Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 91%

 1012785126 Xl3.1-IMAGE:7207546.5 - 7 ESTs
                                                                       .....0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7207546.5      TATGCCTGAATGTTGTTGTGGTTCTCTGCTCAGCCTGCCTGCTCCACTCCGGCTTCTCAGCATCAGGTGACCTGCAGCATCTGCATCTGACATGGCTGACACAAAGTGATGCTGCCTCTGTTCTCTGGGAATACAAAGGCCACATACAGAGGACCACTGAAAGGAAGTAGCTGATTAGATATAGTGGAGCTCCTGTACTGAATAAACATGAGTAGTGAACTTAACATTCCAGTGGATCCTTCCACCCCTGCTGTCTCAGAAAGAGGAAACAAAGGCATGGACTACAGAGACTGGGTCAGACGTAGCTACCTTGAACTGGTCACATCCAACCACCATTCTGTTCAGGCTCTTTCCTGGAGGAAGTTGTACCTCAGCAGAGCCAAGTTAAAGGCCTCCAGTCGCACATCTGCATTGCTGTCTGGATTTGCTATGATCCAGAGTAAAGATGCCACCATTACCTGGTGCTGAGCTGGTACATAGCCCTTTGCAACTTTACAGATATCTCCTTCGATGTTGCAAGCTACTCCCTACTGAAAGCCTTCAGCACTATTACAGACATGCAGTCCCAATGTCGAGGCAGTGAGTAACATCCATAATCTATCCTGAGCGGATGAATCTCCACATTAAGAGGGCCATAGAAGATGCTGAATGGGTGCTAAATTTTCGACAGCTATAAAACTAGCTCTTTTTCTTGCAGCTGGCCTGTATCTAATATTTAGT
                                                  Xl3.1-CHK-1012700479            TGAATGTTGTTGTGGTTCTCTGCTCAGCCTGCCTGCTCCACTCCGGCTTCTCAGCATCAGGTGACCTGCAGCATCTGCATCTGACATGGCTGACACAAAGTGATGCTGCCTCTGTTCTCTGGGAATACAAAGGCCACATACAGAGGACCACTGAAAGGAAGTAGCTGATTAGATATAGTGGAGCTCCTGTACTGAATAAACATGAGTAGTGAACTTAACATTCCAGTGGATCCTTCCACCCCTGCTGTCTCAGAAAGAGGAAACAAAGGCATGGACTACAGAGACTGGGTCAGACGTAGCTACCTTGAACTGGTCACATCCAACCACCATTCTGTTCAGGCTCTTTCCTGGAGGAAGTTGTACCTCAGCAGAGCCAAGTTAAAGGCCTCCAGTCGCACATCTGCATTGCTGTCTGGATTTGCTATGxTxxxxAGTAAAGATGCCACCATTACCTGGxxxTxxGxxxxxACATAGCCCTTTGCAACTTTACAGATATCTCCTTCGATGTTGCAAGCTACTCCCTACTGAxxxxCTxxxxxxCTATTACAGACATGCAGTxxxxxxGTCGAGGCAGTGAGTAACATCCATAxxxxATCCTGAGCGGATxxAxxxCCACATxAxxxxGGCCATAGAAGATGCTGAATGGGTGCTAAATxxxxxxxAGxxATAAAAxTxxxTCTTTTTxxxxCxGCTGGCCTGTATCTAATATTTAGTAACATT
                                                      consensus depths           2     2     2     2     2     2     2     2     2     2     2     2     2     2     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     7     5     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     3     7     4     7     4     7     3     7     3     7     3     7     2     6     2     6     2     6     2     6     2     6     2     6     2     6     2     6     2     6     2     6
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTTGCAATGGTAGAAGTCCAGCTTGAGATGAAATATGGATACCCCCAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCATTTAGTGCTTGCACTACAGTGCTTGTCGCAGTCCACCTCTTTGCTCTCCTGATCAGCACATGCATTCTG
                                               BLH ATG     207     266      
                                               BLH MIN     207      42      
                                               BLH MPR     102      42      
                                               BLH OVR     207     699      
                                               CDS MIN     207      42      
                                                                                                                                                                                  PROTEIN --- Bt ---- 3e-026     NP_001092472.1 calcium release-activated calcium channel protein 1 [Bos taurus] ---------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                           PREDICTED = Dr ==== 1e-036     XP_706744.1 PREDICTED: similar to CG11430-PB, isoform B isoform 2 [Danio rerio] ==========================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                           PROTEIN === Mm ==== 1e-041     NP_848866.2 transmembrane protein 142B [Mus musculus] ====================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                           PREDICTED = Gg ==== 9e-042     NP_001025881.1 hypothetical protein LOC417509 [Gallus gallus] ============================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                           PROTEIN === Hs ==== 8e-042     NP_001119812.1 ORAI calcium release-activated calcium modulator 2 [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                           PREDICTED = ?? ==== 1e-042     XP_001789850.1 PREDICTED: similar to ORAI calcium release-activated calcium modulator 2 [Bos taurus] =====================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                           PREDICTED = Cf ==== 5e-043     XP_850105.1 PREDICTED: similar to CG11430-PB, isoform B [Canis familiaris] ===============================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                           PREDICTED = Xl ==== 2e-046     NP_001084444.1 hypothetical protein LOC403390 [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                           PREDICTED = Xt ==== 2e-046     NP_001096448.1 hypothetical protein LOC100125061 [Xenopus tropicalis] ====================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:7207546.5            TGAATG---------------------------------------------------------------------------TGA------TGA---------ATG------------------------------------------------------------TGA------------------------TGA------ATG------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------TGA---------TAG------------------------------ATG------------------TGA---------------------------------------------------------------------TGA---------------------------------------TGAATG
                                                                   ORF                                                                                                                                                                                                                     [ open reading frame                                                                                                                                                                                                          ...
  5   1   2      seed Te2N      in                    IMAGE:7765857.5p TAAGCTATGCCTGAATGTTGTTGTGGTTCTCTGCTCAGCCTGCCTGCTCCACTCCGGCTTCTCAGCATCAGGTGACCTGCAGCATCTGCATCTGACATGGCTGACACAAAGTGATGCTGCCTCTGTTCTCTGGGAATACAAAGGCCACATACAGAGGACCACTGAAAGGAAGTAGCTGATTAGATATAGTGGAGCTCCTGTACTGAATAAACATGAGTAGTGAACTTAACATTCCAGTGGATCCTTCCACCCCTGCTGTCTCAGAAAGAGGAAACAAAGGCATGGACTACAGAGACTGGGTCAGACGTAGCTACCTTGAACTGGTCACATCCAACCACCATTCTGTTCAGGCTCTTTCCTGGAGGAAGTTGTACCTCAGCAGAGCCAAGTTAAAGGCCTCCAGTCGCACATCTGCATTGCTGTCTGGATTTGCTATGATCCAGAGTAAAGATGCCACCATTACCTGGTGCTGAGCTGGTACATAGCCCTTTGCAACTTTACAGATATCTCCTTCGATGTTGCAAGCTACTCCCTACTGAAAGCCTTCAGCACTATTACAGACATGCAGTGAAGCAGAGTTTCCGAGTTCATGCAGATGAAGATGATCCTGAGCGGATACAGAATATTATTAAGAGGGCCATAGAAGATGCTGAATGGGTGCTAAATAAGTACAAGAAATAAAACTAGCTGAGCACAAGTATGTGCACTCCTGAGCAGCTCTGAAGATTATAGACTGTTCTGGGCCATGAGGG
  5   1   2       bld Te2  5g                         IMAGE:7207546.5p      TATGCCTGAATGTTGTTGTGGTTCTCTGCTCAGCCTGCCTGCTCTGCTCCGGCTTCTCAGCATCAGGTGACCTGCAGCATCTGCATCTGACATGGCTGACACAAAGTGATGCTGCCTCTGTTCTCTGGGAATACAAAGGCCACATACAGAGGACCACTGAAAGGAAGTAGCTGATTAGATATAGTGGAGCTCCTGTACTGAATAAACATGAGTAGTGAACTTAACATTCCAGTGGATCCTTCCACCCCTGCTGTCTCAGAAAGAGGAAACAAAGGCATGGACTACAGAGACTGGGTCAGACGTAGCTACCTTGAACTGGTCACATCCAACCACCATTCTGTTCAGGCTCTTTCCTGGAGGAAGTTGTACCTCAGCAGAGCCAAGTTAAAGGCCTCCAGTCGCACATCTGCATTGCTGTCTGGATTTGCTATGGTTGCAATGGTAGAAGTCCAGCTTGAGATGAAATATGGATACCCCCAGTTGCTGCTGATAGCATTTAGTGCTTGCACTACAGTGCTTGTCGCAGTCCACCTCTTTGCTCTCCTGATCAGCACATGCATTCTGCCCAATGTCGAGGCAGTGAGTAACATCCATAATCTAAACTCTGTCAATGAATCTCCACATGATCGCATGCATCCTTACATCGAGTTGGCCTGNGGATTTTCGACAGCTCTTGGGATCCTTCTTTTTCTTGCAGAGTCGTTCTGCTGTGCTGGATAAATTTCTACCATAGATCTGCATGACACGGATGAACCGCACACTCAAAGCACTGAAATGCAGGTGACTCGCCTGTCCACATATATGTGCCGTGTACATCTGCTTTACATCATTT
  5   1   2       bld Lu1  5g                IMAGE:4633914-IMAGp.IMAGp                                                                               GCAGCATCTGCATCTGACATGGCTGACACAAAGTGATGCTGCCTCTGTTCTCTGGGAATACAAAGGCCACATACAGAGGACCACTGAAAGGAAGTAGCTGATTAGATATAGTGGAGCTCCTGTACTGAATAAACATGAGTAGTGAACTTAACATTCCAGTGGATCCTTCCACCCCTGCTGTCTCAGAAAGAGGAAACAAAGGCATGGACTACAGAGACTGGGTCAGACGTAGCTACCTTGAACTGGTCACATCCAACCACCATTCTGTTCAGGCTCTTTCCTGGAGGAAGTTGTACCTCAGCAGAGCCAAGTTAAAGGCCTCCAGTCGCACATCTGCATTGCTGTCTGGATTTGCTATGGTTGCAATGGTAGAAGTCCAGCTTGAGATGAAATATGGATACCCCCAGTTGCTGCTGATAGCATTTAGTGCTTGCACTACAGTGCTTGTCGCAGTCCACCTCTTTGCTCTCCTGATCAGCACATGCATTCTGCCCAATGTCGAGGCAGTGAGTAACATCCATAATCTAAACTCTGTCAATGAATCTCCACATGATCGCATGCATCCTTACATCGAGTTGGCCTGGGGATTTTCGACAGCTCTTGGGATCCTTCTTTTTCTTGCAGAAGTCGTTCTGCTGTGCTGGATAAAATTTCTACCCATAGACTCTGCATTGACACGGAATGAAACCGCAACAACTCAAAAGCCACGT
  5   1   2       bld Lu1  5x3  out                   IMAGE:4633914.5p                                                                                 AGCATCTGCATCTGACATGGCTGACACAAAGTGATGCTGCCTCTGTTCTCTGGGAATACAAAGGCCACATACAGAGGACCACTGAAAGGAAGTAGCTGATTAGATATAGTGGAGCTCCTGTACTGAATAAACATGAGTAGTGAACTTAACATTCCAGTGGATCCTTCCACCCCTGCTGTCTCAGAAAGAGGAAACAAAGGCATGGACTACAGAGACTGGGTCAGACGTAGCTACCTTGAACTGGTCACATCCAACCACCATTCTGTTCAGGCTCTTTCCTGGAGGAAGTTGTACCTCAGCAGAGCCAAGTTAAAGGCCTCCAGTCGCACATCTGCATTGCTGTCTGGATTTGCTATGGTTGCAATGGTAGAAGTCCAGCTTGAGATGAAATATGGATACCCCCAGNTGCTGCTGATAGCATTTAGTGCTTGCACTACAGTGCTTGTCGCAGTCCACCTCTTTGCTCTCCTGATCAGCACATGCATTCTGCCCAATGTCGAGGCAGTGAATAACATCCATAATCTAAAC
  3   1   2       add Te2N      in                    IMAGE:7765857.3p                                                                                                                                                                                    TTTAGATTAGGAGAGCTCCTGTCCGGAATACACATGAGTAGTGAACTAAACATTCCAGTGGATCCTTCCACCCCTGCTGTTTCAGAAAGAGGAACCAAAGGCATGGTCTCCAGAGACTGGTTCAGAGGTAGTTCCCTTGAACTGGTCACATCCAACCACCATTTTGTTCAGGTTTTTTCCTGGAGGAAGTTGTACTTCAGCAGAGCCAAGTTAAAGGCCTCCAGTCGCACATTTGCATTGCTGTCTGGATTTGCTATGATCCAGAGTAAAGATGCCCCCATTACCTGGTGTTGAGCTGGTACATAGCCCTTTGCAACTTTACAGATTTTTCCTTGGATGTTGCAAGCTACTCCCTACTGAAAGCCTTCAGCCTTTTTACAGACATCCAGTGAAGCAGAGTTTCCGAGTTCATGCAGATGAAGATGATCCTGAGCGGATACAGAATTTTTTTAAGAGGGCCATAGAAGATGCTGAATGGGTGCTAAATAAGTCCAAGAAATAAAACTAGCTGAGCAACAAGTATGTGCACTCCTGAAGCAGCTTTTGAAGATTATAGGACATGGTTTGGGGCCATGAGGGCTACTTGCATGAAGAAAACGCAACCAGAACGAGACGGCTGGCCTGTATTTAATATTTAGTAACATTCTTGCAACTTTTCCATCAACATTTTACAAAATAAAAGAAAAATGGGCCCTGAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   1       add Ga18      in                      xlk139i11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                         AAAAACACAGCGGCTCACATATCCGACAGATCCAGAGTAAAGATGCCACCATTACCTGGTGCTGAGCTGGTACATAGCCCTTTGCAACTTTACAGATATCTCCTTCGATGTTGCAAGCTACTCCCTACTGAAANNCTTCAGCACTATTACAGACATGCAGTGAAGCAGTACAAGAAATAAAACTAGCTGAGCAACAAGTATGTGCACTCCTGAAGCAGCTTCTGAAGATTATAGGACATGGTCTGGGGCCATGAGGGCTACTTGCATGAAGAAAACGCAACCAGAACGAGACGGCTGGCCTGTATCTAATATTTAGTAACANTCNNCNNCTTNCC
  5   1   1       add Ga18      in                      xlk139i11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                         AAAAACACAGCGGCTCACATATCCGACAGATCCAGAGTAAAGATGCCACCATTACCTGGTGCTGAGNTGGTACATAGCCCTTTGCAACTTTACAGATATCTCCTTCGATGTTGCAAGCTACTCCCTACTGAAAGCCTTCAGCACTATTACAGACATGCAGTGAAGCAGTACAAGAAATAAAACTAGCTGAGCAACAAGTATGTGCACTCCTGAAGCAGCTTCTGAAGATTATAGGACATGGTCTGGGGCCATGAGGNCTACTTGCATGAAGAAAACGCAACCAGAACGAGACGGCTGGCCTGTATCTAATATTTAGTAACATTCTTGCAACTTTTCCATCAACATTTTAcaaaataaaagaaaaatgaacaaaaaaaaaa

In case of problems mail me! (mike.gilchrist@crick.ac.uk)