGCAATGGCTGCCTCAGTCAGAAATGGGATTGCAAATTGCCGAACGAGAATGGAGAGTGAGCCGTCGTGTGGATCTCCCTTAGTTAGCAGTGATCCCAAAGATGACCACAACTACAGCAGNNNNAATCTGCTAACAAGAGGAGCTCATCGCCCAGTGACTCCATCTCATCCTCCTCTGCCGACGATCACTACGAATTTGCAGCCAAAGTCTGCAGAGAAGGCAGNGATATCAGCTTCCAGAGCCACGAGAGCTTCANNNNGACAGAGGAAGAGGACAAGAAACAGATAAAGAAAGAGTTGAAGGAGCCCCTTGTTGAGAG
  5   1   2       bld Te2N      in                    IMAGE:7203499.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATCACATAGCGGCTACAGTTGGCTCCCAGATTTTTCTTCAGAGATGTGCACATCAGTCCCACCCCTTTGGCCAGGAAGCACCTTCTTTAAGAAAAATGGAGCCTTACTTCAAGATCCCGACATTGATGCTGCTTCTGCCATGATGCTATTGAATTCTGCCCATGAGTTACAAGCAGGTTTTTCTCCGGGTGTGATACAAAATGGAGCCAGAGTGTTGAACAGAGGAATCTTCCCAGGTGTCCGACCTTTGCCAATTAATCCTATTGGAGCAATGGCTGCCTCAGTCAGAAATGGGATTGCAAATTGCCGAACGAGAATGGAGAGTGAGCCGTCGTGTGGATCTCCCTTAGTTAGCAGTGATCCCAAAGATGACCACAACTACAGCAGCGCCAAATCTGCTAACAAGAGGAGCTCATCGCCCAGTGACTCCATCTCATCCTCCTCTGCCGACGATCACTACGAATTTGCAGCCAAAGTCTGCAGAGAAGGCAGTGATATCAGCTTCCAGAGCCACGAGAGCTTCAGCGAGACAGAGGAAGAGGACAAGAAACAGATAAAGAAAGAGTTGAAGGAGCCCCTTGTTGAGAGTGGCTACTCTTCCCAACACAAGAAAAAGCAGCATTTACTAAAACTTCGGAGGATCCCCAGTGATGCCCTTCCTCTGAAAAAGAGACGCACAGAAAAACCACCTGAGAGTGATGATGAAGAGATGAAAGAGGCAGCTGGGTCTCTCTTGCATTTGGCAGGAATTCGCTCTTTGTTGATAACATCACCAATCGGACggcaaagggacagaaagagcaaaaggacaaagagacacaaaaaaatagtggcaattcaaaaatCGGTTTGGGATTTTAAAATCATTTTCTTTCANCaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld Te2N      in                    IMAGE:7203499.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGNNCAGGAAGCACCTTCTTAAAGAAAAATGGAGCTNTACTCAAAGATNCCGACATTGAATGCTGCTTCTGCCATGATGCTATTGAATTCTGCCCATGAGTTACAAGCAGGTTTTTCTCCGGGTGTGATACAAAATGGAGCCAGAGTGTTGAACAGAGGAATCTTCCCAGGTGTCCGACCTTTGCCAATTAATCCTATTGGAGCAATGGCTGCCTCAGTCAGAAATGGGATTGCAAATTGCCGAACGAGAATGGAGAGTGAGCCGTCGTGTGGATCTCCCTTAGTTAGCAGTGATCCCAAAGATGACCACAACTACAGCAGCGCCAAATCTGCTAACAAGAGGAGCTCATCGCCCAGTGACTCCATCTCATCCTCCTCTGCCGACGATCACTACGAATTTGCAGCCAAAGTCTGCAGAGAAGGCAGTGATATCAGCTTCCAGAGCCACGAGAGCTTCAGCGAGACAGAGGAAGAGGACAAGAAACAGATAAAGAAAGAGTTGAAGGAGCCCCTTGTTGAGAGTGGCTACTCTTCCCAACACAAGAAAGAGCAGCATTTACTAAAACTTCGGAGGATCCCCAGTGATGCCCTTCCTCTGAAAAAGAGACGCACGAAAAAACCCCCTGAGAGTGATGATGAAAGAGATGAAAAGAGGCAGCTGGGTCTCTCTTGCTTTTGGCGGAAATTTCGCTCTTGTTTGAATAACTCCCACGATTCGGACGGCCTAAGGACCGTAAAGAGCCTAAAGAACTAAAAGACCCCCGAAAAATTGTGCACAATACTAGATCTGTGGATTAAATCTTCCCG
  5   1   2       bld Tbd7      out                        XL086k15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACATGTTTTGCAACACCCCACCCACATCTCCTCAGGCATATCAAAGCACATCAGTCCCACCCCTTTGGCCAGGAAGCACCTTCTTTAAGAAAAATGGAGCCTTACTTCAAGTTTCTCCGGGCGTGATACAAAATGGAGCCAGAGTGTTGAACAGAGGAATCTTCCCAGGTGTCCGACCTTTGCCAATTAATCCTATTGGAGCAATGGCTGCCTCAGTCAGAAATGGGATTGCAAATTGCCGAACGAGAATGGAGAGTGAGCCGTCGTGTGGATCTCCCTTAGTTAGCAGTGATCCCAAAGATGACCACAACTACAGCAGCGCCAAATCTGCTAACAAGAGGAGCTCATCGCCCAGTGACTCCATCTCATCCTCCTCTGCCGACGATCACTACGAATTTGCAGCCAAAGTCTGCAGAGAAGGCAGTGATATCAGCTTCCAGAGCCACGAGAGCTTCAGCGAGACAGAGGAAGAGGACAAGAAACAGATAAAGAAAGAGTTGAAGGAGCCCCTTGTTGAGAGTGGCT
  3   1   2       bld Sp1                             IMAGE:4962874.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGAGCTTCAGCGAGACAGAGGAAGAGGACAAGAACCAGATAAAGAAAGAGTTGAAGGAGCCCCTTGTTGAGAGTGGCTACTCTTCCCAACACAAGAAAAAGCAGCATTTACTAAAACTTCGGAGGATCCCCAGTGATGCCCTTCCTCTGAAAAAGAGACGCACAGAAAAACCACCTGAGAGTGATGATGAAGAGATGAAAGAGGCAGCTGGGTCTCTCTTGCATTTGGCAGGAATTCGCTCTTGTTTGAATAACATCACCAATCGGACGGCAAAGGGACAGAAAGAGCAAAAGGACAAAGAGACCACAAAAAATTAGTGCAAATCATAGATCTGTTTGGATTTTAAAATCATTTCTTTCAGCACGTCAGGTGAATTCTAATGATTTTGTGGCAATAGCAACATTTTTCCCCTTTATTTTTATTTTGGTGTTTCTTTTGGACCCTTGAAATGTTTATTTTTTAAAGGAGATTGAAGCCATAGAACTCAGCTAACTAACATTTTCCTTTAAA

In case of problems mail me! (