Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:4084929.3                      11 END     3          75       27                hypothetical protein LOC379270 [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL096i23.5                            2 PI      94        199      982                hypothetical protein LOC379270 [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012786385 Xl3.1-XL034g21.5 - 4 ESTs
                                                                       -850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL034g21.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AACAGCCTCAGATTCCACAGTCTGCGTTTCGATCCCCGCCAACTTCACAATGCACTTCTCCCTATAGTTCTCCTCAACATCAAGTGCAGACCAACCAACTGAGCCACCAAACTTCGCATGTGTTTTTGCCACCCAGCCCATCAACAGTGTCACCTCATCTATACCAGCAGGCACCTCCTCCCTATCCTAAGCAAAGTTCTCTTGGGTATATTCCCTATGGACCTGGTCTGAACAAGGGACCTATGAACAAGATAGAAATCACAGTTGAATCACAACAAAGACCTGGACCCACCTTGAATAGAAGTCCGTCACCAATAAATAACCAGTCTGCCCAAAGAAGCCAACAACATCCTGTTTATGTATCAAATGCACGTTCAGGGTCACCTTCAAGGGGAATACCTACCCAACCAAAGGCTTCATATAGTGGCAGCCCATTATTTATTACATATTCACAACCACCTACAACCACTGGGTCTCCTACCCCTTCTTCACGTGTTGTGATGTCTCCGTCTAATCCGACCGTGTTTAAAATCACCGTTGGACGTGCCCCAACTGAAAATCTATTAAATATAGTGGACCAAGAGCAGCATCCCAGCACACCAGAGCCTATACAGCCCATTTCCTTATTGCCAGTTTCGGGTGGAGACAAAGGAATCCATAAATATCACAGAAGTTCCAGCTCTGGGTCAGATGATTATGCATATACCCAAGCCTTATTACTGCATCAGAGGGCAAGAATGGAGCGGTTGGCTAAAGAGCTGAAACATGAAAAAGAGGAGCTGGAAAGACTGAAAGCAGAAGTGAATGGCATGGAGCATGATCTAATGCAGCGCCGCCTCCGGAGAGTGAGCTGTACAACAGCAATTCCAACTCCAGAAGAAATGACCAGACTGAGAGGTCTAAACAGGCAACTTCAAATAAATGTTGACTGTACACAGAAAAGAAATTGATCTGCTTCAGTCCCGAGGAATGGCAAAGCTTGATGTAAAAGCAATGAGTAACTTTTTATGACAACTTGTCACCTGGTCCTGCTGTTCCACCTATACTTGTAAAAAGGAGTCGTTCGGAAACCACTTCAGGAGAGAAGAAAAG
                                                  Xl3.1-CHK-1012708192                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCAGATTCCACAGTCTGCGTTTCGATCCCCGCCAACTTCACAATGCACTTCTCCCTATAGTTCTCCTCAACATCAAGTGCAGACCAACCAACTGAGCCACCAAACTTCGCATGTGTTTTTGCCACCCAGCCCATCAACAGTGTCACCTCATCTATACCAGCAGGCACCTCCTCCCTATCCTAAGCAAAGTTCTCTTGGGTATATTCCCTATGGACCTGGTCTGAACAAGGGACCTATGAACAAGATAGAAATCACAGTTGAATCACAACAAAGACCTGGACCCACCTTGAATAGAAGTCCGTCACCAATAAATAACCAGTCTGCCCAAAGAAGCCAACAACATCCTGTTTATGTATCAAATGCACGTTCAGGGTCACCTTCAAGGGGAATACCTACCCAACCAAAGGCTTCATATAGTGGCAGCCCATTATTTATTACATATTCACAACCACCTACAACCACTGGGTCTCCTACCCCTTCTTCACGTGTTGTGATGTCTCCGTCTAATCCGACCGTGTTTAAAATCACCGTTGGACGTGCCCCAACTGAAAATCTATTAAATATAGTGGACCAAGAGCAGCATCCCAGCACACCAGAGCCTATACAGCCCATTTCCTTATTGCCAGTTTCGGGTGGAGACAAAGGAATCCATAAATATCACAGAAGTTCCAGCTCTGGGTCAGATGATTATGCATATACCCAAGCCTTATTACTGCATCAGAGGGCAAGAATGGAGCGGTTGGCTAAAGAGCTGAAACATGAAAAAGAGGAGCTGGAAAGACTGAAAGCAGAAGTGAATGGCATGGAGCATGATCTAATGCAGCGCCGCCTCCGGAGAGTGAGCTGTACAACAGCAATTCCAACTCCAGAAGAAATGACCAGACTGAGAGGTCTAAACAGGCAACTTCAAATAAATGTTGACTGTACACAGAAAAGAAATTGATCTGCTTCAGTCCCGAGGAATGGCAAAGCTTGATGTAAAAGCAATGAGTAACTTTTTATGACAACTTGTCACCTGGTCCTGCTGTTCCACCTATACTTGTAAAAAGGAGTCGTTCGGAAACCACTTCAGGAGAGAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Sp ---- 1e-014     XP_001176907.1 PREDICTED: similar to Map3k7ip2 protein [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                        PREDICTED - Xt ---- 1e-032     NP_001090763.1 hypothetical protein LOC100037849 [Xenopus tropicalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                              PREDICTED - Bt ---- 4e-038     XP_592279.2 PREDICTED: similar to mitogen-activated protein kinase kinase kinase 7 interacting protein 2 isoform 1 [Bos taurus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                     PREDICTED - Dr ---- 5e-058     NP_001038570.1 hypothetical protein LOC566547 [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = ?? ==== 6e-123     XP_001789634.1 PREDICTED: similar to mKIAA4135 protein, partial [Bos taurus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                          PROTEIN --- Hs ---- 1e-124     NP_690000.2 mitogen-activated protein kinase kinase kinase 7 interacting protein 3 [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                          PREDICTED - Mm ---- 1e-125     NP_080005.2 hypothetical protein LOC66724 [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Cf ---- 5e-122     XP_860534.1 PREDICTED: similar to TAK1-binding protein 3 isoform 2 isoform 2 [Canis familiaris] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                         PREDICTED - Gg ---- 1e-132     XP_416787.2 PREDICTED: similar to Mitogen-activated protein kinase kinase kinase 7 interacting protein 3 [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                  PREDICTED - Xl ---- 0          NP_001079583.1 hypothetical protein LOC379270 [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-XL034g21.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG------------ATG------------------------------------------------------ATG---------------------------------------------------------------TGA------------------------------TGA---------------TAA------ATG---------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ...
  5   1   2       bld Sp1       out                   IMAGE:4964093.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AACAGCCTCAGATTCCACAGTCTGCGTTTCGATCCCCGCCAACTTCACAATGCACTTCTCCCTATAGTTCTCCTCAACATCAAGTGCAGACCAACCAACTGAGCCACCAAACTTCGCATGTGTTTTTGCCACCCAGCCCATCAACAGTGTCACCTCATCTATACCAGCAGGCACCTCCTCCCTATCCTAAGCAAAGTTCTCTTGGGTATATTCCCTATGGACCTGGTCTGAACAAGGGACCTATGAACAAGATAGAAATCACAGTTGAATCACAACAAAGACCTGGACCCACCTTGAATAGAAGTCCGTCACCAATAAATAACCAGTCTGCCCAAAGAAGCCAACAACATCCTGTTTATGTATCAAATGCACGTTCAGGGTCACCTTCAAGGGGAATACCTACCCAACCAAAGGCTTCATATAGTGGCAGCCCATTATTTATTACATATTCACAACCACCTACAACCACTGGGTCTCCTACCCCTTCTT
  5   1   2      seed Neu7      out                        XL034g21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCAAAGACCTGGNACCCACCTTGAATAGAAGTCCGTCACCAATAAATAACCAGTCTGCCCAAAGAAGCCAACAACATCCTGTTTATGGATCAAATGCACGTTCAGGGTCACCTTCAAGGGGAATACCTACCCAACCAAAGGCTTCATATAGTGGCAGCCCATTATTTATTACATATTCACAACCACCTACAACCACTGGGTCTCCTACCCCTTCTTCACGTGTTGTGATGTCTCCGTCTAATCCGACCGTGTTTAAAATCACCGTTGGACGTGCCCCAACTGAAAATCTATTAAATATAGTGGACCAAGAGCAGCATCCCAGCACACCAGAGCCTATACAGCCCATTTCCTTATTGCCAGTTTCGGGTGGAGACAAAGGAATCCATAAATATCACAGAAGTTCCAGCTCTGGGTCAGATGATTATGCATATACCCAAGCCTTATTACTGCATCAGAGGGCAAGAATGGAGCGGTTGGCTAAAGAGCTGAAACATGAAAAAGAGGAGCTGGAAAGACTGAAAGCAGAAGTGAATGGCATGGAGCATGATCTAATGCAGCGCCGCCTCCGGAGAGTGAGCTGTACAACAGCAATTCCAACTCCAGAAGAAATGACCAGACTGAGA
  5   1   2       bld Em10                            IMAGE:8321421.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCAAGGGGAATACCTACCCAACCAAAGGCTTCATATAGTGGCAGCCCATTATTTATTACATATTCACAACCACCTACAACCACTGGGTCTCCTACCCCTTTTTCACGTGTTGTGATGTCTCCGTCTAATCCGACCGTGTTTAAAATCACCGTTGGACGTGCCCCAACTGAAAATCTATTAAATATAGTGGACCAAGAGCAGCATCCCAGCACACCAGAGCCTATACAGCCCATTTCCTTATTGCCAGTTTCGGGTGGAGACAAAGGAATCCATAAATATCACAGAAGTTCCAGCTCTGGGTCAGATGATTATGCATATACCCAAGCCTTATTACTGCATCAGAGGGCAAGAATGGAGCGGTTGGCTAAAGAGCTGAAACATGAAAAAGAGGAGCTGGAAAGACTGAAAGCAGAAGTGAATGGCATGGAGCATGATCTAATGCAGCGCCGCCTCCGGAGAGTGAGCTGTACAACAGCAATTCCAACTCCAGAAGAAATGACCAGACTGAGAGGTCTAAACAGGCAACTTCAAATAAATGTTGACTGTACACAGAAAAGAAATTGATCTGCTTCAGTCCCGAGGAATGGCAAAGCTTGATGTAAAAGCAATGAGTAACTTTTTATGACAACTTGTCACCTGGTCCTGCTGTTCCACCTATACTTGTAAAAAGGAGTCGTTCGGAAACCACTTCAGGAGAGAAGAAAAGCCCA
  5   1   2       bld Neu4      out                   IMAGE:4084929.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTACCCCTTCTTCACGTGTTGTGATGTCTCCGTCTAATCCGACCGTGTTTAAAATCACCGTTGGACGTGCCCCAACTGAAAATCTATTAAATATAGTGGACCAAGAGCAGCATCCCAGCACACCAGAGCCTATACAGCCCATTTCCTTATTGCCAGTTTCGGGTGGAGACAAAGGAATCCATAAATATCACAGAAGTTCCAGCTCTGGGTCAGATGATTATGCATATACCCAAGCCTTATTACTGCATCAGAGGGCAAGAATGGAGCGGTTGGCTAAAGAGCTGAAACATGAAAAAGAGGAGCTGGAAAGACTGAAAGCAGAAGTGAATGGCATGGAGCATGATCTAATGCAGCGCCGCCTCCGGAGAGTGAGCTGTACAACAGCAATTCCAACTCCAGAAGAAATGACCAGACTGAGAGGTCTAAACAGGCAACTTCAAATAAATGTTGACTGTACACAGAAAGAAATTGATCTGCTTCAGTCCCGAGGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)