Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:8550764.3                       7 END     1          25       14                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:3300840-IMAGp.5                 6 PI      93        371     1037                phospholipase C-gamma-1b [Xenopus laevis]
     3   0.0    0Xl3.1-IMAGE:5570528.5                       3 PI      86          2      341                phospholipase C-gamma-1a [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012785621 Xl3.1-IMAGE:8550764.5 - 4 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8550764.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATGTAGAGAAGCAAGAGGGAGGATGGTGGCGAGGAGACTGTGGGGGTAAAAAACAAATGTGGTTCCCTGCCAACTATGTGGAAGAGATATTTAGTCCCGCTGAGCCTGAACCTGAGAGGCAGAATCTAGATGAGAACAGTCCTCTAGGAGATCTACTGGGTGGAGTTTTGGATGTGCCATCCTGTCACATTGCTCCCCGACAGGACGTCCATAACGGCCGACCCTTTGTATTCACCATTACTGGTCCTCAGTTAAACCGATATCCACTTGATGTTGCTGCGGACACACTGGAAGACATGCAAGACTGGATACGGAAAATTCGGGAAGCAGCTCAAACTGCTGATGCACGGCTCACAGAAGGCAAAATCATGGAGCGCAGAAAGAAGATTGCCCTGGAACTCTCAGAACTTGTCATCTACTGCCGGCCAGTCCCCTTTGATGAAGAGAAGATTGGCACTGAAAAGGCCTGTTACCGTGACATGTCTTCATTCCCTGAGACCAAAGCAGAAAAGTATGTCAACAAGATGAAAGGGAAGAAATTCCTGCAGTACAACCGGCGGCAGCTCTCTCGTATCTATCCCAAAGGACAACGCCTTGATTCATCAAACTATGACCCCCTGACAATGTGGATCTGTGGCAGTCAACTTGTAGCGCTCAACTTCCAGACACCAGACAAACCCATGCAAATGAACCAGGCTCTTTTCCAGTCCGGGGGCCGTTGCGGTTATGTTTTTCAGCCAAACTGCATGAGAGATGAAGTTTTTGATCCGTTTGACAAAAGCACTCTTCGTCTGGAGACAATAACCGTCAGCATTGAGATCCTAGGTGCCCGCCATCTGCCCAAGATTGGAAAGGGTATTGTTTGCCCTTTTGTGGAGGTAGAAGTTTGTGGTACTGAATATGACATGCAAAGCAGAGACGATTTGTAGTGGATATGGCTTGATCCTGTCTGCACAGAAAACTTTCTCGTTTGTCATGCTAACCTGAGTCACTTTCTGCGATTTCGTCTTTGAAGAGACTGTTAGTGATCAGAACTCTGCTCAGCTTCATTGTGTCTGGCTAGCCGGATGATTCTTCATCAAATATACGCGAATCGAACTGCACCCTGTCCTTAAGATAGACATCGA
                                                  Xl3.1-CHK-1012706581                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGAAGCAAGAGGGAGGATGGTGGCGAGGAGACTGTGGGGGTAAAAAACAAATGTGGTTCCCTGCCAACTATGTGGAAGAGATATTTAGTCCCGCTGAGCCTGAACCTGAGAGGCAGAATCTAGATGAGAACAGTCCTCTAGGAGATCTACTGGGTGGAGTTTTGGATGTGCCATCCTGTCACATTGCTCCCCGACAGGACGTCCATAACGGCCGACCCTTTGTATTCACCATTACTGGTCCTCAGTTAAACCGATATCCACTTGATGTTGCTGCGGACACACTGGAAGACATGCAAGACTGGATACGGAAAATTCGGGAAGCAGCTCAAACTGCTGATGCACGGCTCACAGAAGGCAAAATCATGGAGCGCAGAAAGAAGATTGCCCTGGAACTCTCAGAACTTGTCATCTACTGCCGGCCAGTCCCCTTTGATGAAGAGAAGATTGGCACTGAAAAGGCCTGTTACCGTGACATGTCTTCATTCCCTGAGACCAAAGCAGAAAAGTATGTCAACAAGATGAAAGGGAAGAAATTCCTGCAGTACAACCGGCGGCAGCTCTCTCGTATCTATCCCAAAGGACAACGCCTTGATTCATCAAACTATGACCCCCTGACAATGTGGATCTGTGGCAGTCAACTTGTAGCGCTCAACTTCCAGACACCAGACAAACCCATGCAAATGAACCAGGCTCTTTTCCAGTCCGGGGGCCGTTGCGGTTATGTTTTTCAGCCAAACTGCATGAGAGATGAAGTTTTTGATCCGTTTGACAAAAGCACTCTTCGTCTGGAGACAATAACCGTCAGCATTGAGATCCTAGGTGCCCGCCATCTGCCCAAGATTGGAAAGGGTATTGTTTGCCCTTTTGTGGAGGTAGAAGTTTGTGGTACTGAATATGACATGCAAAGCAGAGACGATTTGTAGTGGATATGGCTTGATCCTGTCTGCACAGAAAACTTTCTCGTTTGTCATGCTAACCTGAGTCACTTTCTGCGATTTCGTCTTTGAAGAGACTGTTAGTGATCAGAACTCTGCTCAGCTTCATTGTGTCTGGCTAGCCGGATGATTCTTCATCAAATATACGCGAATCGAACTGCACCCTGTCCTTAAGATAGA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     3     1     3     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                                                       ...PROTEIN --- Xt ---- 3e-030     AAI53326.1 Unknown (protein for IMAGE:7660635) [Xenopus tropicalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 3e-045     NP_496205.1 phospholipase C gamma (2K519) [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 9e-052     NP_476726.2 CG4200-PA [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ag ---- 9e-067     XP_309496.4 AGAP011152-PA [Anopheles gambiae str. PEST] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 5e-074     XP_414166.2 PREDICTED: similar to 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase gamma 2 [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 4e-084     XP_001191015.1 PREDICTED: similar to phospholipase C-gamma [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 3e-125     NP_919388.1 phospholipase C, gamma 1 [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 4e-141     NP_002651.2 phospholipase C gamma 1 isoform a; 1-phosphatidylinositol-4,5-bisphosphatephosphodiesterase gamma 1; phosphoinositide phospholipase C; PLC-gamma-1;phospholipase C-gamma-1; phospholipase C-148; triphosphoinositidephosphodiesterase; phosphoinositidase C; mon [Homo sapiens]  ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 1e-141     XP_542998.2 PREDICTED: similar to 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase gamma 1 (Phosphoinositide phospholipase C) (PLC-gamma-1) (Phospholipase C-gamma-1) (PLC-II) (PLC-148) [Canis familiaris] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Bt ---- 5e-142     NP_776850.1 phospholipase C, gamma 1 (formerly subtype 148) [Bos taurus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 2e-142     NP_067255.2 phospholipase C, gamma 1; 1-phosphatidylinositol-4,5-bisphosphatephosphodiesterase gamma 1; cell differentiation and embryonic development [Musmusculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 2e-180     NP_001082278.1 phospholipase C-gamma-1b [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:8550764.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG---ATG---------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------TAG---------------------------------------------------------------------------------TGA---------TAGTGA---------------------------------------ATG------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ...
  5   1   2       bld Ga12                                 XL175h20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATGTAGAGAAGCAAGAGGGAGGATGGTGGCGAGGAGACTGTGGGGGTAAAAAACAAATGTGGTTCCCTGCCAACTATGTGGAAGAGATATTTAGTCCCGCTGAGCCTGAACCTGAGAGGCAGAATCTAGATGAGAACAGTCCTCTAGGAGATCTACTGGGTGGAGTTTTGGATGTGCCATCCTGTCACATTGCTCCCCGACAGGACGTCCATAACGGCCGACCCTTTGTATTCACCATTACTGGTCCTCAGTTAAACCGATATCCACTTGATGTTGCTGCGGACACACTGGAAGACATGCAAGACTGGATACGGAAAATTCGGGAAGCAGCTCAAACTGCTGATGCACGGCTCACAGAAGGCAAAATCATGGAGCGCAGAAAGAAGATTGCCCTGGAACTCTCAGAACTTGTCATTTACTGCCGGCCAGTCCCCTTTGATGAAGAGAAGATTGGCACTGAAAAGGCCTGTTACCGTGACATGTCTTCATTCCCTGAGACCAAAGCAGAAAAGTATGTCAACAAGATGAAAGGGAAGAAATTCCTGCAGTACAACCGGCGGCAGCTCTCTCGTATCTATCCCAAAGGACAACGCCTTGATTCATCAAACTATGACCCCCTGACAATGTGGATCTGTGGCAGTCAACTTGTAGCGCTCAA
  5   1   2       bld Thy       out                   IMAGE:8550764.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCAAGTTATTAGAGCCAGACATCGCATCGAATTCGTCCCCTCTAGGAGATCTACTGGGTGGAGTTTTGGATGTGCCATCCTGTCACATTGCTCCCCGACAGGACGTCCATAACGGCCGACCCTTTGTATTCACCATTACTGGTCCTCAGTTAAACCGATATCCACTTGATGTTGCTGCGGACACACTGGAAGACATGCAAGACTGGATACGGAAAATTCGGGAAGCAGCTCAAACTGCTGATGCACGGCTCACAGAAGGCAAAATCATGGAGCGCAGAAAGAAGATTGCCCTGGAACTCTCAGAACTTGTCATCTACTGCCGGCCAGTCCCCTTTGATGAAGAGAAGATTGGCACTGAAAAGGCCTGTTACCGTGACATGTCTTCATTCCCTGAGACCAAAGCAGAAAAGTATGTCAACAAGATGAAAGGGAAGAAATTCCTGCAGTACAACCGGCGGCAGCTCTCTCGTATCTATCCCAAAGGACAACGCCTCGATTCATCAAACTATGACCCCCTGACAATGTGGATCTGTGGCAGTCAACTTGTAGCGCTCAACTTCCAGACACCAGACAAACCCATGCAAATGAACCAGGCTCTTTTCCAGTCCGGGGGCCGTTGCGGTTATGTTTTTCAGCCAAACTGCATGAGAGATGAAGTTTTTGATCCGTTTGACAAAAGCACTCTTCGTCTGGAGACAATAACCGTCAGCATTGAGATCCTAGGTGCCCGCCATCTGCCCAAGATTGGAAAGGGTATTGTTTGCCCTTTTGTGGAGGTAGAAGTTTGTGGTACTGAATATGACATGCAAAGCAGAGACGATTTGTAGTGGATATGGCTTGATCCTGTCTGCACAGAAAACTTTCTCGTTTGTCATGCTAACCTGAGTCACTTTCTGCGATTTCGTCTTTGAAGAGACTGTTAGTGATCAGAACTCTGCTCAGCTTCATTGTGTCTGGCTAGCCGGATGATTCTTCATCAAATATACGCGAATCGAACTGCACCCTGTCCTTAAGATAGACATCGACTGA
  5   1   2       add Ga18                              xlk130m17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGAGAGGNAGCATCTAGATGAGAACAGTCCTCTAGGAGATCTGCTAGGTGGAGTTTTGGATGTGCCATCCTGTCACATTGTTCCCCGNNNNNNGTTTTTAATGGCCGACCCTTTGTATTCACCATTACTGGGCCTCAGTTAAACCGATATCCTCTTGATGTCGCTGCAGACACACTGGAAGACATGCAAGACTGGATAAGAAAAATTCGGGAAGCAGCTCAAACTGCTGATGCGCGGNTCACAGAAGGCAAAATTATGGAGCGCCGAAAGAAGATTGCCCTTGAACTCTCAGAACTTGTCATCTACTGCCGGCCAGTGCCCTTTGACGAAGAGAAGANTGGCACTGAAAAGGCCTGTTACCGTGACATGTCTTCCTTCCCTGAGACCAAAGCTGAAAAGTATGTCAACAAGATGAAAGGGAAGAAATTCCTCCAGTACAACCGGCGGNNNNNTCTCGTATCTATCCCAAAGGACAACGACTCGATTCATCAAACTATGACCCCCTGACAATGTGGATCTGTGGCAGTCAACTCGTAGCGCTCAACTTCCAGACACCAGACAAACCCATGCAAATGAACCAGGCTCTTTTCCAGTCCGGGGGCCGTTnnnnnnnnnTTTTTCAGCCNANTGCATG
  5   1   2      seed FaBN                            IMAGE:8077974.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTTAAACCGATATCCACTTGATGTTGCTGCGGACACACTGGAAGACATGCAAGACTGGATACGGAAAATTCGGGAAGCAGCTCAAACTGCTGATGCACGGCTCACAGAAGGCAAAATCATGGAGCGCAGAAAGAAGATTGCCCTGGAACTCTCAGAACTTGTCATTTACTGCCGGCCAGTCCCCTTTGATGAAGAGAAGATTGGCACTGAAAAGGCCTGTTACCGTGACATGTCTTCATTCCCTGAGACCAAAGCAGAAAAGTATGTCAACAAGATGAAAGGGAAGAAATTCCTGCAGTACAACCGGCGGCAGCTCTCTCGTATCTATCCCAAAGGACAACGCCTTGATTCATCAAACTATGACCCCCTGACAATGTGGATCTGTGGCAGTCAACTTGTAGCGCTCAACTTCCAGACACCAGACAAACCCATGCAAATGAACCAGGCTCTTTTCCAGTCCGGGGGCCGTTGCGGTTATGTTTTTCAGCCAAACTGCATGAGAGATGAAGTTTTTGATCCGTTTGACAAAAGCACTCTTCGTCTGGAAACAATAACCGTCAGCATTGAGATCCTAGGTGCCCGCCATCTGCCCAAGATTGGAAGGGGTATTGTTTGCCCTTTTGTGGAGGTAGAAGTTTGTGGTACTGAATATGACAATGCTAATCAAAAGACGGAATTTGTTGTGGATAAAGGCTCTGAACCTGTTTGGCNACAGAAAACGTTCTCTATTGCTATGGCAAACCCAGAGATTACTTCCTACAGATTGTCTACTATAAATAGAATAGTTTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)