Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-IMAGE:6630729-IMAGp.5.5              12 END     1          14        8                hypothetical protein LOC100145687 [Xenopus tropicalis]
     2   1.0    0Xl3.1-IMAGE:8544815.5                       4 END     1          14       25                ets-2a proto-oncogene [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012791794 Xl3.1-PBX0095B12.5 - 7 ESTs
                                                                       .....-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-PBX0095B12.5                                                                  AAAACACCAAATCCGTGACATGAATTAGCGCTTTACTCCATTCTCTTGGGTCGGAGTAAAGATCTGATGGATGGCGCTTATTGTTATACAGTTGCTCACTTGAAAAAGAAGATTGCACATAAGTAACTCGTCGTGTATGCTACTTTCTGATTATTGCGTCCCGCCTTAAGGAACTTCTTGTTTCAGTCCATGAACGAGAAGAGAGGCGTTTTAGTTTGTTTAAAACTGTCGTGCTTGGATATCGGATCAAGGCCTGGTGCCTGTTGCTGAACCACATTCCAAGGATCTGGGAGATTTGAGAATTCTCCAAAAGTCTTCATTGGCATCATCTCTAAGTCATGTAGATATTGACCAGGACCGAGTCACCAGGCTGTCCATATACACCCTCATTTTTGTTTTTAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGACCGCGTGTAAATAATATATGAGGTTTTATATTTACAGAACTAATTTTATTTTGCCAGGTATATGTATATTTTAATTATTTGTATTTTAAATATGATTCTCGTTGTAAATATTGGAACGTTTCCTTTGCCGAGAGCATTAAGACAGGAGCGCTAGGAAAGACTGTTTGTACATGACTTGATTACCGCTATTTTTTTTTTGTTTTAAATGAAGCCTTGTGTTTCCCATGTGGGTGATTTGATGCCGATTGTTCACAATATTGCACAACCGATAGAATGTCCCGTTCTCCTTTGCTGTACATAATTTGTTCACTGTTGTACTTTTTGTTTTTAATTGCCTTTTGATTTCATAATAGGAATTCATTATATATATTTTTTTCAATGTATTTGCCTCATTTTCATAGGCCAGGAGAAGTGTGCGTAGCAGATTTTTTTACTGCAGTTTTTTTTTTTCTTCTTTTGAAAGGAAGTTGTATTTTTTTAACAAGTGCCTTTATGAAAACCTATTTCTGTAACATATTTTGATTCATAGGGGGGAAAGCAACTAATGGATCGATTTATGATTAAAATGATCTTTTTT
                                                  Xl3.1-CHK-1012699265                                                                        CCAAATCCGTGACATGAATTAGCGCTTTACTCCATTCTCTTGGGTCGGAGTAAAGATCTGATGGATGGCGCTTATTGTTATACAGTTGCTCACTTGAAAAAGAAGATTGCACATAAGTAACTCGTCGTGTATGCTACTTTCTGATTATTGCGTCCCGCCTTAAGGAACTTCTTGTTTCAGTCCATGAACGAGAAGAGAGGCGTTTTAGTTTGTTTAAAACTGTCGTGCTTGGATATCGGATCAAGGCCTGGTGCCTGTTGCTGAACCACATTCCAAGGATCTGGGAGATTTGAGAATTCTCCAAAAGTCTTCATTGGCATCATCTCTAAGTCATGTAGATATTGACCAGGACCGAGTCACCAGGCTGTCCATATACACCCTCATTTTTGTTTTTAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGACCGCGTGTAAATAATATATGAGGTTTTATATTTACAGAACTAATTTTATTTTGCCAGGTATATGTATATTTTAATTATTTGTATTTTAAATATGATTCTCGTTGTAAATATTGGAACGTTTCCTTTGCCGAGAGCATTAAGACAGGAGCGCTAGGAAAGACTGTTTGTACATGACTTGATTACCGCTATTTTTTTTTTGTTTTAAATGAAGCCTTGTGTTTCCCATGTGGGTGATTTGATGCCGATTGTTCACAATATTGCACAACCGATAGAATGTCCCGTTCTCCTTTGCTGTACATAATTTGTTCACTGTTGTACTTTTTGTTTTTAATTGCCTTTTGATTTCATAATAGGAATTCATTATATATATTTTTTTCAATGTATTTGCCTCATTTTCATAGGCCAGGAGAAGTGTGCGTAGCAGATTTTTTTACTGCAGTTTTTTTTTTTCTTCTTTTGAAAGGAAGTTGTATTTTTTTAACAAGTGCCTTTATGAAAACCTATTTCTGTAACATATTTTGATTCATAGGGGGGAAAGCAACTAATGGATCGATTTATGATTAAAATGATCTTTTTTGTGAAA
                                                      consensus depths                                                                       2     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     3     2     3     2     4     3     4     3     4     3     4     2     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     5     6     6     6     5     5     5     5     4     4     4     4     4     4     3     4     3     4     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                    Xl3.1-PBX0095B12.5                                                                                 TGA------------------------------------------------ATG------------------------------------------------------TAA---------------------TGA---------------------------------------ATG---------------------------------------------------------------------------TGA------------------------------------------------------------------------------TGA------------------------------------------------TAATGA---------------ATG---------------------------TAA------------------------------TAA------------------ATG---------------------------ATG---------------------------------------------------------TAG------------------------------------------------TAAATG------------------------------ATG---------------------------------------------------------TAA---------------------------TAA---------------------------------------------------------------------------------------TAG------------------------------------TGA------------------TAA------------TGA------------------------------TAG---------------ATG---------ATG------ATG
  3   1   1       add Ga12 5g3  out                        XL194h22.3p GAAAAGGATCGTTTAGTGGGCTGTCCAAGATGGCCGAACAGTGCATGACTTCAAAAGACTGGAAACATCAAATCCGNGACATGAATTGGCTNTTTGCTNTGTTTTNTTAGATCGGAGTAAAGATTTGATGGATGGNGCTTATTGTTATACAGTTGNTCNCTTGAAAAAAAGAAGATAACCCGTTGNGTATGCTACTTTNTGACTATTGNGTCCCCCCTAAAGGAACTTGGTTTTTCAGTCCATGGACAAAAATAGNGGNTTATNTGTTTTCAGCCCTGCCGNGTTTATATNTCAAATCNCGGCCTGTTGCCGAACCNCTATCCAAGGATCCGGGAGTTTAGGAGTTNTTTAAAATGTTTCATAGGCTGTTGNGATNTTTAAGCTGNGNGGGTTTTGATCAGGNCCCCAGGGCTGTNTNTATACNCCTAATCCTTTTTTTTTTTTATTTTTTTATTTTTTATTTGCAAATGAACTGAAAAAAATGTGATCATGGCATTCTCATCATTTCAAGTCTGCTTGTAAATAATATGAGGTTTTATATTTACAGAACTATTTTATTTGTCAGGTACATGTATATTTTAATTATTTGTATTTTAAATATGATTCCCATTGTAAATATTGTAACGTGTTTTCCTTTGCCAAGAGCATTAAAACAGGAGCGCTAGGATAGGCC
  5   1   2      seed Egg1                               PBX0095B12.5p                              CACGAGGCGAACAGTGCATGAGTTGAAAAGACTGGAAAAACACCAAATCCGTGACATGAATTAGCGCTTTACTCCATTCTCTTGGGTCGGAGTAAAGATCTGATGGATGGCGCTTATTGTTATACAGTTGCTCACTTGAAAAAGAAGATTGCACATAAGTAACTCGTCGTGTATGCTACTTTCTGATTATTGCGTCCCGCCTTAAGGAACTTCTTGTTTCAGTCCATGAACGAGAAGAGAGGCGTTTTAGTTTGTTTAAAACTGTCGTGCTTGGATATCGGATCAAGGCCTGGTGCCTGTTGCTGAACCACATTCCAAGGATCTGGGAGATTTGAGAATTCTCCAAAAGTCTTCATTGGCATCATCTCTAAGTCATGTAGATATTGACCAGGACCGAGTCACCAGGCTGTCCATATACACCCTCATTTTTGTTTTTAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGACCGCGTGTAAATAATATATGAGGTTTTATATTTACAGAACtaattttattttgccaggtatatgtatattttaattatttgtattttaaatatGAT
  5   1   2       bld Emb3                            IMAGE:3399549.5p                                                                 AAAAACACCAAATCCGTGACATGAATTAGTGATTTACTCCATTCTCTTGGGTCGGAGTAAAGATCTGATGGATGGCGCTTATTGTTATACAGTTGCTCACTTGAAAAAGAAGATTGCACATAAGTAACTCGTCGTGTATGCTACTTTTATGCGTCCCGCCTTAAGGAACTTCTTGTTTCAGTCCATGAACGAGAAAAGAGGCGTTTTAGTTTGTTTAAAACTGTCGTGCTTGAATATCAGATCAAGGCCTGGTGCCTGTTGCTAAACCACATTCCAAGGATCTGGAAGTGTTAAGAATT
  5   1   2       bld Egg1                               PBX0082G07.5p                                                                            ATCCGTGACATGAATTAGCGCTTTACTCCATTCTCTTGGGTCGGAGTAAAGATCTGATGGATGGCGCTTATTGTTATACAGTTGCTCACTTGAAAAAGAAGATTGCACATAAGTAACTCGTCGTGTATGCTACTTTCTGATTATTGCGTCCCGCCTTAAGGAACTTCTTGTTTCAGTCCATGAACGAGAAGAGAGGCGTTTTAGTTTGTTTAAAACTGTCGTGCTTGGATATCGGATCAAGGCCTGGTGCCTGTTGCTGAACCACATTCCAAGGATCTGGGAGATTTGAGAATTCTCCAAAAGTCTTCATTGGCATCATCTCTAAGTCATGTAGATATTGACCAGGACCGAGTCACCAGGCTGTCCATATACACCCTCATTTTTGTTTTTAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGACCGCGTGTAAATAATATATGAGGTTTTATATTTACAGAACTAATTTTATTTTGCCAGGTATATGTATATTTT
  5   1   2       add Egg1                               PBX0132G12.5p                                                                                                                                                                                                                                                                                                                                                                                        CGAGGATCATTGGCATCATGTCTAAGTCATGTAGATATTGACCAGGACCGAGTCATCTTTCTGTCCATATACACCCTCATTTTTGTTATTAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGACCGCGTGTAAATAATATATGAGGTTTTATATTTACAGAACTAATTTTATTTTGCCAGGTATATGTATATTCTAAATTATTGTATTTTAAATATGATTCTCGTTGTAAATATTGGAACGTTTCCTTTGCCGAGAGCATTAAGACAGGAGCGCTC
  5   1   2      skin Emb1                            IMAGE:5155091.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTCCAGAACtaattttattttgccaggtatatgtatattttaattatttgtattttaaatatGATTCTCGTTGTAAATATTGGAACGTTTCCTTTGCCGAGAGCATTAAGACAGGAGCGCTAGGAAAGACTGTTTGTACATGACTTGATTACCGCTAttttttttttgttttAAATGAAGCCTTGTGTTTCCCATGTGGGTGATTTGATGCCGATTGTTCACAATATTGCACAACCGATAGAATGTCCCGTTCTCCTTTGCTGTACATAATTTGTTCACTGTTGTACTTTTTGTTTTTAATTGCCTTTTGATTTCATAATAGGAATTCATTATATATATTTTTTTCAATGTATTTGCCTCATTTTCATAGGCCAGGAGAAGTGTGCGTAGCAGAtttttttactgcagtttttttttttcttcttttgaaaggaagttgtatttttttAACAAGTGCCTTTATGAAAACCTATTTCTGTAACATATTTTGATTCATAGGGGGGAAAGCAACTAATGGATCGATTTATGATTAAAATGATCTTTTTTGTGAAAAAGCAAACCCCCNCCAAAAACACACTAAAAAGGGCGGCCGCCTCTAGAAATATTCCCCTCCAAGGGGGCCCAAAGGCTTTACGCCGTAACCCCAGCTTTTTTCTTTGGGAACAAAAGGGGGGCCCCCCTTAAAAAGGGGGAGGGCCCGCAATTTTATAAAAAGCCCTAAGGGGACACCCTTGGGGCCCCCGGCTCCCtttttttttaaaaaaaaCCGGTTTTCCTGGGTGGAAACC
  5  -1   2       bld Egg3      out                   IMAGE:3378216.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACAGAACTAattttattttgccaggtatatgtatattttaattatttgtattttaaatatGATTCTCGTTGTAAATATTGGAACGTTTCCTTTGCCGAGAGCATTAAGACAGGAGCGCTAGGAAAGACTGTTTGTACATGACTTGATTACCGCTAttttttttttgttttAAATGAAGCCTTGTGTTTCCCATGTGGGTGATTTGATGCCGATTGTTCACAATATTGCACAACCGATAGAATGTCCCGTTCTCCTTTGCTGTACATAATTTGTTCACTGTTGTACTTTTTGTTTTTAATTGCCTTTTGATTTCATAATAGGAATTCATTATATATATTTTTTTCAATGTATTTGCCTCATTTTCATAGGCCAGGAGAAGTGTGCGTAGCAGAtttttttactgcagtttttttttttCTTCTTTTGAAAGGAAGTTGTATTTTTTTAACAAGTGCCTTTATGAAAACCTATTTCTGTAACATATTTTGATTCATAGGGGGGAAAGCAACTAATGGATCGATTTATGATTAAAATGATCTTTTTTGTGAAAAGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)