Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL218j01.3                            2 END     2          66      100                Siamois homeo domain [Xenopus laevis]

 This cluster: approximate FL confidence score = 83%

 1012791553 Xl3.1-XL192g09.5 - 3 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL192g09.5 GGTGGGAGACNGACATGACCTATGAGGCTGAAATGGAGCAAATTGTCTCTACCGCACTGACTCTGCAAGATGACTACATCAAATTCACTCCAAGGAACCAAAACATGGCCTGCCACGCTGAAATTATTGGGATATTCCATGATATTCATCCAACTGTGGAAATTAAGGAACCCCACCAGGATAAATCTGTCCTACAAGAGACTCTGGTAGAACTTTACTCTGTTTTGGGAATTCCACAGGAGCCTCAGGTCAGCAAAACCATGAAGTTTGAAGAACCAGAACAACATAAAGAATCATCATCTACTGTCACAAGATCTGACTCCCTAGTCAACAGTCTGCAGTCAACAGGACTTAAAAGGCCATTTTGTGAAGATGAACATAGAGAATATAAGAAACCACTGATTCAGGCAGAGGATATTTCTCCAGCCACCAGTACCAGATCTAGGAAGAGAACCATTTATTCAAAGGAACAAACCAACTTTCTCCAGAACCAATTTGATCTCAACCCTTATCCAGACTTTGTGAACAGATGCCGTATTGCAAAGATAACTGGCATTCCTGAGC
                                                  Xl3.1-CHK-1012710356       AGACNGACATGACCTATGAGGCTGAAATGGAGCAAATTGTCTCTACCGCACTGACTCTGCAAGATGACTACATCAAATTCACTCCAAGGAACCAAAACATGGCCTGCCACGCTGAAATTATTGGGATATTCCATGATATTCATCCAACTGTGGAAATTAAGGAACCCCACCAGGATAAATCTGTCCTACAAGAGACTCTGGTAGAACTTTACTCTGTTTTGGGAATTCCACAGGAGCCTCAGGTCAGCAAAACCATGAAGTTTGAAGAACCAGAACAACATAAAGAATCATCATCTACTGTCACAAGATCTGACTCCCTAGTCAACAGTCTGCAGTCAACAGGACTTAAAAGGCCATTTTGTGAAGATGAACATAGAGAATATAAGAAACCACTGATTCAGGCAGAGGATATTTCTCCAGCCACCAGTACCAGATCTAGGAAGAGAACCATTTATTCAAAGGAACAAACCAACTTTCTCCAGAACCAATTTGATCTCAACCCTTATCCAGACTTTGTGAACAGATGCCGTATTGCAAAGATAACTGGCATTC
                                                      consensus depths      1     1     1     1     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG      14      60 
                                               BLH MIN      14      19 
                                               BLH MPR      14      19 
                                               BLH OVR      14      60 
                                               ORF LNG      14       6 
                                                                                     PROTEIN === Xt ==== 4e-074     NP_001090821.1 siamois homeodomain 1 [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                     PROTEIN === Xl ==== 4e-103     NP_001079305.1 Siamois homeo domain [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-XL192g09.5               ATG---------------ATG---------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF               ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ...
  5   1   2       bld Ga12 5g3  out                        XL218j01.5p GGTGGGAGACNGACATGACCTATGAGGCTGAAATGGAGCAAATTGTCTCTACCGCACTGACTCTGCAAGATGACTACATCAAATTCACTCCAAGGAACCAAAACATGGCCTGCCACGCTGAAATTATTGGGATATTCCATGATATTCATCCAACTGTGGAAATTAAGGAACCCCACCAGGATAAATCTGTCCTACAAGAGACTCTGGTAGAACTTTACTCTGTTTTGGGAATTCCACAGGAGCCTCAGGTCAGCAAAACCATGAAGTTTGAAGAACCAGAACAACATAAAGAATCATCATCTACTGTCACAAGATCTGACTCCCTAGTCAACAGTCTGCAGTCAACAGGACTTAAAAGGCCATTTTGTGAAGATGAACATAGAGAATATAAGAAACCACTGATTCAGGCAGAGGATATTTCTCCAGCCACCAGTACCAGATCTAGGAAGAGAACCATTTATTCAAAGGAACAAACCAACTTTCTCCAGAACCAATTTGATCTCAACCCTTATCCAGACTTTGTGAACAGATGCCGTATTGCAAAGATAACTGGCATTCCTGAGCCCAG
  5   1   2      seed Ga12      out                        XL192g09.5p                TGACCTATGAGGCTGAAATGGAGCAAATTGTCTCTACCGCACTGACTCTGCAAGATGACTACATCAAATTCACTCCAAGGAACCAAAACATGGCCTGCCACGCTGAAATTATTGGGATATTCCATGATATTCATCCAACTGTGGAAATTAAGGAACCCCACCAGGATAAATCTGTCCTACAAGAGACTCTGGTAGAACTTTACTCTGTTTTGGGAATTCCACAGGAGCCTCAGGTCAGCAAAACCATGAAGTTTGAAGAACCAGAACAACATAAAGAATCATCATCTACTGTCACAAGATCTGACTCCCTAGTCAACAGTCTGCAGTCAACAGGACTTAAAAGGCCATTTTGTGAAGATGAACATAGAGAATATAAGAAACCACTGATTCAGGCAGAGGATATTTCTCCAGCCACCAGTACCAGATCTAGGAAGAGAACCATTTATTCAAAGGAACAAACCAACTTTCTCCAGAACCAATTTGATCTCAACCCTTATCCAGACTTTGTGAACAGATGCCGTATTGCAAAGATAACTGGCATTCCTGAGC
  5   1   2       bld Ga12                                 XL158c19.5p                 CCTATGAGGCTGAAATGGAGCAAATTGTACTCTACCGCACTGACTCTGCAAGATGACTACATCAAATTCACTCCAAGGCAACCAAAACATGGCCTGCCACGCTGAAATTATTGGGATATTCCATGATATTCATCCAACTGTGGAAATCAAGGAACCCCACCAGGATAAATCTGTTCTACAAGAGACTCTGGTAGAACTTTACTCGGTTTTGGGAATTCCACAGGAGCCTCAGGTCAGCAAAACCATGAAGTTTGAAGAACCAGAACAACATAAAGAATCATCAACCACTGTCACAAGATCTGACCCCCTANTCAACAGTCTGCAGTCAACAGGACTTAAAAGGCCATTTTGTGAAGATGAACATAGAGAATATAANAAACCACTGATTCAGGCAGAGGATATTNC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)