Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 96%

 1012787468 Xl3.1-IMAGE:7394393.5 - 3 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7394393.5 CAGGAATAGCTGTCCGGCTGGAGTCAAGGCGCTAGACGTTAACGGAGCTGCGGGACTTTTAAACAGCGAACCGGGTCTACTCTGCCGGCTGTGTTAATAAAATCGGAAAAGCGGAAAGCCATCTGGGCGGTGGATCTGTGAAAATGGCTGGGGACTGACCTTACTTTGCTTATGCAAGGATACACAGCTTACACTGTGACATACATGATTTTGATAGGATAAGGTTTTTCGAATGATTGGTGTTAATTATGGATCCTGGTGGTGGTGGCCTAGGCCTGCATGTAGAAGAAACCAAAATACCCCATGCCATGATCATGCAGGACTTTGTGACTGGGATGGCTGGCACCGCTCATGTTGATGGAGACCACATTGTTGTTTCTGTTCCTGAAGCTGTCTTAGTCTCGGAAGTTATCACAGATGATGACATTGCACTGGAACATGATCTGTCAGATGAAGTTGTTCAAGGTCCTGATATCATCACAGAGGCTGAAAGTGTCATTGTTCCCGAATCAGTGCTGGAAACTAATGTTGCCATTGAGGAGGCTTTGGATGACAGTCACCATGTGTTGGAATCAGACATCATTACTGAAACAGTCACAGTTCCTGAGCAAGTATTTGTGGCTGACCTAGTCACAGACAGAGATGGCCAGCTGGAACATGTAGTCCAGGACTCTATTCATGGATCCCACTCGCCCACAATGGTTTCCCAAGAGGTCCTTGTAGCCAGTTGTCATGCAGATGCTGTTATCCAAGTGCCCACCCATTCAGCCTCAGGTTCATCTGTAACTATAAAGACTGAAGATGATGAAATAAAAACACCTCTGAAGATATCTATGATATCATGTAGTTAAGGGACATCCATATAAGACATCATAT
                                                  Xl3.1-CHK-1012713799       TAGCTGTCCGGCTGGAGTCAAGGCGCTAGACGTTAACGGAGCTGCGGGACTTTTAAACAGCGAACCGGGTCTACTCTGCCGGCTGTGTTAATAAAATCGGAAAAGCGGAAAGCCATCTGGGCGGTGGATCTGTGAAAATGGCTGGGGACTGACCTTACTTTGCTTATGCAAGGATACACAGCTTACACTGTGACATACATGATTTTGATAGGATAAGGTTTTTCGAATGATTGGTGTTAATTATGGATCCTGGTGGTGGTGGCCTAGGCCTGCATGTAGAAGAAACCAAAATACCCCATGCCATGATCATGCAGGACTTTGTGACTGGGATGGCTGGCACCGCTCATGTTGATGGAGACCACATTGTTGTTTCTGTTCCTGAAGCTGTCTTAGTCTCGGAAGTTATCACAGATGATGACATTGCACTGGAACATGATCTGTCAGATGAAGTTGTTCAAGGTCCTGATATCATCACAGAGGCTGAAAGTGTCATTGTTCCCGAATCAGTGCTGGAAACTAATGTTGCCATTGAGGAGGCTTTGGATGACAGTCACCATGTGTTGGAATCAGACATCATTACTGAAACAGTCACAGTTCCTGAGCAAGTATTTGTGGCTGACCTAGTCACAGACAGAGATGGCCAGCTGGAACATGTAGTCCAGGACTCTATTCATGGATCCCACTCGCCCACAATGGTTTCCCAAGAGGTCCTTGTAGCCAGTTGTCATGCAGATGCTGTTATCCAAGTGCCCACCCxTxxAGCCTCAGGTTCATCTGTAACTATAAAGACTGAAGATGATGAAATAAAAACACCTCTGAAGATATCTATGATATCATGTAGTTAAGGGACATCCATATAAGACA
                                                      consensus depths      1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     1     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     1     1     1
                                               BLH ATG     248     446 
                                               BLH MIN     248      59 
                                               BLH MPR     248      59 
                                               BLH OVR     248     557 
                                               CDS MIN     248      59 
                                               ORF LNG     248      28 
                                                                                                                                                                                                                                                                                                                               PREDICTED = Dr ==== 3e-031     XP_001918711.1 PREDICTED: hypothetical protein [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED = Gg ==== 2e-055     XP_420253.2 PREDICTED: similar to Zinc finger protein 711 (Zinc finger protein 6) [Gallus gallus] =========================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                               PROTEIN === Mm ==== 4e-062     NP_808415.2 zinc finger protein 711 [Mus musculus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                               PROTEIN === Hs ==== 4e-063     NP_068838.3 zinc finger protein 6 [Homo sapiens] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                               PREDICTED = Bt ==== 3e-063     XP_604385.3 PREDICTED: similar to Zinc finger protein 711 isoform 2 [Bos taurus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                               PREDICTED = Cf ==== 7e-064     XP_860957.1 PREDICTED: similar to Zinc finger protein 6 isoform 5 [Canis familiaris] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                               PROTEIN === Xt ==== 8e-095     AAI60417.1 Unknown (protein for MGC:135471) [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                               PROTEIN === Xl ==== 1e-101     AAI10743.1 Unknown (protein for IMAGE:7394393) [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:7394393.5                                 TAG------------------------TAA---------------------------------------------------------------------------------ATG---------TGA---------------------------------------------------------------------------TGA------------ATG---------------------------------------------------------ATG---ATG------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG------------TAA------------TAA
                                                                   ORF                                                                                                                                                                                                                                                         [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ...
  5   1   2      seed DMZ       in                         xl243p12.5p CAGGAATAGCTGTCCGGCTGGAGTCAAGGCGCTAGACGTTAACGGAGCTGCGGGACTTTTAAACAGCGAACCGGGTCTACTCTGCCGGCTGTGTTAATAAAATCGGAAAAGCGGAAAGCCATCTGGGCGGTGGATCTGTGAAAATGGCTGGGGACTGACCTTACTTTGCTTATGCAAGGATACACAGCTTACACTGTGACATACATGATTTTGATAGGATAAGGTTTTTCGAATGATTGGTGTTAATTATGGATCCTGGTGGTGGTGGCCTAGGCCTGCATGTAGAAGAAACCAAAATACCCCATGCCATGATCATGCAGGACTTTGTGACTGGGATGGCTGGCACCGCTCATGTTGATGGAGACCACATTGTTGTTTCTGTTCCTGAAGCTGTCTTAGTCTCGGAAGTTATCACAGATGATGACATTGCACTGGAACATGATCTGTCAGATGAAGTTGTTCAAGGTCCTGATATCATCACAGAGGCTGAAAGTGTCATTGTTCCCGAATCAGTGCTGGAAACTAATGTTGCCATTGAGGAGGCTTTGGATGACAGTCACCATGTGTTGGAATCAGACATCATTACTGAAACAGTCACAGTTCCTGAGCAAGTATTTGTGGCTGACCTAGTCACAGACAGAGATGGCCAGCTGGAACATGTAGTCCAGGACTCTATTCATGGATCCCACTCGCCCACAATGG
  5   1   2       bld Te2  5g                         IMAGE:7394393.5p                                                                                     GCCGGCTGTGTTATAAAATCGGAAAAGCGGAAAGCCATCTGGGCGGTGGATCTGTGAAAATGGCTGGGGACTGACCTTACTTTGCTTATGCAAGGATACACAGCTTACACTGTGACATACATGATTTTGATAGGATAAGGTTTTTCGAATGATTGGTGTTAATTATGGATCCTGGTGGTGGTGGCCTAGGCCTGCATGTAGAAGAAACCAAAATACCCCATGCCATGATCATGCAGGACTTTGTGACTGGGATGGCTGGCACCGCTCATGTTGATGGAGACCACATTGTTGTTTCTGTTCCTGAAGCTGTCTTAGTCTCGAAAGTTATCACAGATGATGACATTGCACTGGAACATGATCTGTCAGATGAAGTTGTTCAAGGTCCTGATATCATCACAGAGGCTGAAAGTGTCATTGTTCCCGAATCAGTGCTGGAAACTAATGTTGCCATTGAGGAGGCTTTGGATGACAGTCACCATGTGTTGGAATCAGACATCATTACTGAAACAGTCACAGTTCCTGAGCAAGTATTTGTGGCTGACCTAGTCACAGACAGAGATGGCCAGCTGGAACATGTAGTCCAGGACTCTATTCATGGATCCCACTCGCCCACAATGGTTTCCCAAGAGGTCCTTGTAGCCAGTTGTCATGCAGATGCTGTTATCCAAGTGCCCACCCATTCAGCCTCANGTTCATCTGTAACTATNAAGACTGAAGATGATGAAATAAAAACACCTCTGAAGATATCTATGATATCATGTAGTTAAGGGACATCCATATAAGACATCATATTTTTaaaaaaaaaaaaaaaaaaaaaaaGGCGCCGCTATACTCAGATGTCCTAATGG
  3   1   2       bld DMZ       in                         xl243p12.3p                                                                                                                                                             GACCTTACTTTGCTTATGCAAGGATACACAGCTTACACTGTGACATACATGATTTTGATAGGATAAGGTTTTTCGAATGATTGGTGTTAATTATGGATCCTGGTGGTGGTGGCCTAGGCCTGCATGTAGAAGAAACCAAAATACCCCATGCCATGATCATGCAGGACTTTGTGACTGGGATGGCTGGCACCGCTCATGTTGATGGAGACCACATTGTTGTTTCTGTTCCTGAAGCTGTCTTAGTCTCGGAAGTTATCACAGATGATGACATTGCACTGGAACATGATCTGTCAGATGAAGTTGTTCAAGGTCCTGATATCATCACAGAGGCTGAAAGTGTCATTGTTCCCGAATCAGTGCTGGAAACTAATGTTGCCATTGAGGAGGCTTTGGATGACAGTCACCATGTGTTGGAATCAGACATCATTACTGAAACAGTCACAGTTCCTGAGCAAGTATTTGTGGCTGACCTAGTCACAGACAGAGATGGCCAGCTGGAACATGTAGTCCAGGACTCTATTCATGGATCCCACTCGCCCACAATGGTTTCCCAAGAGGTCCTTGTAGCCAGTTGTCATGCAGATGCTGTTATCCAAGTGCCCACCATTCAAGCCTCAGGTTCATCTGTAACTATAAAGACTGAAGATGATGAAATAAAAAACACCTCTGAAGATTATCTAATGATATCATGAAGTAAGGGAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)