Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:3748009-IMAGp.5                70 END     5          83        7                hypothetical protein LOC100145520 [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:3748009-IMAGp.5                70 PI      89          4      552                hypothetical protein LOC100145520 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012785147 Xl3.1-xl266d14.3 - 6 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl266d14.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCAGTGGACTCTTCCAACGCCGACTTACTCCCCAGGCCTGGAAGCCATACCATCGAATTTTTTGAAATGTGCGCAAATCTAATAAAAATCCTCGCACGATAGGCCTCCAGCAACATGAGCGAATCCATATCCAGCAATAAGCATGCAGTGATCTGTAGCCAAATGCTTCCACTTTCAGTCCAGTTACGACCAACAGCTGAGAGCTCCGTCACAATGCAGTTTGCACAGAAGATTCTAAGACCTAAATCCGTAGCGATTATGATTTTTAACAGTTCCTTGTCGACGCATATAAATTGTATATATTTTTCAGGTTGACAAAAGTTTTAATTGCACATTTTATCGAGCACTGGGCTACTTCGCATATCCCCGAGATAAACCTCAACATCTTGTCTTCGTTTTTTTGTTTTTTTTCTCGTCTTGTGAAATACATAGAAAGTGATTTTCATGATAATTTAGTGGATTAAGCATGCCGGCCATAATTCTGCATCTTAATCTCCACTCGGATAGATCAGTCTGATGAATAAGGGCAGTAAATGTGGATACAAAAAGGCA
                                                  Xl3.1-CHK-1012701061                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GACTCTTCCAACGCCGACTTACTCCCCAGGCCTGGAAGCCATACCATCGAATTTTTTGAAATGTGCGCAAATCTAATAAAAATCCTCGCACGATAGGCCTCCAGCAACATGAGCGAATCCATATCCAGCAATAAGCATGCAGTGATCTGTAGCCAAATGCTTCCACTTTCAGTCCAGTTACGACCAACAGCTGAGAGCTCCGTCACAATGCAGTTTGCACAGAAGATTCTAAGACCTAAATCCGTAGCGATTATGATTTTTAACAGTTCCTTGTCGACGCATATAAATTGTATATATTTTTCAGGTTGACAAAAGTTTTAATTGCACATTTTATCGAGCACTGGGCTACTTCGCATATCCCCGAGATAAACCTCAACATCTTGTCTTCGTTTTTTTGTTTTTTTTCTCGTCTTGTGAAATACATAGAAAGTGATTTTCATGATAATTTAGTGGATTAAGCATGCCGGCCATAATTCTGCATCTTAATCTCCACTCGGATAGATCAGTCTGATGAATAAGGGCAGTAAATGTGGATACAAAAAGGCAGTTTGT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              3     3     2     3     5     5     5     6     4     6     5     6     5     6     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     4     6     5     6     5     6     5     6     5     6     5     6     5     6     4     6     4     6     5     6     5     6     3     5
                                                                       ...PROTEIN --- Bt ---- 2e-009     NP_001103272.1 protein kinase, AMP-activated, alpha 1 catalytic subunit [Bos taurus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================
                                                                       ...PROTEIN --- Mm ---- 2e-009     NP_001013385.3 protein kinase, AMP-activated, alpha 1 catalytic subunit [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================
                                                                       ...PREDICTED - Cf ---- 1e-009     XP_536491.2 PREDICTED: similar to protein kinase, AMP-activated, alpha 1 catalytic subunit isoform 2 [Canis familiaris] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================
                                                                       ...PROTEIN --- Hs ---- 1e-009     NP_006242.5 protein kinase, AMP-activated, alpha 1 catalytic subunit isoform 1 [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================
                                                                       ...PROTEIN --- Dr ---- 4e-010     NP_001103756.1 protein kinase, AMP-activated, alpha 1 catalytic subunit [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================
                                                                       ...PROTEIN --- Gg ---- 1e-010     NP_001034692.1 protein kinase, AMP-activated, alpha 1 catalytic subunit [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================
                                                                       ...PREDICTED - Xt ---- 5e-012     NP_001120434.1 hypothetical protein LOC100145520 [Xenopus tropicalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================
                                                                       ...PROTEIN --- Xl ---- 2e-012     NP_001083882.1 SNF1-like protein AMPK [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================
                                                      Xl3.1-xl266d14.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATG------------------------------TAG------------ATG---------------------------------------------ATG------------------------------------------------ATG------------------------------------------ATG---------------------------------------------------TGA---------TAA---------------------------------------------TAA---------------------------------------------TGA------TAG------------ATG------TAG---------------------------------TAA------------TAG---------ATG
  3   1   2       bld DMZ       out                        xl266d14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAGCATGTGCACTAAGATGAGCCTCCAGCTGTACCAAGTGGATAGCAGAACTTACCTGCTGGATTTCCGCAGCATTGACGATGAAGTTACTGAATCCAAGTCGGAAAGCGCCACCCCTAGGAGATCAGGCTCCATTAGCAATTACCGACCTCCAAGAAACGACTCGGATCCTGAAATTCAAGCAAAGTCTTCAGACGGCTCAGGGCCGTCCTCCTTAACCTCATCAGTGGACTCTTCCAACGCCGACTTACTCCCCAGGCCTGGAAGCCATACCATCGAATTTTTTGAAATGTGCGCAAATCTAATAAAAATCCTCGCACGATAGGCCTCCAGCAACATGAGCGAATCCATATCCAGCAATAAGCATGCAGTGATCTGTAGCCAAATGCTTCCACTTTCAGTCCAGTTACGACCAACAGCTGAGAGCTCCGTCACAATGCAGTTTGCACAGAAGATTCTAAGACCTAAATCCGTAGCGATTATGATTTTTAACAGTTCCTTGTCGACGCATATAAATTGTATATATTTTTCAGGTTGACAAAAGTTTTAATTGCACATTTTATCGAGCACTGGGCTACTTCGCATATCCCCGAGATAAACCTCAACATCTTGTCTTCGTTTTNTTGTTTTTNTTCTCGTCNTGTGAAATACATAGAAAGTGATTTTCATGATAATTTAGTGGATTAAGCATGCCGGCCATAATTCTGCNTCTTAATCTCCACTCGGANAGATCAGTCTGATGAATAAGGGCAGTAAATGTGGAACAAAAAGGCAGNTGACAAATA
  3   1   2       bld Ga12      out                        XL179d15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCCTTANCCTCATCAGTGGACTGTTCCANCGCCGANTTACTCCCCAGGCCTGGAAGCCATNCCATNGAATTTTTTGAAATGTGCGCAAATCTAATAAAAATCCTCGCACGATAGGCCTCCAGCAACATGAGCGAATCCATATCCAGCAATAAGCATGCAGTGATCTGTAGCCAAATGCTTCCACTTTCAGTCCAGTTACGACCAACAGCTGAGAGCTCCGTCACAATGCAGTTTGCACAGAAGATTCTAAGACCTAAATCCGTAGCGATTATGATTTTTAACAGTTCCTTGTCGACGCATATAAATTGTATATATTTTTCAGGTTGACAAAAGTTTTAATTGCACATTTTATCGAGCACTGGGNTACTTCGCATATCCCCGAGATAAACCTCAACATCTTGTCTTCGTTTTTTTGTTTTTTTTCTCGTNTTGTGAAATACATAGAAAGTGATTTTCATGATAATTTAGTGGATTAAGCATGCCGGCCATAATTCTGCATCTTAATCTCCACTCGGATAGATCAGTCTGATGAATAAGGGCAGTAAATGTGGATACAAAAAGGC
  3   1   2       bld Ga12      out                        XL141b04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAACCTCATCAGTGGACTCTTCCAACGCCGACTTACTCCCCAGGCCTGGAAGCCATACCATCGAATTTTTTGAAATGTGCGCAAATNTAATAAAAATCCTCGCACGATAGGCCTCCAGCAACATGAGCGAATCCATATCCAGCAATAAGCATGCAGTGATCTGTAGCCAAATGCTTCCACTTTCAGTCCAGTTACGACCAACAGCTGAGAGCTCCGTCACAATGCAGTTTGCACAGAAGATTNTAAGACCTAAATCCGTAGCGATTATGATTTTTAACAGTTCCTTGTCGACGCATATAAATTGTATATATTTTTCAGGTTGACAAAAGTTTTAATTGCACATTTTATCGAGCACTGGGCTACTTCGCATATCCCCGAGATAAACCTCAACATCTTGTCTTCGTTTTTTTGTTTTTTTTTCTCGTCTTGTGAAANACATAGAAAGTGATTTTCATGATAATTTAGTGGATTAAGCATGCCGGCCANAATTCTGCATCTTAATCTCCACTCGGATAGATCAGTCTGAGAATAAGGGCAGTAAATGTGGATACAAAAAGGCAGTTTGNACAAATATA
  3   1   2      seed Emb4      out                   IMAGE:4959184.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GACTTACTCCCCAGGCCTGGAAGCCATACCATCGAATTTTTTGAAATGTGCGCAAATCTAATAAAAATCCTCGCACGATAGGCCTCCAGCAACATGAGCGAATCCATATCCAGCAATAAGCATGCAGTGATCTGTAGCCAAATGCTTCCACTTTCAGTCCAGTTACGACCAACAGCTGAGAGCTCCGTCACAATGCAGTTTGCACAGAAGATTCTAAGACCTAAATCCGTAGCGATTATGATTTTTAACAGTTCCTTGTCGACGCATATAAATTGTATATATTTTTCAGGTTGACAAAAGTTTTAATTGCACATTTTATCGAGCACTGGGCTACTTCGCATATCCCCGAGATAAACCTCAACATCTTGTCTTCGTTTTTTTGTTTTTTTTCTCGTCTTGTGAAATACATAGAAAGTGATTTTCATGATAATTTAGTGGATTAAGCATGCCGGCCATAATTCTGCATCTTAATCTCCACTCGGATAGATCAGTCTGATGAATAAGGGCAGTAAATGTGGATACAAAAAGGCAGTTTGTAC
  3   1   2       add Emb1                            IMAGE:3403041.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTACTCCCCAGGCCTGAAAGCCATACCATGAAATTTTTTGAAATGTGCGCAAATCTAATAAAAATCCTCGCACGATAGGCCTCCAGCAACATGAGCGAATCCATATCCAGCAATAAGCATGCAGTGATCTGTAGCCAAATGCTTCCACTTTCAGTCCAGTTACGACCAACAGCTGAGAGCTCCGTCACAATGCAGTTTGCACAGAAGATTCTAAGACCTAAATCCGTAGCGATTATGATTTTTAACAGTTCCTTGTCGACGCATATAAATTGTATATATTTTTCAGGTTGACAAAAGTTTTAATTGCACATTTTATCGAGCACTGGGCTACTTCGCATATCCCCGAGATAAACCTCAACATCTTGTCTTCGTTTTTTTGTTTTTTTTCTCGTCTTGTGAAATACATAGAAAGTGATTTTCATGATAATTTAGTGGATTAAGCATGCCGGCCATAATTCTGCATCTTAATAGATCAGTCTGATGAATAAGGGCAGTAAATGTGGATACAAAAAGGCAGTTTGTACAAATATATAATAAAAAAAGGATTTTTAAAA
  3   1   2       add Ooc2      out                   IMAGE:3746253.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCAGGACTGGAAGCCAAACCAATGAATTTTTTGAAATGTGCGCAAATCTAATAAAAATCCTCGCACAATAGGCCTCCAGCAAACATGAGCGAATCCATATCCAGCAATAAGCATGCAGTGATCTGTAGCCNAATGCTTCCACTTTCAGTCCAGTTNCGNCCCCCAGCTGAGAGCTCCGTCCCAATGCAGTTTGCACAGAAGATTCTAAGACCTAAATCCGTAGCGATTATGATTTTTAACAGTTCCTTGTCGACGCATATAAATTGTATATNTTTTTCCGGTTGNCNNAAGTTTTAATTGCACATTTTATCGAGCACTGGGCTACTTCGCATATCCCCATGATAAACCTCAACATCTTGTCTTCGTTTTTTTGTTTTTTTTCTCGTCTTGTGAAATACATAGAAAGTGATTTTCATGATAATTTAGTGGATTAAGCATGCCGGCCATAATTCTGCATCTTAATCTCCACTCGGATAGATCAGTCTGATGAATAAGGGCAGTAAATGTGGATACAAAAAGGCAGTTTGTACAAATATATAATAAAAAAAGGATTTTTTTTTAAACAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)