Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:6862945.5                       6 END     1           8       16                (no blast hit)
     2   2.0    0Xl3.1-IMAGE:4683597-IMAGp.5                 3 END     1           8       33                ETS-domain protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012785356 Xl3.1-IMAGE:8528105.5 - 12 ESTs
                                                                       ......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8528105.5                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACTCTTCAGCGGAGAAAGATTTCCAGAGTGATGAGGAAGATGACTCGTTCTCTCCAAGAGAAGACCCTAGTAAGCAAGGGCATGCCTTTATCAAGCCGGCTACTCCATCTTGGACCCCAGTTTCATCTGCATCTTCCAGACCTTCTTATCCGAATGTGGGTACAGTAGATCCCTCAGAATCAAATCGAATAACAAAGGACTTTTCTATCGATGCAGTTACAGTGGAAAAGAAAGACTCTCTTCCCCCAAAGCTACGTCTGAAACGCCTGTGGAACGGCGATCGTCAGGCAGAAGTTGCAGAGGACAGAGGAGAGTGCAGGAAAGTCAGCTGCATTGTTAATGCTCTCAGGTCTCCAGTCATCCCTGCAGAAACCAAGGCAGTGACTGATTCTTAGTAATGGCGAATGATATATTGGTCTATTCCTGTTTATGTAGAACTGCTACAGAATGGTTGAGTTTTATTGATTTCCAAACTTTCCTAATAGCGGATCCTTATTTAGTATTTTTTTTTCTTATTTGAGCATTCAGGGTGGACAATACCTCGAATACACAGGGGATGACTTAACTGTACAAACTGAAGACCTGAGTGTTTTTTTGCTTTTATTTTTGCCTTTTCTGGTGGTGACGTAAAACATTCAGTAGTAAAGAGCATTTTGATTGGTGGTTTTGAATCTCTCTGCTTAAAATGGCTCAGGAAAGCTCTTGGAATGGATGAATCTTGCACTTGGATTTTCAATTCTGGTCTTTGGGTTTATTTATATGTTATTCATGATGTCACCCCCCCCCCCCCATTCTTCTGGAATATATTGACTGCTTAGTTGTGTTTAAGGAAGAGCTCAGAAAAGTTAATACAGTTGGGCAACATCTCCGTTGTCTCATATTAATTGACTAGGGGAAGAAGATGAAGACAAGAGGCCAGATTTTATGCCAAAATTATTCACTGGGTACAGAAGAGAATACCTCATATTATGGTGATCCACTTAAGAGGGATCAACAACAAGTGGGCAGATCAAATGAGCAGGTAGAAGATAGTTCCAGGCCAATGGTCTCTGGGTCAGGAGGTAGTTTAATACAGCAGTACTATTTACAAATATACCTCCTGTGCTCAAGCCACTTCTTTGGCCTGTAGGAAAGTGATTTATTGCTGCAATTCCATCACTTTTTATTGGAACCCTGCAGTTGCATTGACTCAGTATTTGTATAGGCGATGAATAATTCCTGTGGGGAAGTCGAGGAAGCGCAGCTTGCAGTCTTTATGACCTACGGGAAGTAGAGTTTAGAGAAATCGTGGATGGTGGGAAGAATTGGAACACAAAGCCTTTCAGTCTGCGATTTTTTTTCCCACACCACCGTCAGTTTATACCCTTAAACACGTATACATCTAACTCTGGTATGTTAATCATAGGATCTGATTCTATTATATACAGATTTGCTTTTTTTAACTCCTGCTTTCCCTTTGTATTGCCCCAAATCGTTTCTAACACATGAGATTCCACAATGCCTTGATATCTACATCTGCCTTTTCCCTTACCTGTGATATGTTCAACGGAATGTCAAAAAGGAGGTTTATTTTTTCCTTTTAAAGACCTGTCAAATCCTGTTTGGTTTGGACATAAATGTTACTCTTTGTAGAGGTATTAAGTTGCCTGGGCCTCAGGGACTAATTAATCTTCATGATCTGTGGCAGGTGAGTCTGATCCCTTGTCATTTAAGCCCTACATAGGAAGGTGCGTAGCACATACCAGAGTCGATGGAAAAATCATATGCGTGATCCTCTGCACATGTCATGTCCTCGCCGGTGCCTCTATGCACTGATAGGACTATACTTGCGAATCGATAGATTTTGTTGCCTTGATTATA
                                                  Xl3.1-CHK-1012693616                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGCGGAGAAAGATTTCCAGAGTGATGAGGAAGATGACTCGTTCTCTCCAAGAGAAGACCCTAGTAAGCAAGGGCATGCCTTTATCAAGCCGGCTACTCCATCTTGGACCCCAGTTTCATCTGCATCTTCCAGACCTTCTTATCCGAATGTGGGTACAGTAGATCCCTCAGAATCAAATCGAATAACAAAGGACTTTTCTATCGATGCAGTTACAGTGGAAAAGAAAGACTCTCTTCCCCCAAAGCTACGTCTGAAACGCCTGTGGAACGGCGATCGTCAGGCAGAAGTTGCAGAGGACAGAGGAGAGTGCAGGAAAGTCAGCTGCATTGTTAATGCTCTCAGGTCTCCAGTCATCCCTGCAGAAACCAAGGCAGTGACTGATTCTTAGTAATGGCGAATGATATATTGGTCTATTCCTGTTTATGTAGAACTGCTACAGAATGGTTGAGTTTTATTGATTTCCAAACTTTCCTAATAGCGGATCCTTATTTAGTATTTTTTTTTCTTATTTGAGCATTCAGGGTGGACAATACCTCGAATACACAGGGGATGACTTAACTGTACAAACTGAAGACCTGAGTGTTTTTTTGCTTTTATTTTTGCCTTTTCTGGTGGTGACGTAAAACATTCAGTAGTAAAGAGCATTTTGATTGGTGGTTTTGAATCTCTCTGCTTAAAATGGCTCAGGAAAGCTCTTGGAATGGATGAATCTTGCACTTGGATTTTCAATTCTGGTCTTTGGGTTTATTTATATGTTATTCATGATGTCACCCCCCCCCCCCCATTCTTCTGGAATATATTGACTGCTTAGTTGTGTTTAAGGAAGAGCTCAGAAAAGTTAATACAGTTGGGCAACATCTCCGTTGTCTCATATTAATTGACTAGGGGAAGAAGATGAAGACAAGAGGCCAGATTTTATGCCAAAATTATTCACTGGGTACAGAAGAGAATACCTCATATTATGGTGATCCACTTAAGAGGGATCAACAACAAGTGGGCAGATCAAATGAGCAGGTAGAxxATxGxTxxxxxxxxxxxxxxxxxGxxxxxxxxxxxxxTxxxAxAxxGCAGTACTATTTACAAATATACCTCCTGTGCTCAAGCCACTTCTTTGGCCTGTAGGAAAGTGATTTATTGCTGCAATTCCATCAxTTxTxxTxxxAxCCxxxxxxxTxxxTxxxxxCxxxxTTTGTATxxGxGAxGAxTAATTCCTGTCGGGAAGTCGAGGAAGxGCxGCTTGCxxTCTTTATGACCTACGGGAAGTAGAGTTTAGAGAAATCGTGGATGGTGGGAAGAATTGGAACACAAAGCCTTTCAGTCTGCGATTTTTTTTCCCACACCACCGTCAGTTTATACCCTTAAACACGTATACATCTAACTCTGGTATGTTAATCATAGGATCTGATTCTATTATATACAGATTTGCTTTTTTTAACTCCTGCTTTCCCTTTGTATTGCCCCAAATCGTTTCTAACACATGAGATTCCACAATGCCTTGATATCTACATCTGCCTTTTCCCTTACCTGTGATATGTTCAACGGAATGTCAAAAAGGAGGTTTATTTTTTCCTTTTAAAGACCTGTCAAATCCTGTTTGGTTTGGACATAAATGTTACTCTTTGTAGAGGTATTAAGTTGCCTGGGCCTCAGGGACTAATTAATCTTCATGATCTGTGGCAGGTGAGTCTGATCCCTTGTCATTTAAGCCCTACATAGGAAGGTGCGTAGCACATACCAGAGTCGATGGAAAAATCATATGCGTGATCCTCTGCACATGTCATGTCCTCGCCGGTGCCTCTATGCACTGATAGGACTATACTTGCGAATCGATAGATTTTGTTGCCTTGATTATAATACCT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                          2     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     3     4     2     4     3     4     2     4     2     4     2     4     2     3     2     3     2     3     2     4     2     4     2     4     2     4     2     4     2     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     4     6     7     6     7     5     7     5     7     5     7     5     7     5     7     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     4     5     4     4     4     4     4     4     3     4     3     4     3     4     4     4     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     3     2     3     2     3     2     3     2     3     1     2     1     2     1     2     1     2     1     2     1     2     2     3     2     3     2     3     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     2     3     1     2     1     2     2     3     2     3     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     1     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
  5   1   1       add Spl       in                    IMAGE:8463296.5p GNCTCCTCTGCCTGGCCGGGGTAGCCTCCTTTTTTACCCATCTCACCTGCCTTATCTCTCACTCCGACTGTTTTTTCCTATAGTCCATCACCAGGTCTGAGCCCTGCTTTAAGTGGCAGCTGCTTTAACTTCACCACTGAAGAGATGAAACACTACCTGCAGGCCCAGGCTTGCTCTGTTTTAAACTACCACCTCAGTCCACGGACTTTCCCAAGATTCCCTGGTTTTATGATGGCTCCACGTCAGGCTCATTTTCCTCCAGAGGAGCAGTCATCGTTCCCCATCAAGTTGCAGCCCCCACCAATGGGACGCAAAAACAGAGAACATCATCAGAGCCAGGAAGAGATTCAGATTACTCTACAGCAAACACCTCTTGCAACTGCCATGAAGGTGGAGCCAATTTCTGATGATGAACGAACCTCAGACGATGATCTAGACTCTTCAGCGGAGAAAGATTTCCAGAGTGATGAGGAAGATGACTCGTTCTCTCCAAGAGAAGACCCTAGTAAGCAAGGGCATGCCTATATCAAGCCGGCTTCTCCATCTTGGACCCCAGTTTCATCTGCATCCTTCCAGACCTTCTTATCCGAATGTGGGTACAGCAAATCCCTCAGAATCACATCGAAATAACAAGGACTTTTCTATCGAGCCAGTACAGTGGGAAATATAGACTCCATTCCCCCAATGCTCGTCAGAAACCCCTGTGGAACGCCATCGTTCAGCAGAATTGAATA
  5   1   2       add Thy                             IMAGE:8549755.5p                                                                                                                                                                                                                                                                                                                                                                 CTCTACAGCAAACACCTCTTGCAACTGCCATGAAGGTGGAGCCAATTTCTGATGATGAACGAACCTCAGACGATGATCTAGACTCTTCAGCGGAGAAAGATTTCCAGAGTGATGAGGAAGATGACTCGTTCTCTCCAAGAGAAGAACCTAGTAAGCAAGGGCATGCCTTTATCAAGCCGGCTACTCCATCTTGGACCCCAGTTTCATCTGCATCTTCCAGACCTTCTTATCCGAATGTGGGTACAGTAGATCCCTCAGAATCAAATCGAATAACAAAGGACTTTTCTATCGATGCAGTTACAGTGGAAAAGAAAGACTCTCTTCCCCCAAAGCTACGTCTGAAACGCCTGTGGAACGGCGATCGTCAGGCAGAAGTTGCAGAGGACAGAGGAGAGTGCAGGAAAGTCAGCTGCATTGTTAATGCTCTCAGGTCTCCAGTCATCCCTGCAGAAACCAAGGCAGTGACTGATTCTTAGTAAATGGCGAATGATATATTGGTCTATTCCTGTTTATGTAGAACTGCTACAGAATGGTTGAGTTTTATTGATTTCCAAACTTTCCTAATAGCGGATCCCTATTTAGTAtttttttttttCTTATTTGAGCATTCAGGGTGGACATACCTCGAATACACTGGGAGGACTTACTGTACAACTGAAGACCCGAGTGTTATTGGCTTTATTTTGCCTTTTTGGGGTGACTAAAACTTTATAATAAGACCTTCTGTTGTGGTTTGACTTTCTGTCAGGAGCAGAAACTTTGATTTGATTCTGCTTGAttttttttttG
  5   1   2       bld Int2                            IMAGE:8528105.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTAGACTCTTCAGCGGAGAAAGATTTCCAGAGTGATGAGGAAGATGACTCGTTCTCTCCAAGAGAAGACCCTAGTAAGCAAGGGCATGCCTTTATCAAGCCGGCTACTCCATCTTGGACCCCAGTTTCATCTGCATCTTCCAGACCTTCTTATCCGAATGTGGGTACAGTAGATCCCTCAGAATCAAATCGAATAACAAAGGACTTTTCTATCGATGCAGTTACAGTGGAAAAGAAAGACTCTCTTCCCCCAAAGCTACGTCTGAAACGCCTGTGGAACGGCGATCGTCAGGCAGAAGTTGCAGAGGACAGAGGAGAGTGCAGGAAAGTCAGCTGCATTGTTAATGCTCTCAGGTCTCCAGTCATCCCTGCAGAAACCAAGGCAGTGACTGATTCTTAGTAATGGCGAATGATATATTGGTCTATTCCTGTTTATGTAGAACTGCTACAGAATGGTTGAGTTTTATTGATTTCCAAACTTTCCTAATAGCGGATCCTTATTTAGTAtttttttttCTTATTTGAGCATTCAGGGTGGACAATACCTCGAATACACAGGGGATGACTTAACTGTACAAACTGAAGACCTGAGTGtttttttgcttttatttatgccttttCTGGTGGTGACGTAAAACATTCAGTAGTAAAGAGCATTTTGATTGGTGGTTTTGAATCTCTCTGCTTAAAATGGCTCAGGAAAGCTCTTGNAATGGATGAA
  3   1   2      skin Tbd7 5g3  out                        XL095a11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCTTCAGCGGAGAAAGATTTCCAGAGTGATGAGGAAGATGACTCGTTCTCTCCAAGAGAAGACCCTAGTAAGCAAGGGCATGCCTTTATCAAGCCGGCTACTCCATCTTGGACCCCGGTTTCATCTGCATCTTCCAGACCTTCTTATCCGAATGTGGGTACAGTAGATCCCTCAGAATCAAATCGAATAACAAAGGACTTTTCTATCGATGCAGTTACAGTGGAAAAGAAAGACTCTCTTCCCCCAAAGCTACGTCTGAAACGCCTGTGGAACGGCGATCGTCAGGCAGAAGTTGCAGAGGACAGAGGAGAGTGCAGGAAAGTCAGCTGCATTGTTAATGCTCTCAGGTCTCCAGTCATCCCTGCAGAAACCAAGGCAGTGACTGATTCTTAGTAATGGCGAATGATATATTGGTCTATTCCTGTTTATGTAGAACTGCTACAGAATGGTTGAGTTTTATTGATTTCCAAACTTTCCAAATAGCGGATCCTTATTTAGTATTTTTTTTTCTTATTTTCAGGGTGGACAATACCTCGAATACACAGGGGATGACTTAACTGTACAAACTGAAGACCTGAGTGTTTTTTTGCTTTTATTTTTGCCTTT
  5   1   2       bld Tad2                            IMAGE:6935761.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGCAGCTGCATTGTTAATGCTCTCAGGTCTCCAGTCATCCCTGCAGAAACCAAGGCAGTGACTGATTCTTAGTAAATGGCGAATGATATATTGGTCTATTCCTGTTTATGTAGAACTGCTACAGAATGGTTGAGTTTTATTGATTTCCAAACTTTCCTAATAGCGGATCCTTATTTAGTAtttttttttCTTATTTGAGCATTCAGGGTGGACAATACCTCGAATACACAGGGGATGACTTAACTGTACAAACTGAAGACCTGAGTGtttttttgcttttatttttgccttttCTGGTGGTGACGTAAAACATTCAGTAGTAAAGAGCATTTTGATTGGTGGTTTTGAATCTCTCTGCTTAAAATGGCTCAGGAAAGCTCCTGGAATGGATGAATCTTGCACTTGGATTTTCCATTCTGGTCTTTGGGGCTCACTTAATAGGCATTCATGAATGccccccccccccccATTCTTCTGGAAAATTTTTGACTGCTTAAGTTTGTGGTTTCCACGAAGAACCTCCATAAAAGCTTAATACCAGCCTGGGCCAAACTCGCTCCGGTTGTCCTCACCAATAAAATGGAATTAGGGGGAAAGCAAGAATGCAAAGACAAAGAGGTCCCTCAATTTTTATCCCCCCAAAATAATTCCAATTGGGCTCCCTTAAGAATTAATTACCCTCCTTCATTTATGGGGGGATTCCCACTTTTAAATAGGGGTATTCCATTATCTTCAggggggggCCGCGAATCTAAATTGCGACCCACGCTCACAAAATATATATTCTCCCACGGTCCCTAAATG
  5   1   2       bld Egg1                               PBX0014G11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTTTTCTTATTTGAGCATTCAGGGTGGACAATACCTCGAATACACAGGGGATGACTTAACTGTACAAACTGAAGACCTGAGTGtttttttgcttttatttttgccttttCTGGTGGTGACGTAAAACATTCAGTAGTAAAGAGCATTTTGATTGGTGGTTTTGAATCTCTCTGCTTAAAATGGCTCAGGAAAGCTCTTGGAATGGATGAATCTTGCACTTGGATTTTCAATTCTGGTCTTTGGGTTTATTTATATGTTATTCATGATGTCAcccccccccccccATTCTTCTGGAATATATTGACTGCTTAGTTGTGTTTAAGGAAGAGCTCAGAAAAGTTAATACAGTTGGGCAACATCTCCGTTGTCTCATATTAATTGACTAGGGGAAGAAGATGAAGACAAGAGGCCAGATTTTATGCCAAAATTATTCACTGGGTACAGAAGAGAATACCTCATATTATGGTGATCCACTTAAGAGGGATCAACAACAAGTGGGCAGATCAAATGAG
  5   1   2       bld Egg1                               PBX0013G11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTTTCTTATTTGAGCATTCAGGGTGGACAATACCTCGAATACACAGGGGATGACTTAACTGTACAAACTGAAGACCTGAGTGtttttttgcttttatttttgccttttCTGGTGGTGACGTAAAACATTCAGTAGTAAAGAGCATTTTGATTGGTGGTTTTGAATCTCTCTGCTTAAAATGGCTCAGGAAAGCTCTTGGAATGGATGAATCTTGCACTTGGATTTTCAATTCTGGTCTTTGGGTTTATTTATATGTTATTCATGATGTCAcccccccccccccATTCTTCTGGAATATATTGACTGCTTAGTTGTGTTTAAGGAAGAGCTCAGAAAAGTTAATACAGTTGGGCAACATCTCCGTTGTCTCATATTAATTGACTAGGGGAAGAAGATGAAGACAAGAGGCCAGATTTTATGCCAAAATTATTCACTGGGTACAGAAGAG
  5   1   2      seed Egg1                               PBX0136A02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTATTTGAGCATTCAGGGTGGACAATACCTCGAATACACAGGGGATGACTTAACTGTACAAACTGAAGACCTGAGTGtttttttgcttttatttttgccttttCTGGTGGTGACGTAAAACATTCAGTAGTAAAGAGCATTTTGATTGGTGGTTTTGAATCTCTCTGCTTAAAATGGCTCAGGAAAGCTCTTGGAATGGATGAATCTTGCACTTGGATTTTCAATTCTGGTCTTTGGGTTTATTTATATGTTATTCATGATGTCAcccccccccccccATTCTTCTGGAATATATTGACTGCTTAGTTGTGTTTAAGGAAGAGCTCAGAAAAGTTAATACAGTTGGGCAACATCTCCGTTGTCTCATATTAATTGACTAGGGGAAGAAGATGAAGACAAGAGGCCAGATTTTATGCCAAAATTATTCACTGGGTACAGAAGAGAATACCTCATATTATGGTGATCCACTTAAGAGGGATCAACAACAAGTGGGCAGATCAAATGAGCAGGTAGAAGATAGTTCCAGGCCAATGGTCTCTGGGTCAGGAGGTAGTTTAATACAGCAGTACTATTTACAAATATACCTCCTGTGCTCAAGCCACTTCTTTGGCCTGTAGGAAAGTGATTTATTGCTGCAATTCCATCACTTTTTATTG
  3   1   0       add Ga12 5g3  out                        XL213h06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCTTTTTTTTTTTTTCCCTCCATTCTTCTGGATCAAATTGACTCCTGTTTAAGGAGAGCCCGGGAATGATAATACTCCTTGCAACTGAATAGAAGTGTGAAGATCCGTACAANCGGGAAATATACCACCTCTCTGAATCCTCTTGTGATTTAATGGGTTCATTGCTAAGAATGTGCACCAAAAGTCCATCCGTAGTTTAATACAGCAGTACTATTTACAAATATACCTCCTGTGCTCAAGCCAATTCTTTTGCCTGTAGGAAAAAAGACTTCTTGCTTCAATCCTGTCACTTTCTATTGAAACCCTGCAGTCTCATTGACTCCGTGTTTTGTATGTGTGACGACTAATTCCTGTCGGGAAGTCGAGGAAGTGCTGCTTGCGCTCTTTATGACCTACGGGAAGTAGAGTTTAGAGAAGTCATGGAAGGTGGGAATAATTGTAAGACAAAGCCTTGTTCTCAGTCTGGGGTTTTCCCATTGCCACTTTATACCCGTATACATCTAGATCTGGTATGTTAATCATAGATTCTGTCCTCTCAAGATATGTATATAGATTTAGCATTTTTAACTCCTGCTTTCCCTTTATATTCCCCCCTAAAACTTTTATANATAAGAGAT
  5   1   2      skin Egg1                               PBX0089F08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGAGCAGTACTATTTACAAATATACCTCCTGTGCTCAAGCCACTTCTTTGGCCTGTAGGAAAGTGATTTATTGCTGCAATTCCATCACTTTTTATTGGAACCCTGCAGTTGCATTGACTCAGTATTTGTATAGGCGATGAATAATTCCTGTGGGGAAGTCGAGGAAGCGCAGCTTGCAGTCTTTATGACCTACGGGAAGTAGAGTTTAGAGAAATCGTGGATGGTGGGAAGAATTGGAACACAAAGCCTTTCAGTCTGCGAttttttttCCCACACCACCGTCAGTTTATACCCTTAAACACGTATACATCTAACTCTGGTATGTTAATCATAGGATCTGATTCTATTATATACAGATTTGCttttttttAACTCCTGCTTTCCCTTTGTATTGCCCAAATTGTTTCTAACACAAGAGATTCCACAATGCCCTGATATCTACATCTGCCTTTTCCCTTACCTGTGACATGTTTAACGGAATGTCAAAAAGGAGGTTTATTTTTTCCTTTTAAAGACCTGTCAAATCCTGTTTGGTTTGGACATAA
  3   1   2       bld Spl       in                    IMAGE:8463296.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGTGATCGCATTATGACTGATCATGATCGATGATGGATGATATCTGGGAGTGAGAGGAGCTGCGTCTAGACTACGAGTAGAGTAGAGATCGTGATGTGGAGAATGACAGAGCTTTCGTCTTGATTTTTCCACACACCGCAGTTATAGCTTAAACAGATACATCTACTCTGGTAGTAATCATAGGATTGATTCTATTAATACAGATTNGCTTTTTTTAACTCCTGCTTTCCCTTTGTATTGCCCCAAATCGTTTCTAACACATGAGATTCCACAATGCCTTGATATCTACATCTGCCTTTTCCCTTACCTGTGATATGTTCAACGGAATGTCAAAAAGGAGGTTTATTTTTTCCTTTTAAAGACCTGTCAAATCCTGTTTGGTTTGGACATAAATGTTACTCTTTGTAGAGGTATTAAGTTGCCTGGGCCTCAGGGACTAATTAATCTTCATGATCTGTGGCAGGTGAGTCTGATCCCTTGTCATTTAAGCCCTACATAGGAAGGTGCGTAGCACATACCAGAGTCGATGGAAAAATCATATGCGTGATCCTCTGCACATGTCATGTCCTCGCCGGTGCCTCTATGCACTGATAGGACTATACTTGCGAATCGATAGATTTTGTTGCCTTGATTATAATACCTCTTTTATAGTTGGAATATAAATCAAAGTATCCCCCTCCAAAAAAAAAAAAAATATTGATACCTGTTTTTTTTTAAAACAAATCTGTAAATATCTATTTTTATTAGTGAATTTGTATTTTCTAAGTAAAGCTACAAGTATTTGTAAGCAGACCACCCCTGG
  3   1   2      skin Egg6                            IMAGE:4432923.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTCCCTTTGTATTGCCCCAAATCGTTTCTAACACATGAGATTCCACAATGCCTTGATATCTACATCTGCCTTTTCCCTTACCTGTGATATGTTCAACGGAATGTCAAAAAGGAGGTTTATTTTTTCCTTTTAAAGACCTGTCAAATCCTGTTTGGTTTGGACATAAATGTTACTCTTTGTAGAGGTATTAAGTTGCCTGGGCCTCAGGGACTAATTAATCTTCATGATCTGTGGCAGGTGAGTCTGATCCCTTGTCGTTCAAACCCTACATAGGAAGGTGCGTAGCACATACCAGAGTCGATGGAAAAATCATATGCGTGATCCTCTGCACATGTCATGTCCTCGCCGGTGCCTCTATGCACTGATAGGACTATACTTGCGAATCGATAGATTTTGTTGCCTTGATTATAATACCTC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)