Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1  1.75    0Xl3.1-IMAGE:6879717.3                       5 END     4          66       80                protein C [Xenopus laevis]

 This cluster: approximate FL confidence score = 93%

 1012789823 Xl3.1-IMAGE:3396717-IMAGp.5 - 6 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:3396717-IMAGp.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGGTACTAACAAGGCACTCTCTGGATACATGCAAGCATGAACTGTTTACCCTTCTACAGAATATGGTGGCTTCTTATTTTTCATTTAATTCTGGTCATTTGGGTGTCTCCAAATGCAGAAAGCAGTCCAGTCTTCTCCAGCAGACAGGAGGCCAATCACGTGCTGAAAGTTCGGAAGCGTGCTTTTAACTTCATGGAGGAGCTAAAGCCGGGCTCCCTGGAACGCGAGTGCATAGAGGAGAAGTGCGATTTCGAGGAGGCCTTCGAAATTTTTGAGACTAAAGAGGACACACTCAACTTTTGGGCAAAATATTTTGATGGGGATCAATGTCAGTCCAATCCATGTGTCAATGCAGAGTGCAAGGATGGGATTGGAAGATTCGACTGCATCTGTAATGAGGGCTGGGAAGGGCGTCTGTGTGGCTATGAGGTTGTGTATTCCAACTGCTCATTGAATAATGGAGGATGTAGCCACTTCTGCACCCAGCCAATGAATAGCACGAGGCGTGTGTGCAGCTGTGCCACGGGATACAAGTTAGATGAAGACCACCACACGTGCCAACCAGTAGTGGAATTCCCCTGTGGGAAATCGAAAATTGTAGACTATGACTA
                                                  Xl3.1-CHK-1012702080                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTAACAAGGCACTCTCTGGATACATGCAAGCATGAACTGTTTACCCTTCTACAGAATATGGTGGCTTCTTATTTTTCATTTAATTCTGGTCATTTGGGTGTCTCCAAATGCAGAAAGCAGTCCAGTCTTCTCCAGCAGACAGGAGGCCAATCACGTGCTGAAAGTTCGGAAGCGTGCTTTTAACTTCATGGAGGAGCTAAAGCCGGGCTCCCTGGAACGCGAGTGCATAGAGGAGAAGTGCGATTTCGAGGAGGCCTTCGAAATTTTTGAGACTAAAGAGGACACACTCAACTTTTGGGCAAAATATTTTGATGGGGATCAATGTCAGTCCAATCCATGTGTCAATGCAGAGTGCAAGGATGGGATTGGAAGATTCGACTGCATCTGTAATGAGGGCTGGGAAGGGCGTCTGTGTGGCTATGAGGTTGTGTATTCCAACTGCTCATTGAATAATGGAGGATGTAGCCACTTCTGCACCCAGCCAATGAATAGCACGAGGCGTGTGTGCAGCTGTGCCACGGGATACAAGTTAGATGAAGACCACCACACGTGCCAACCAGTAGTGGAATTCCCCTGTGGGAAATCGAAAATTGTAGACTATGACTATAATGC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     4     4     3     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     5     5     5     5     5     5     5     5     4     5     5     5     5     5     5     5     5     5     4     5     4     5     5     5     5     5     4     5     3     4     3     4     3     4     3     4     3     4     3     4     3     4
                                               BLH ATG      37     506                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN      37      64                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR      37     249                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG      37       6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PROTEIN --- Dm ---- 6e-009     NP_476859.2 CG3936-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================
                                                                                                                                                                                                       PROTEIN --- ?? ---- 3e-009     XP_001733016.1 EGF-like domain-containing protein [Dictyostelium discoideum AX4] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Ce ---- 2e-009     NP_502737.2 Y64G10A.7 [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Sp ---- 2e-012     XP_001178415.1 PREDICTED: similar to fibropellin Ia [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ci ---- 3e-018     ABJ09593.1 gamma-carboxyglutamic acid protein 3 splice variant B [Ciona intestinalis] ==================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Dr ---- 2e-043     NP_956650.1 hypothetical protein MGC63987 [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Hs ==== 1e-048     NP_000303.1 protein C (inactivator of coagulation factors Va and VIIIa) [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Mm ==== 1e-051     NP_001036233.1 protein C [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Cf ==== 8e-053     NP_001013871.1 protein C [Canis familiaris] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Bt ---- 1e-053     XP_585990.3 PREDICTED: similar to protein C prepropeptide [Bos taurus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Gg ==== 1e-061     NP_989772.1 anticoagulant protein C precursor [Gallus gallus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Xt ==== 2e-099     NP_001015759.1 MGC107972 protein [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Xl ==== 1e-118     NP_001080424.1 protein C [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                           Xl3.1-IMAGE:3396717-IMAGp.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAA---------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ...
  5   1   2       bld Tad1      out                   IMAGE:6877936.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGGGGGTACTAACAAGGTACTATCTGGATACATGCAGTCATGAACTGTTTACCCCCCTACAGAATATGGTGGCCTCTTATTCTTCATTTAATTCTTGTCATTTGGGAGTCTCCTAATGCTGAAAGCAGCCCAGTGTTCTCCAGCAAACAGGAGGCCAATCATGTGCTGAAAGTTCGGAAGCGTGCTTTTAACTTCATGGAGGAGCTAAAGCCGGGATCCCTGGAACGTGAGTGCATAGAGGAGACGTGCAATTTCGAGGAGGCCTATGAAATTTTTGAGAATAACGAGGACACACTCAAATTTTGGACAACATATGTTGATGGGGATCAGTGCCAGTCCAATCCATGTATCAATGCTGAGTGCAAGGACGGGATTGGAAGATTTGACTGCATCTGTAATGAGGGCTGGGAAGGACGCCTGTGTGGCTATGAGGTTGTGTATTCCAACTGCTCATTGAATAATGGCGGATGTACCCACTTCTGCACTGAGGCAGTGAATAGCACGAGACGTGTGTGCAGCTGTGCCACAGGTTACATGTTACATTTGTGTTCAGATGCTGGAAAGTACACTGTCCGACTTGGCGAAATGACATCCGAAAAGTTGGAGGATACAGAGCAACAATTTTGCTTGTGGCTAAGAATCATTTTCCCATTCCTGCGGTAATCAAAGGGGACACCCAGCCCAATAAATGAATATTCGCCCCCTAAATGGGGGCTCTTTGTAACAAACCCAGGTTTGTTCTTTATAAAAAAAGATAAATTCCTTGGCCCCAAATGTTTTCTTATACCACCATT
  5   1   2      seed Tad1 5g3  out                   IMAGE:6879717.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGGTACTAACAAGGCACTCTCTGGATACATGCAAGCATGAACTGTTTACCCTTCTACAGAATATGGTGGCTTCTTATTTTTCATTTAATTCTGGTCATTTGGGTGTCTCCAAATGCAGAAAGCAGTCCAGTCTTCTCCAGCAGACAGGAGGCCAATCACGTGCTGAAAGTTCGGAAGCGTGCTTTTAACTTCATGGAGGAGCTAAAGCCGGGCTCCCTGGAACGCGAGTGCATAGAGGAGAAGTGCGATTTCGAGGAGGCCTTCGAAATTTTTGAGACTAAAGAGGACACACTCAACTTTTGGGCAAAATATTTTGATGGGGATCAATGTCAGTCCAATCCATGTGTCAATGCATAGTGCAAGGATGGGATTGGAAGATTCGACTGCATCTGTAATGAGGGCTGGGAAGGGCGTCTGTGTGGCTATGAGGTTGTGTATTCCAACTGCTCATTGAATAATGGAGGATGTAGCCACTTCTGCACCCAGCCAATGAATAGCACGAGGCGTGTGTGCAGCTGTGCCACGGGATACAAGTTAGATGAAGACCACCACACGTGCCAACCAGTAGTGGAATTCCCCTGTGGGAAATCGAANATTGTAGACTATGACTATTATGGCCCGTCTTATTGGTGCAAAGCAAGGACGCAAAGGGGATACTCCTTTGGCAGCCATGCTGCGTTACGAGAAGAAGATGAAAATGTGGAGGGGGTCCGGAATTCATCCTTCCTGGGGTCTGACTGCAGCCCCATTGCCGTTACATATACGGGGAAAGTACA
  5   1   2       bld Li1  5g3  out                   IMAGE:3396929.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGTACTAACAAGGCACTCTCTGGATACATGCAACCATGAACTGTTTACCCTTCTACAGAATATGGTGGCTTCTTATTTTTCATTTAATTCTGGTCATTTGGGTGTCTCCAAATGCAGAAAGCAGTCCAGTCTTCTCCAGCAGACAGGAGGCCAATCACGTGCTGAAAGTTCGGAAGCGTGCTTTTAACTTCATGGAGGAGCTAAAGCCGGGCTCCCTGGAACGCGAGTGCATAGAGGAGAAGTGCGATTTCGAGGAGGCCTTCGAAATTTTTGAGACTAAAGAGGACACACTCAACTTTTGGGCAAAATATTTTGATGGGGATCAATGTCAGTCCAATCCATGTGTCAATGCAGAGTGCAAGGATGGGATTGGAAGATTCGACTGCATCTGTAATGAGGGCTGGGAAGGGCGTCTGGGTGGCTATGAGGTTGTGTATNCCAACTGCTCATTGAATAATGGAGGATGTAGCCACTTCTGCACGCAGCCGATGGATAGCACGAGGCGTGTGTGCAGCTTGTGNACGGGATACAGGTTA
  5   1   2       bld Li1  5g                         IMAGE:3396745.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACTAACAAGGCACTCTCTGGATACATGCAAGCATGAACTGTTTACCCTTCTACAGAATATGGTGGCTTCTTATTTTTCATTTAATTCTGGTCATTTGGGT
  5   1   2       bld Li1                    IMAGE:3396717-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAAAGCCGGGCTCCCTGGAACGCGAGTGCATAGAGGAGAAGTGCGATTTCGAGGAGGCCTTCGAAATTTTTGAGACTAAAGAGGACACACTCAACTTTTGGGCAAAATATTTTGATGGGGATCAATGTCAGTCCAATCCATGTGTCAATGCAGAGTGCAAGGATGGGATTGGAAGATTCGACTGCATCTGTAATGAGGGCTGGGAAGGGCGTCTGTGTGGCTATGAGGTTGTGTATTCCAACTGCTCATTGAATAATGGAGGATGTAGCCACTTCTGCACCCAGCCAATGAATAGCACGAGGCGTGTGTGCAGCTGTGCCACGGGATACAAGTTAGATGAAGACCACCACACGTGCCAACCAGTAGTGGAATTCCCCTGTGGGAAATCGAAAATTGTAGACTATGACTATAATGCCCGTCTTATTGGTGCAAAGCAAGGACGCAAAGGGGATACTCCTTGGCAGGCCATGCTGCGTTACGAGAAGAAGATGAAATGTGGAGGGGTCCTGATTCATCCTTCCTGGGTTCTGACTGCAGCCCATTGCGTTACATATACTGGAAAGTACAGTGTTCGACTTGGTGAATACGACATACGCAAGTTGGAGGATACAGAGCAGCAGTTTGCTGTGGTCAAGATCATTATCCATCCTGAGTATCGAAGTGACACCAATGATAATGATATCGCCCTACTGCGCCTCGTGCAGCCAGTTGTCTATAACAAATATATCCTGCCCATATGTCTGCCCAGTCTGGACCTTGCTGAAAATACCCTGATGGTGAATGGCACTGTAGTCGTGGTTTCCGGCTGGGGCAGAGAAGATGAAAAGGCCCTAAACTTTTCTAGTGTACTCAGCTACATCCAGATCCCCTGTTGTTTCTCATAAATCAATGCG
  5   1   2       bld Li1       out                   IMAGE:3396717.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGCCGGGCTCCCTGGAACGCGAGTGCATAGAGGAGAAGTGCGATTTCGAGGAGGCCTTCGAAATTTTTGAGACTAAAGAGGACACACTCAACTTTTGGGCAAAATATTTTGATGGGGATCAATGTCAGTCCAATCCATGTGTCAATGCAGAGTGCAAGGATGGGATTGGAAGATTCGACTGCATCTGTAATGAGGGCTGGGAAGGGCGTCTGTGTGGCTATGAGGTTGTGTATTCCAACTGCTCATTGAATAATGGAGGATGTAACCACTTCTGCACCCAGCCAATGAATAGCACGAGGCGTGTGTGCAGCTGTGCCACGGGATACAAGTTATATGAAGACCACCACACGTGCCAACCAGTAGTGGAATTCCCCTGTGGGAAATCGAAAATTGTAGACTATGACTATAATGCCCG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)