Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL108i10.3                            5 END     2          66       40                (no blast hit)

 This cluster: approximate FL confidence score = 89%

 1012789090 Xl3.1-XL108i10.5 - 3 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL108i10.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTAGAATGATTGAGGTATTTAATTTGATTTAGAATTCGTCCCCGCTCGTGTCATGGCAAGTTTTTTTTCTTCTAAGAAGCTGTGGTATTAAGGAACTGTTTCTTCAGAAAGCTTTTTTTTCTTCCAGCAAGCAGGAAGCAGTGGGTCATATATACCACAGGCAGGTCGTCTTATTGGCATTTGTATGTGGAAATAGGGATCTCTCTCTCTTACTGCACTGCCCACAGCACGGGATAACTTTTACACCATGGGCACACTGGGTGATATGTTGGTTCTAGTAGACTTTAAGGGGCAACTTGATGATGAGTTAAAAATAAAAACTGGAGATGTCATACAGAATGTGAAGAAAACAGCAGAAGAAGGCTGGCTAGAAGGAGAGTTCAATGGGAAGAGGGGCTTCTTCCCCCAAATGTTTGTGAAGGAAATCCCTCCATTCTTCCTAAATGACAATGCACAGAGGTACCCAAGGTCGATCAGGAAACCTAATGCATCCATTGTACCTAAGAATCCCCAGGAGGAGCTCCCAGACACACAGGCACCCACTGATGATGGTTATGCTGGGGTCAATAAGAAGAAACGTTGGTGCAGAGTCGAGTATACCTACAAAGCAAGCAGTGCCGATGAGCTGGATCTCTCTGTAGGGGATACTTTTGAAGTATTAGAAGAGATTGAAGATGGCTGGTACTTAGGCAAGAAAGGAGATGTAGTTGGTGCTTTTCCATCTAACTTTGTAAAAGAAATCCCAGAGCCTCCTTCTGATAAAATACCAGAACATTCAAAAAATGCCAAAAAGAGGCCAGCAATGATGGATATTAACTTCTCAGCCAAAGAAGAAGGGAAGTGTAAACAAGATGATAAACCAGTACCGGAGAACCAAAGCAAAGTAGACTCTTCACTTCCTCAGCCCAAGAATATTGTAGGGTCATGTTCAACTATATACCTTTTCTACCTGATGAACTTGCATTAAAGAAGGTGATGTGATACTGCTCATAAGCAGGAGACAGGAATGAGTGGTGGCAGGAAACTAATGGGAAACTGGGCTGTTCGACACTTTGTTAACATCTCGAATTGCAAAAAACAACAACTTCCACCCGAACTTCAACT
                                                  Xl3.1-CHK-1012714095                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGATTGAGGTATTTAATTTGATTTAGAATTCGTCCCCGCTCGTGTCATGGCAAGTTTTTTTTCTTCTAAGAAGCTGTGGTATTAAGGAACTGTTTCTTCAGAAAGCTTTTTTTTCTTCCAGCAAGCAGGAAGCAGTGGGTCATATATACCACAGGCAGGTCGTCTTATTGGCATTTGTATGTGGAAATAGGGATCTCTCTCTCTTACTGCACTGCCCACAGCACGGGATAACTTTTACACCATGGGCACACTGGGTGATATGTTGGTTCTAGTAGACTTTAAGGGGCAACTTGATGATGAGTTAAAAATAAAAACTGGAGATGTCATACAGAATGTGAAGAAAACAGCAGAAGAAGGCTGGCTAGAAGGAGAGTTCAATGGGAAGAGGGGCTTCTTCCCCCAAATGTTTGTGAAGGAAATCCCTCCATTCTTCCTAAATGACAATGCACAGAGGTACCCAAGGTCGATCAGGAAACCTAATGCATCCATTGTACCTAAGAATCCCCAGGAGGAGCTCCCAGACACACAGGCACCCACTGATGATGGTTATGCTGGGGTCAATAAGAAGAAACGTTGGTGCAGAGTCGAGTATACCTACAAAGCAAGCAGTGCCGATGAGCTGGATCTCTCTGTAGGGGATACTTTTGAAGTATTAGAAGAGATTGAAGATGGCTGGTACTTAGGCAAGAAAGGAGATGTAGTTGGTGCTTTTCCATCTAACTTTGTAAAAGAAATCCCAGAGCCTCCTTCTGATAAAATACCAGAACATTCAAAAAATGCCAAAAAGAGGCCAGCAATGATGGATATTAACTTCTCAGCCAAAGAAGAAGGGAAGTGTAAACAAGATGATAAACCAGTACCGGAGAACCAAAGCAAAGTAGACTCTTCACTTCCTCAGCCCAAGAATATTGTAGGGTCATGTTCAACTATATACCTTTTCTACCTGATGAACTTGCATTAAAGAAGGTGATGTGATACTGCTCATAAGCAGGAGACAGGAATGAGTGGTGGCAGGAAACTAATGGGAAACTGGGCTGTTCGACACTTTGTTAACATCTCGAATTGCAAAAAACAACAACTTCCACCCGAACT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     247     104                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     139      56                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     247     225                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     247       9                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PROTEIN --- Ce ---- 2e-010     NP_503037.1 EF hand and SH3 domain containing protein [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Dm ---- 8e-013     NP_733405.2 CG31012-PC [Drosophila melanogaster] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Sp ---= 3e-015     XP_001195816.1 PREDICTED: similar to SH3-domain kinase binding protein 1 [Strongylocentrotus purpuratus] ================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ag ---- 3e-017     XP_313115.3 AGAP004211-PA [Anopheles gambiae str. PEST] ================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Bt ==== 4e-024     NP_001121972.1 SH3-domain kinase binding protein 1 [Bos taurus] =========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Gg ---- 2e-026     NP_001025976.1 SH3-domain kinase binding protein 1 [Gallus gallus] ----------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Cf ---- 2e-027     XP_532162.2 PREDICTED: similar to CD2-associated protein [Canis familiaris] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = ?? ==== 2e-027     XP_612512.4 PREDICTED: CD2-associated protein, partial [Bos taurus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Hs ==== 2e-028     NP_036252.1 CD2-associated protein [Homo sapiens] =====================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Mm ==== 1e-028     NP_033977.3 CD2-associated protein [Mus musculus] =====================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED = Dr ==== 1e-040     NP_001032509.1 hypothetical protein LOC641492 [Danio rerio] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xt ==== 4e-119     AAI60597.1 Unknown (protein for IMAGE:7716022) [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED = Xl ==== 3e-128     NP_001108312.1 hypothetical protein LOC100137714 [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-XL108i10.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAG------TGA------TAA------------------------------ATG---------------------------------TAA---------------------------------------------------------------------------------------------ATG------TAG---------------------------------------------------ATG---------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG------------------------------------------------------------------------------------------------------------------------------------------------ATG---------TAA------TGA------------------------------ATG------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ...
  5   1   2      skin Int2 5g3  out                   IMAGE:8822908.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTAGAATGATTGAGGTATTTAATTTGATTTAGAATTCGTCCCCGCTCGTGTCATGGCAAGttttttttCTTCTAAGAAGCTGTGGTATTAAGGAACTGTTTCTTCAGAAAGCttttttttCTTCCAGCAAGCAGGAAGCAGTGGGTCATATATACCACAGGCAGGTCGTCTTATTGGCATTTGTATGTGGAAATAGGGATCTCTCTCTCTTACTGCACTGCCCACAGCACGGGATAACTTTTACACCATGGGCACACTGGGTGATATGTTGGTTCTAGTAGACTTTAAGGGGCAACTTGATGATGAGTTAAAAATAAAAACTGGAGATGTCATACAGAATGTGAAGAAAACAGCAGAAGAAGGCTGGCTAGAAGGAGAGTTCAATGGGAAGAGGGGCTTCTTCCCCCAAATGTTTGTGAAGGAAATCCCTCCATTCTTCCTAAATGACAATGCACAGAGGTACCCAAGGTCGATCAGGAAACCTAATGCATCCATTGTACCTAAGAATCCCCAGGAGGAGCTCCCAGACACACAGGCACCCACTGATGATGGTTATGCTGGGGTCAATAAGAAGAAACGTTGGTGCAGAGTCGAGTATACCTACAAAGCAAGCAGTGCCGATGAGCTGGATCTCTCTGTAGGGGATACTTTTGAAGTATTAGAAGAGATTGAAGATGGCTGGTACTTATGCAAGAAAGGAGATGTAGTTGGTGCTTTTCCATCTAACTTTGTAAAAGAATCCCAGAGCCTCCTTCTGATAAAATACCAGACATTCAAAAAATGCCAAAAGAGCCAGCAATGATGGATATTACTTCTCAGCAAAGAGATGGAAGTGTAACCAGATGATAACAGTACAGAGACAAAGCAAGTAGACTCTCACTTCTCAGCAAGAATATGGTAGCTCATGTCACTATTACTTTCTACTGATGAACTGCTAGAGTCAGTTGCAATCTGCCTCATAGGTCCAAGGGGA
  5   1   2      seed Tbd7 5g3  out                        XL108i10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCAGGNAATTCGGCACGAGGGGCAGGTCGTCTTATTGGCATTTGTATGTGGAAATAGGGATCTCTCTCTCTTACTGCACTGCCCACAGCACGGGACAACTTTTACACCATGGGCACACTGGGTGATATGTTGGTTCTAGTAGACTTTAAGGGGCAACTTGATGATGAGTTAAAAATAAAAACTGGAGATGTCATACAGAATGTGAAGAAAACAGCAGAAGAAGGCTGGCTAGAAGGAGAGTTCAATGGGAAGAGGGGCTTCTTCCCCCAAATGTTTGTGAAGGAAATCCCTCCATTCTTCCTAAATGACAATGCACAGAGGTACCCAAGGTCGATCAGGAAACCTAATGCATCCATTGTACCTAAGAATCCCCAGGAGGAGCTCCCAGACACACAGGCACCCACTGATGATGGTTATGCTGGGGTCAATAAGAAGAAACGTTGGTGCAGAGTCGAGTATACCTACAAAGCAAGCAGTGCCGATGAGCTGGATCTCTCTGTAGGGGATACTTTTGAAGTATTAGAAGAGATTGAAGATGGCTGGTACTTAGGCAAGAAAGGAGATGTAGTTGGTGCTTTTCCATCTAACTTTGTAAAAGAAATCCCAGAGCCTCCTTCTGATAAAATACCAGAACATTCAAAAAATGCCAAAAAGAGGCCAGCAATGATGGATATTAACTTCTCAGCCA
  5   1   2       bld Int2 5g                         IMAGE:8821550.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCCCCCCGAATAACCCACGAGCCCTCCCAATACGAATTCGTCCCCTTTTACACCATGGGCACACTGGGTGATATGTTGGTTCTAGTAGACTTTAAGGGGCAACTTGATGATGAGTTAAAAATAAAAACTGGAGATGTCATACAGAATGTGAAGAAAACAGCAGAAGAAGGCTGGCTAGAAGGAGAGTTCAATGGGAAGAGGGGCTTCTTCCCCCAAATGTTTGTGAAGGAAATCCCTCCATTCTTCCTAAATGACAATGCACAGAGGTACCCAAGGTCGATCAGGAAACCTAATGCATCCATTGTACCTAAGAATCCCCAGGAGGAGCTCCCAGACACACAGGCACCCACTGATGATGGTTATGCTGGGGTCAATAAGAAGAAACGTTGGTGCAGAGTCGAGTATACCTACAAAGCAAGCAGTGCCGATGAGCTGGATCTCTCTGTAGGGGATACTTTTGAAGTATTAGAAGAGATTGAAGATGGCTGGTACTTAGGCAAGAAAGGAGATGTAGTTGGTGCTTTTCCATCTAACTTTGTAAAAGAAATCCCAGAGCCTCCTTCTGATAAAATACCAGAACATTCAAAAAATGCCAAAAAGAGGCCAGCAATGATGGATATTAACTTCTCAGCCAAAGAAGAAGGGAAGTGTAAACAAGATGATAAACCAGTACCGGAGAACCAAAGCAAAGTAGACTCTTCACTTCCTCAGCCCAAGAATATTGTAGGGTCATGTTCAACTATATACCTTTTCTACCTGATGAACTTGCATTAAAGAAGGTGATGTGATACTGCTCATAAGCAGGAGACAGGAATGAGTGGTGGCAGGAAACTAATGGGAAACTGGGCTGTTCGACACTTTGTTAACATCTCGAATTGCAAAAAACAACAACTTCCACCCGAACTTCAACTTAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)