Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:6949761.5                       7 PI      91         49      792                MGC84424 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012786125 Xl3.1-IMAGE:6950227.3 - 4 ESTs
                                                                       ..-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6950227.3                                                                                   TGCTTGAAGGGACAATTTTTCGGGTAAAAAGATTTAAAAAACCACGGTTTCCACGGGCTGCAGTTTTTAGAGCAGCAGGGTGATTATGGGGAACGCCAAGAGTGGGGCTATTCAAAAGAGATCCTGAAAGATTTAAAGAAAACACAAGGTATTCAGATGACGAACTCTGCAAATGGTACGAGAGTTTCAACAAGCAGTGTCCCGATGGCAAAATCACCCGCACCGAGTTTGAGAAGATCTATGCCAATTTCTTCCCCAATTCTGATCCCAAGAGCTACGCCCGGCACGTGTTCCGTAGCTTCGACACCAATGAAGATGGTACATTAGACTTTAGGGAGTACATCATTGCCCTGCACCTCACTTCTTCTGGAAAAACCAGCCTCAAACTAGAATGGGCATTTTCCCTGTTTGATGTAGACAAGAACGGGGAAATCAGCAAGGTGGAAGTGCTTGAGATTATCACTGCAATATTCAAGATGATCCCACCAGAAGAGCAGAAGAAACTGCCAGATGATGAAAATACCCCACAAAAAAGAGCAGACAAGCTATGGGCCTACTTCAAAAAGACTGAGGAAGCTAAAATAGCCGAGGGAGAATTCATCCAAGGCGTTATGATGAACGACGAGATCATGAGGCTTATTCAGTACGACCCGAAGAAATAAGCAGCCACCACTGAAGGAAGAGAAGATGGGGAAGCCCAAGTGAATGCCAATAAAATTCCGTGTGTTTGTGTTTGTGAGACAGCAATTCTTTTTCTCCATTTCAGAATAAAGTCATACAATGCATGTGTTGGTTTTAAAGCGCCAGTGCAATAGACTTATCCAGAAAAAACTTCTGGACTATATGGCACTAGTGACGAACCAAACAATGTTTTATTTCAGTTATTTACATTTTCTCCTTCGATAATATTAATATTCAGTAAACATCAGAATTGAGACAGTTATGCAGCTTATCCCACTACAGTTACTGTAAGAAGTAGTGAATTTTCCATTGTCTCATGTCACAGGTTTGGAGGGGGGGAAAAAAGTCTCATTTCGCATGAAATCCAGTCCTGGAATTGACATATGGATGATCTTAAGGGAAAATGAAAGCCATCTAAACCATGGAGTAGAAAAACTATTTCGGATTTGCTTCTTTGGTGAGCGGTCTTTTTACCAAGTTACCCTTGGAGCGGTTGCCTTCCCTAGGTTTTTTCCAAGGAATTTGAACCCCCGGTTAAGAAAGGTTTTTTTTAAAAAATTTGGGCCT
                                                  Xl3.1-CHK-1012707829                                                                                         AAGGGACAATTTTTCGGGTAAAAAGATTTAAAAAACCACGGTTTCCACGGGCTGCAGTTTTTAGAGCAGCAGGGTGATTATGGGGAACGCCAAGAGTGGGGCTATTCAAAAGAGATCCTGAAAGATTTAAAGAAAACACAAGGTATTCAGATGACGAACTCTGCAAATGGTACGAGAGTTTCAACAAGCAGTGTCCCGATGGCAAAATCACCCGCACCGAGTTTGAGAAGATCTATGCCAATTTCTTCCCCAATTCTGATCCCAAGAGCTACGCCCGGCACGTGTTCCGTAGCTTCGACACCAATGAAGATGGTACATTAGACTTTAGGGAGTACATCATTGCCCTGCACCTCACTTCTTCTGGAAAAACCAGCCTCAAACTAGAATGGGCATTTTCCCTGTTTGATGTAGACAAGAACGGGGAAATCAGCAAGGTGGAAGTGCTTGAGATTATCACTGCAATATTCAAGATGATCCCACCAGAAGAGCAGAAGAAACTGCCAGATGATGAAAATACCCCACAAAAAAGAGCAGACAAGCTATGGGCCTACTTCAAAAAGACTGAGGAAGCTAAAATAGCCGAGGGAGAATTCATCCAAGGCGTTATGATGAACGACGAGATCATGAGGCTTATTCAGTACGACCCGAAGAAATAAGCAGCCACCACTGAAGGAAGAGAAGATGGGGAAGCCCAAGTGAATGCCAATAAAATTCCGTGTGTTTGTGTTTGTGAGACAGCAATTCTTTTTCTCCATTTCAGAATAAAGTCATACAATGCATGTGTTGGTTTTAAAGCGCCAGTGCAATAAACTTATCCAGAAAAAACTTCTGGACTATATGGCACTAGTGACGAACCAAACAATGTTTTATTTCAGTTATTTACATTTTCTCCTTCGATAATATTAATATTCAGTAAACATCAGAATTGAGACAGTTATGCAGCTTATCCCACTACAGTTACTGTAAGAAGTAGTGAATTTTCCATTGTCTCATGTCACAGGTTTGGAGGGGGGGAAAAAAGTCTCATTTCGCATGAAATCCAGTCCTGGAATTGACATATGGATGATCTTAAGGGAAAATGAAAGCCATCTAAACCATGGAGTAGAAAAACTATTTCGGATTTGCTTCTTTGGTGAGCGGTCTTTTTACCAAGTTACCCTTGGAGCGGTTGCCTTCCCTAGGTTTTTTCCAAGGAATTTGAACCCCCGGTTAAGAAAGGTTTTTTTTAAAAAATTTGGGCCTCCACAA
                                                      consensus depths                                                                                        1     2     1     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     4     2     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH MIN     107      87                                                                                   
                                                                       PROTEIN --- Ci ---- 3e-023     NP_001027949.1 potassium channel-interacting protein KChIP [Ciona intestinalis] ------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                         PROTEIN --- Ce ---- 9e-038     NP_492651.1 neuronal Calcium Sensor (22.0 kD) (ncs-2) [Caenorhabditis elegans] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                               PREDICTED - Sp ---- 1e-047     XP_001177012.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                               PROTEIN --- Dm ---- 3e-048     NP_788543.1 Neurocalcin CG7641-PA [Drosophila melanogaster] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                               PROTEIN --- Ag ---- 7e-049     XP_308553.4 AGAP007247-PB [Anopheles gambiae str. PEST] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN --- Bt ---- 3e-068     NP_776590.1 recoverin [Bos taurus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN --- Mm ---- 3e-068     NP_033064.1 recoverin; guanylate cyclase activator; cancer associated retinopathy protein[Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN --- Hs ---- 2e-068     NP_002894.1 recoverin [Homo sapiens] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN --- Cf ---- 1e-068     NP_001014303.1 recoverin [Canis familiaris] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PREDICTED - Dr ---- 5e-071     NP_001025419.1 hypothetical protein LOC570333 [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN --- Gg ---- 4e-079     NP_990845.1 calcium binding protein [Gallus gallus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN --- Xt ---- 2e-094     NP_001008164.1 MGC79749 protein [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN --- Xl ---- 1e-100     NP_001087534.1 MGC84117 protein [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6950227.3                                                                                                                                                                   TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATGATG------------ATG---------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------TGA---ATG------------------TGA---------------------------------------------------TGA------------------------------------------TAG---------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                                ]
  3   1   2       bld Brn1      in                    IMAGE:6950227.3p                                                                                   TGCTTGAAGGGACAATTTTTCGGGTAAAAAGATTTAAAAAACCACGGTTTCCACGGGCTGCAGTTTTTAGAGCAGCAGGGTGATTATGGGGAACGCCAAGAGTGGGGCTATTCAAAAGAGATCCTGAAAGATTTAAAGAAAACACAAGGTATTCAGATGACGAACTCTGCAAATGGTACGAGAGTTTCAACAAGCAGTGTCCCGATGGCAAAATCACCCGCACCGAGTTTGAGAAGATCTATGCCAATTTCTTCCCCAATTCTGATCCCAAGAGCTACGCCCGGCACGTGTTCCGTAGCTTCGACACCAATGAAGATGGTACATTAGACTTTAGGGAGTACATCATTGCCCTGCACCTCACTTCTTCTGGAAAAACCAGCCTCAAACTAGAATGGGCATTTTCCCTGTTTGATGTAGACAAGAACGGGGAAATCAGCAAGGTGGAAGTGCTTGAGATTATCACTGCAATATTCAAGATGATCCCACCAGAAGAGCAGAAGAAACTGCCAGATGATGAAAATACCCCACAAAAAAGAGCAGACAAGCTATGGGCCTACTTCAAAAAGACTGAGGAAGCTAAAATAGCCGAGGGAGAATTCATCCAAGGCGTTATGATGAACGACGAGATCATGAGGCTTATTCAGTACGACCCGAAGAAATAAGCAGCCACCACTGAAGGAAGAGAAGATGGGGAAGCCCAAGTGAATGCCAATAAAATTCCGTGTGTTTGTGTTTGTGAGACAGCAATTCTTTTTCTCCATTTCAGAATAAAGTCATACAATGCATGTGTGGTTTTAAAGCGCCAGTTCCAATAAACTTATCAGAGA
  5   1   2       add Brn1      in                    IMAGE:6950227.5p                                                                                   GCTTGAAGGGACATTTTGTCTGGGTGAAAAGATTTAAAAAACACAGATTCCACGGCTGCAGGTTTTAGAGCAGCAGGGTGACTATGGGGAACGCCAAGAGTGGGGCTATTTCAAAAGAGATCCTGGAAGATCTTAAAGAAAACACAAGGTATTCAGATGACGAACTCTGCAAATGGTACGAGAGTTTCAACAAGCAGTGTCCCGATGGCAAAATCACCCGCACCGAGTTTGAGAAGATCTATGCCAATTTCTTCCCCAATTCTGATCCCAAGAGCTACGCCCGGCACGTGTTCCGTAGCTTCGACACCAATGAAGATGGTACATTAGACTTTAGGGAGTACATCATTGCCCTGCACCTCACTTCTTCTGGAAAAACCAGCCTCAAACTAGAATGGGCATTTTCCCTGTTTGATGTAGACAAGAACGGGGAAATCAGCAAGGTGGAAGTGCTTGAGATTATCACTGCAATATTCAAGATGATCCCACCAGAAGAGCAGAAGAAACTGCCAGATGATGAAAATACCCCACAAAAAAGAGCAGACAAGCTATGGGCCTACTTCAAAAAGACTGAGGAAGCTAAAATAGCCGAGGGAGAATTCATCCCAAGCGTTATGATGAACGACGAGATCATGAGGCTTATTCAGTACGACCCGAAGAAATAAGCAGCCACCACTGAAAGGAAGAGAAGATGGGGGAAGCCCAAGTGAATGCCCATAAAATTCCGTGTGTTTGTGTTTGTGAGACAGCAATTCTTTTTTCTCCTTTTCAGAATAAAGTCATACAATGCATGTGGTTGTTTTTAAAGCGCCAGTGCAATAAACTTATCCAGAAAAAACTTCTTGGACTAAATTGGTACTAAGGGACCAACCCTNTTTAAACTTACCAATGTTGCAAAGATACCCACGGCTTTCCTTATAAACCCA
  5   1   2      seed Brn1                            IMAGE:7018686.5p                                                                                                                                                                                                                                                                                                                                                              CCAAGAGCTACGCCCGGCACGTGTTCCGTAGCTTCGACACCAATGAAGATGGTACATTAGACTTTAGGGAGTACATCATTGCCCTGCACCTCACTTCTTCTGGAAAAACCAGCCTCAAACTAGAATGGGCATTTTCCCTGTTTGATGTAGACAAGAACGGGGAAATCAGCAAGGTGGAAGTGCTTGAGATTATCACTGCAATATTCAAGATGATCCCACCAGAAGAGCAGAAGAAACTGCCAGATGATGAAAATACCCCACAAAAAAGAGCAGACAAGCTATGGGCCTACTTCAAAAAGACTGAGGAAGCTAAAATAGCCGAGGGAGAATTCATCCAAGGCGTTATGATGAACGACGAGATCATGAGGCTTATTCAGTACGACCCGAAGAAATAAGCAGCCACCACTGAAGGAAGAGAAGATGGGGAAGCCCAAGTGAATGCCAATAAAATTCCGTGTGTTTGTGTTTGTGAGACAGCAATTCTTTTTCTCCATTTCAGAATAAAGTCATACAATGCATGTGTTGGTTTTAAAGCGCCAGTGCAATAAACTTATCCAGAAAAAACTTCTGGACTATATGGCACTAGTGACAAACCAAACAATGTTTTATTTCAGTTATTTACATTTTCTCCTTCAATAATATTAATATTCAGTAAACATCAGAATTGAGACAGTTATGCAGCTTATCCCACTACAGTTACTGTAAGAAGTAGTGAATTTTCCATTGTCTCATGTCACAAGTTTGGAggggggggAAAAAAGTCTCATTTCGCATGAAATCCAGTCCTGGAAATGACATATGGGATGAATTTAAAGGAAATGGAAAGCCATCAAAACCATGGAATAGA
  5   1   2       bld Brn1                            IMAGE:7018428.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GACAAGAACGGGGAAATCAGCAAGGTGGAAGTGCTTGAGATTATCACTGCAATATTCAAGATGATCCCACCGAGAATAGCAGAAGAAACTGCCAGATGATGAAAATACCCCACAAAAAAGAGCAGACAAGCTATGGGCCTACTTCAAAAAGACTGAGGAAGCTAAAATAGCCGAGGGAGAATTCATCCAAGGCGTTATGATGAACGACGAGATCATGAGGCTTATTCAGTACGACCCGAAGAAATAAGCAGCCACCACTGAAGGAAGAGAAGATGGGGAAGCCCAAGTGAATGCCAATAAAATTCCGTGTGTTTGTGTTTGTGAGACAGCAATTCTTTTTCTCCATTTCAGAATAAAGTCATACAATGCATGTGTTGGTTTTAAAGCGCCAGTGCAATAGACTTATCCAGAAAAAACTTCTGGACTATATGGCACTAGTGACGAACCAAACAATGTTTTATTTCAGTTATTTACATTTTCTCCTTCGATAATATTAATATTCAGTAAACATCAGAATTGAGACAGTTATGCAGCTTATCCCACTACAGTTACTGTAAGAAGTAGTGAATTTTCCATTGTCTCATGTCACAGGTTTGGAGGGGGGGAAAAAAGTCTCATTTCGCATGAAATCCAGTCCTGGAATTGACATATGGATGATCTTAAGGGAAAATGAAAGCCATCTAAACCATGGAGTAGAAAAACTATTTCGGATTTGCTTCTTTGGTGAGCGGTCTTTTTACCAAGTTACCCTTGGAGCGGTTGCCTTCCCTAGGTTTTTTCCAAGGAATTTGAACCCCCGGTTAAGAAAGGttttttttAAAAAATTTGGGCCTCCACAAATAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)