Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 91%

 1012792137 Xl3.1-PBX0142D03.5 - 14 ESTs
                                                                       -290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-PBX0142D03.5                                                                                                                                                                                                                                                                                                   ATCGGCCGAGGATTCTTCTATTTGGGGCGCGGGGAGATCAGCTGGAGCTTTTGCTGTTGGTTCTTCCATTTCTTTCAGTCTGTCTGGGCCCTTCTCCTCCCCCGACCCCTCTGCTTCCGGCTGACACTGAAGGGGGTCGGGGTTCGGGGGCAACATGTTCCAACCCACCCCAAAAAGGTGTTTTACCATCGAGTCGTTGGTGGCTAAAGACTTGCCGATCTCTCGCTCCGACGACCCCATCCGACCCGCCGCCCTCAGTTATTCCAACTCTGCGCCCCTGAACCCTTTTATCAACGGCTTCCACCCCACGGCCAGGGGCGTCTACTCCAACCAGGACTTGGTCTTTGCTGAAGCCATTTCTCACCCGCCCAACCCGGCTGTCCCTGTGCACCCAGTGCCCCCACCCCATGCCCTGTCAGCGCACCCCCTGCCGAACCCTCACTCCCCGCACCCCCTTTTTTCATCTCAGCAACGGGACCCCTCAACCTTCTACCCCTGGTTAATACACCGGTACCGCTACCTGGGACACAGATTCCAAGGGAACGACCCGAGTGCTGAGAGTTTCCTTCTCCACAACGCACTGGCCCGAAAACCCAAACGGATCCGCACCGCTTTCTCCCCCTCTCAGTTACTGCGCCTGGAACACGCCTTTGAGAAAAACCACTATGTTGTGGGCGCAGAAAGGAAACAGTTGGCGCACACGCTCAGCCTCACCGAGACCCAGGTAAAAGTTTGGTTTCAGAACAGAAGGACAAAGTTCAAACGTCAGAAACTGGAGGAAGAGGGGTCGGATTGTTCGCAGAAGAAAAAAGGGGCTCATCACATCAACAGATGGAGGATCGCCACCAAACAAGGGAGCCCCGAGGAGATCGATGTCACATCGGACGATTAACAACGACCACTTGGGACTTCCACATTCTTTTTGCTTTTTAATGAACTTTCAAACGAGAAAACAAATAAAAGGGTTTGAGCTCCAAGGGAGTCAGACTGGACTGGGCTCAGAAGCAGAACTCACAGAGGAGAGAGAGAGAGATGGGCGACCCCAAAGTGGCCTGGGCTTCGAGGTCAACCAGCAGGGGTCAAGGTCATCCCCAGGGATTCAGTGAATAAGGACAACTCGTTTCTTTTGCACTTCCAACATTTCTCCCCCCAACAAATATATAAAAATCCTGTTTTTGTTTTTTTAAATAAATTATTTCCCAAAACTTGAATTGCATGACAAATGGGTTTACACGATGTTCTAACTACCCCTCCCCAATAAAACAGGTAACTTTATAATTTAAGAGAAATAGTTTCACTTCTAACCAACGCCCCCCATCCCAGAGCCAATGAAAGGCTTTGGTCACTGCAGCACCTCTTGCGTCACCCTACAGATTCCTGACGTCATGGAGAGTGCAATATGACGACTGAAACCCTAGTTGGCCAAGATGTTCTGCAGCAGCAGTAGCTGAAATAAATCTTTACACGAGAGTCGCACTGAGTTTTGGTGCGATAATATAGGGGGTCAGGAATGCGATTTTTTTTTAAAGACATCTTCCAAAATATTCTGGAATTTTATTGATCGTACAGAAATCAGTAAAAAAAAAAATATTTTGAATGCTGCAGAAATAATCAGAGGGGAGTGTTTGTGTGGACTTGGACCTGAAGCATTTCCCACGGTGTCTGGTGCTTTAATTAAACCCACAGACTTGGCACAAGGAGTCTCCAAAAATGACAGTTTCATGGATCATTTTGTAGAACTGATCACTTTTGGCAGCAATTCGGAAGCACTGAGATTTTTATTTTCCACAATAGTAAAAACTCTATTAAATATGGACAACAACA
                                                  Xl3.1-CHK-1012692359                                                                                                                                                                                                                                                                                                         CGAGGATTCTTCTATTTGGGGCGCGGGGAGATCAGCTGGAGCTTTTGCTGTTGGTTCTTCCATTTCTTTCAGTCTGTCTGGGCCCTTCTCCTCCCCCGACCCCTCTGCTTCCGGCTGACACTGAAGGGGGTCGGGGTTCGGGGGCAACATGTTCCAACCCACCCCAAAAAGGTGTTTTACCATCGAGTCGTTGGTGGCTAAAGACTTGCCGATCTCTCGCTCCGACGACCCCATCCGACCCGCCGCCCTCAGTTATTCCAACTCTGCGCCCCTGAACCCTTTTATCAACGGCTTCCACCCCACGGCCAGGGGCGTCTACTCCAACCAGGACTTGGTCTTTGCTGAAGCCATTTCTCACCCGCCCAACCCGGCTGTCCCTGTGCACCCAGTGCCCCCACCCCATGCCCTGTCAGCGCACCCCCTGCCGAACCCTCACTCCCCGCACCCCCTTTTTTCATCTCAGCAACGGGACCCCTCAACCTTCTACCCCTGGTTAATACACCGGTACCGCTACCTGGGACACAGATTCCCAGGGAACGACCCGAGTGCTGAGAGTTTCCTTCTCCACAACGCACTGGCCCGAAAACCCAAACGGATCCGCACCGCTTTCTCCCCCTCTCAGTTACTGCGCCTGGAACACGCCTTTGAGAAAAACCACTATGTTGTGGGCGCAGAAAGGAAACAGTTGGCGCACACGCTCAGCCTCACCGAGACCCAGGTxAAxGTTTGGTTTCAGAACAGAAGGACAAAxTxCAAACGTCAGAAACTGGAGGAAGAGGGGTCGGATTGTTCTCAGAAGAAGAAAGGGTCTCATCACATCAACxGxTGGAGxATxGCCACCAAACAxxxxAxxxxxxAGxxxxTCGATGTCACATCGGACGATTAACAACGACCACTTGGGACTTCCACATTCTTTTTGCTTTTTAATGAACTTTCAAACGAGAAAACAAATAAAAGGGTTTGAGCTCCAAGGGAGTCAGACTGGACTGGGCTCAGAAGCAGAACTCACAGAGGAGAGAGAGAGAGATGGGCGACCCCAAAGTGGCCTGGGCTTCGAGGTCAACCAGCAGGGGTCAAGGTCATCCCCAGGGATTCAGTGAATAAGGACAACTCGTTTCTTTTGCACTTCCAACATTTCTCCCCCCAACAAATATATAAAAATCCTGTTTTTGTTTTTTTAAATAAATTATTTCCCAAAACTTGAATTGCATGACAAATGGGTTTACACGATGTTCTAACTACCCCTCCCCAATAAAACAGGTAACTTTATAATTTAAGAGAAATAGTTTCACTTCTAACCAACGCCCCCCATCCCAGAGCCAATGAAAGGCTTTGGTCACTGCAGCACCTCTTGCGTCACCCTACAGATTCCTGACGTCATGGAGAGTGCAATATGACGACTGAAACCCTAGTTGGCCAAGATGTTCTGCAGCAGCAGTAGCTGAAATAAATCTTTACACGAGAGTCGCACTGAGTTTTGGTGCGATAATATAGGGGGTCAGGAATGCGATTTTTTTTTAAAGAxxxxTTCCAAAATATTCTGGAATTTTATTGATCGTACAGAAATCAGTAAAAAAAAAAATATTTTGAATGCTGCAGAAATAATCAGAGGGGAGTGTTTGTGTGGACTTGGACCTGAAGCATTTCCCACGGTGTCTGGTGCTTTAATTAAACCCACAGACTTGGCACAAGGAGTCTCCAAAAATGACAGTTTCATGGATCATTTTGTAGAACTGATCACTTTTGGCAGCAATTCGGAAGCACTGAGATTTTTATTTTCCACAATAGTAAAAACTCTATTAAATATGGACAACAACAACATCC
                                                      consensus depths                                                                                                                                                                                                                                                                                                        2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     5     3     5     3     5     3     5     3     5     3     5     2     4     2     4     2     3     2     3     3     4     3     4     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     3     3     3     3     3     3     3     3     3     2     3     3     3     3     3     3     3     5     5     3     3     3     3     3     3     3     3     2     2     4     4     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG     154     195                                                                                                                                                                                                                                                                                                   
                                               BLH MIN      61     123                                                                                                                                                                                                                                                                                                   
                                               BLH OVR     154     243                                                                                                                                                                                                                                                                                                   
                                               ORF LNG     154       9                                                                                                                                                                                                                                                                                                   
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ce ---- 6e-022     NP_491746.1 C.Elegans Homeobox (ceh-2) [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ci ---- 1e-030     BAE06399.1 transcription factor protein [Ciona intestinalis] ----------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                           PROTEIN --- Ag ---- 1e-030     XP_321480.3 AGAP001619-PA [Anopheles gambiae str. PEST] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 3e-034     NP_524825.1 CG9930-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Sp ---- 2e-044     XP_001185709.1 PREDICTED: similar to emx [Strongylocentrotus purpuratus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xt ==== 2e-085     CAJ82390.1 empty spiracles homolog 1 (Drosophila) [Xenopus tropicalis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Dr ==== 4e-127     NP_571355.2 empty spiracles homeobox 2 [Danio rerio] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Cf ==== 6e-130     XP_853333.1 PREDICTED: similar to empty spiracles homolog 2 [Canis familiaris] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Mm ==== 5e-130     NP_034262.2 empty spiracles homolog 2 [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Bt ==== 4e-130     NP_001069313.1 empty spiracles homeobox 2 [Bos taurus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Hs ==== 4e-130     NP_004089.1 empty spiracles homolog 2 [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Gg ==== 1e-130     XP_421783.2 PREDICTED: hypothetical protein [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xl ==== 7e-143     NP_001086052.1 MGC81839 protein [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xl3.1-PBX0142D03.5                                                                                                                                                                                                                                                                                                                                                                                                                            TGA---TGA------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------TAA---------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------TGA---ATG---------------------------------TAA------TAA------------------------------------------------------------------------------------------------------------TGA------------------ATG------------------------------------------TAG------TAA---------------------TGA------------TAA---------------ATG---------------------------------------------TGA---------------TAA---------------------------------------------------------------TGA------------------------------TAA---------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                  ... open reading frame                                                                                                   ]
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  5   1   2      skin Kid                             IMAGE:7008205.5p                                                                                                                                                                                     CTCATCGGACTCGGTCGCAGTGTGAGACTGTCGGGGCGACGAGAGGAAGAATCGGCCGAGTCAGGGGCGAAACGGTGGCGCAAAGCTTCAAATCACTGCCAGAGACTGAGATCGGCCGAGGATTCTTCTATTTGGGGCGCGGGGAGATCAGCTGGAGCTTTTGCTGTTGGTTCTTCCATTTCTTTCAGTCTGTCTGGGCCCTTCTCCTCCCCCGACCCCTCTGCTTCCGGCTGACACTGAAgggggtcggggttcgggggCAACATGTTCCAACCCACCCCAAAAAGGTGTTTTACCATCGAGTCGTTGGTGGCTAAAGACTTGCCGATCTCTCGCTCCGACGACCCCATCCGACCCGCCGCCCTCAGTTATTCCAACTCTGCGCCCCTGAACCCTTTTATCAACGGCTTCCACCCCACGGCCAGGGGCGTCTACTCCAACCAGGACTTGGTCTTTGCTGAAGCCATTTCTCACCCGCCCAacccggctgtccctgtgcacccagtgcccccaccccatgccctgtcagcgcaccccctgcCGAACCCTCACTCCCCGCACCCCCTTTTTTCATCTCAGCAACGGGACCCCTCAACCTTCTACCCCTGGTTAATACACCGGTACCGCTACCTGGGACACAGATTCCAAGGGCACGACCCGAGTGCTGAGAGTTTCTTCTCCACACGCACTGGCCGAAAACCAAACGGATCCGCACGCTTTCTCCCCTCTCAGTTCTGCGCCTGGACACGCTT
  5   1   2       bld Neu7      in                         XL019n12.5p                                                                                                                                                                                                                                                                                       GCAGANACTGAGATCGGCCGAGGATTCTTCTATTTGGGGCGCGGGGAGATCAGCTGGAGCTTTTGCTGTTGGTTCTTCCATTTCTTTCAGTCTGTCTGGGCCCTTCTCCTCCCCCGACCCCTCTGCTTCCGGCTGACACTGAAgggggtcggggttcgggggCAACATGTTCCAACCCACCCCAAAAAGGTGTTTTACCATCGAGTCGTTGGTGGCTAAAGACTTGCCGATCTCTCGCTCCGACGACCCCATCCGACCCGCCGCCCTCAGTTATTCCAACTCTGCGCCCCTGAACCCTTTTATCAACGGCTTCCACCCCACGGCCAGGGGCGTCTACTCCAACCAGGACTTGGTCTTTGCTGAAGCCATTTCTCACCCGCCCAACCCGGCTGTCCCTGTGCACCCAGTGCCCCCACCCCATGCCCTGTCAGCGCACCCCCTGCCGAACCCTCACTCCCCGCACCCCCTTTTTTCATCTCAGCAACGCGACCCCTCAACCTTC
  5   1   2       bld Egg1                               PBX0165H08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGCACGAGGCTTTACCCACCCCAAAAAGGTGTTTTACCATCGAATCGTTGGTGGCTAAAGACTCGCCGATCTCTCGCTCCGACGACCCCATCCGACCCGCCGCCCTCAGTTATTCCAACTCTGCGCCCCTGAACCCCTTTATCAACGGCTTCTCCCCCACGGCCAGAGGCGTCTACTCCAACCAGGACTTGGTCTTTGCTGAAGCCATTTCTCACCCGCCCAACCCTTCTGTccctgtgcacccagtgcccccaccccacgccctgcaccccctgccgacccctcactccccgcaccccctCTTTTCATCTCAACAACGCGACCCCTCAACCTTCTACCCCTGGTTAATACACCGGTACC
  5   1   2       bld Egg1                               PBX0145E07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGAGGGCAATGCGCAAAGGGATGAAGATGTTGTTGGTGCCCATGTTTGTTGTTGGAGAATTGGGCAGAATTAAGGAGACTGACTCTGTGCTGAGGATTTGCCCCAGTGGGGGGTATATTTTTGTACAAGGGCATATTTGCAGCCTGTAGCGTTTGGGGAAAGAAAGTGTAGGGGCAGTTCTCAGATTTTGTTTGCCAGGAGCTGCTGGGGGGTAGtttttttttttGGAGAGGAATTGGGCCACTTGTAAAGTAACTAATGGATGTGCTCATGCTGTGACCCCCCAGGGAACGACCCGAGTGCTGAGAGTTTCCTTCTCCACAACGCACTGGCCCGAAAACCCAAACGGATCCGCACCGCTTTCTCCCCCTCTCAGTTACTGCGCCTGGAACACGCCTTTGAGAAAAACCACTATGTTGTGGGCGCAGAAAGGAAACAGTTGGCGCACACGCTCAGCCTCACCGAGACCCAGGTAAAAGTTTGGTTTCAGAACAGAAGGACAAAGTTCAAACGTCAGAAACTGGAGGAAGAGGGGTCGGATTGTTCGCAGAAGAAAAAAGGGGCTCATCACATCAACAGATGG
  3   1   0       add Ga18                              rxlk73a23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTNNGANCCCCGACCCTCCCTNCCCCGNGNCCCCGNNAGNANNNTTNNTCAGTGGATTCCCCANNCNGGCCGGACGCTNCATCTACAACAACCCGGAGCTGCTGTCCCTGANNTNTNACTCACTCNCCTCTGACTGTCAGTCACCTNNAGCCGCCTCACTCCTTCCTCNNACCCCCACACAGGGACCCCCTCANCCTGNNCCCCTGNCTCCTCAGGAACAGCTTCTTTGNCCACAGNTTTCAAGGCAGCGACATTTCCCAGGAGTCTTTGCTCCTACACGGCCCGTTTGNCCGAAAACCCAAGCGGATCAGANCGGCCTTTTCTCCGTCACANCTGCTGAGACTGGAGAGATCGTTTGAGAAGAATCATTATGTGGTGGNNNNNNACGCAAACANCTNNCACTGNCCTCAGTCTGTCCGAGACACAGGTGAAGGTTTGGTTCCAGAACAGAAGGACAAAATACAAAAGGCAGAAGTTGGAAGAGGAAGGTCCAGATTGTGATCAGAAGAAGAAAGGGTCTCATCACATCAACCGGTGGAGAATGGCCACCAAACAGCCAATGGGGAAGACATTGATGTCACCTCCAATGACTAGTTGGGTCAGTTATGAGAGTCAATGTCAAGATGAGACTGGAGACAAACACTCAAGGATTTCACTGACACAGAATCCAGACAAGCTCAGATGCCGAGGAGGACAATAGAGACCTGCTAACACTTAGGCTCAAGGGGTGCAGGATTAACCCCCGAGAGGAGGAGGAGGAACACGTGCACTTGTTCTGTGAAGAGGTGGGACTGCTCCACCCTATGGCTGATTCTCTCATGGACTTCTGTCAGCCACAAGCAAAACCGCTCACCTGTCCTCTGTCTAGTTTTTTCCTCCCTTTTTGTTAATTTTTAATTTATTTTACTTTTTCTTTTTTTTTTGATATTTAATATTTTTATTGGTTTTCATTGTAACAAATAAANNAAAAAAAA
  3   1   0       add Eye1      out                   IMAGE:6957219.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCTTTAAGGGGTTCATTCAATTTCACTTTTGACTGTCGGTTCACCGGCAGCCGGCCTCATTCCTTTCCTTGGCACCCCCCAAAACGGGGACCCCCTCAACCTTGTACCCCCTGGCTCTTCAGGACAAGTTTCTTGGGCCACAGATTTCAAGGCAGCGACATTTCCCGGGAGTCTTTGCTCCTACACGGCCCGTTTGCCGAAAACCCCAAGCGGATCAGAACGGCCTTTTCGCCTTCACAACTGCTGAGACTGGAGAGATCGTTTGAGAAGAATCATTATGTGGTGGGGGCTGAACGCAAACAACTGGCCACTGGCCTCAGTCTGTCCGAGACACAGGTGAAGGTTTGGTTCCAGAACAGAAGGACAAAATACAAAAGGCAGAAGTTGGAAGAGGAAGGTCCAGATTGTGATCAGAAGAAGAAAGGGTCTCATCACATCAACCGGTGGAGAATGGCCACCAAACAGCCCAATGGGGAAGACATTGATGTCACCTCCAATGACTAGTTGGGTCAGTTATGAGAGTCAATGTCAAGATGAGACTGGAGACAAACACTCAAGGATTTCACTGACACAGAATCCAGACAAGCTCAGATGCCGAGGAGGACAATAGAGACCTGCTAACACTTAGGCTCAAGGGGTGCAGGATTAACCCCCGAGAGGAGGAGGAGGAACACGTGCACTTGTTCTGTGAAGAGGTGGGACTGCTCCACCCTATGGCTGATTCTCTCATGGACTTCTGTCAGCCACAAGCAAAACCGCTCACCTGTCCTCTGTCTAGTTTTTTTCTCCCTTTTTGTTAATTTTTAATTTATTTTACTTTTTCTTTTTTTTTTGATATTTAATATTTTTATTGGTTTTCATCGTAACAAAATAAACG
  5  -1   2       bld Brn2                             Brn2-za62f09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACCCCATGCCCTGTCAGCGCACCCCCTGCCGAACCCTCACTCCCCGCACCCCCTTTTTTCATCTCAGCAACGGGACCCCTCAACCTTCTACCCCTGGTTAATACACCGGTACCGCTACCTGGGACACAGATTCCAAGGCAACGACCCGAGTGCTGAGAGTTTCCTTCTCCACAACGCACTGGCCCGAAAACCCAAACGGATCCGCACCGCTTTCTCCCCCTCTCAGTTACTGCGCCTGGAACACGCCTTTGAGAAAAACCACTATGTTGTGGGCGCAGAAAGGAAACAGTTGGCGCATAGTCTCAACCTCACCGAGACCCAGGTAAAAGTCTGGTTTCAGAACAGAAGGACCAAGTTCAAGCGTCAGAAACTGGAGGAAGAGGGGTCGGATTCTTCCCaaaagaaaaaaaCC
  5   1   2      seed Egg1                               PBX0142D03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACACCGATTCCAAGGGAACGACCCGAGTGCTGAGAGTTTCCTTCTCCACAACGCACTGGCCCGAAAACCCAAACGGATCCGCACCGCTTTCTCCCCCTCTCAGTTACTGCGCCTGGAACACGCCTTTGAGAAAAACCACTATGTTGTGGGCGCAGAAAGGAAACAGTTGGCGCACACGCTCAGCCTCACCGAGACCCAGGTAAAAGTTTGGTTTCAGAACAGAAGGACAAAGTTCAAACGTCAGAAACTGGAGGAAGAGGGGTCGGATTGTTCGCAGAAGAAAAAAGGGGCTCATCACATCAACAGATGGAGGATCGCCACCAAACAAGGGAGCCCCGAGGAGATCGATGTCACATCGGACGATTAACAACGACCACTTGGGACTTCCACATTCTTTTTGCTTTTTAATGAACTTTCAAACGAGAAAACAAATAAAAGGGTTTGAGCTCCAAGGGAGTCAGACTGGACTGGGCTCAGAAGCAGAACTCACagaggagagagagagagaTGGGCGACCCCAAAGTGACCTGGGCTTCGAGGTCAACCAGCAGGGGTCAAGGTCATCCCCAGGGATTCAGTGAATAAGGACAACTCGTTTCTTTTGCACT
  5   1   2      skin Tbd1                                 AW765187.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGATCGATGTCACATCGGACGATTAACAACGACCACTTGGGACTTCCACATTCTTTTTGCTTTTTAATGAACTTTCAAACGAGAAAACAAATAAAAGGGTTTGAGCTCCAAGGGAGTCAGACTGGACTGGGCTCAGAAGCAGAACTCACagaggagagagagagagaTGGGCGACCCCAAAGTGGCCTGGGCTTCGAGGTCAACCAGCAGGGGTCAAGGTCATCCCCAGGGATTCAGTGAATAAGGACAACTCGTTTCTTTTGCACTTCCAACATTTCTCCCCCCAACAAATATATAAAAATCCTGtttttgtttttttAAATAAATTATTTCCCAAAACTTGAATTGCATGACAAATGGGTTTACACGATGTTCTAACTACCCCTCCCCAATAAAACAGGTAACTTTATAATTTAAGAGAATAGTTTCACTTCTAACCAACGCCCCCCATCCCAGAGCCAATGAA
  5   1   2       bld Tbd7      in                         XL091f14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAAGGGTTTGAGCTCCAAGGGAGTNAGACTGGACTGGGCTCAGAAGCAGAACTCACagaggagagagagagagaTGGGCGACCCCAAAGTGGCCTGGGCTTCGAGGTCAACCAGCAGGGGTCAAGGTCATCCCCAGGGATTCAGTGAATAAGGACAACTCGTTTCTTTTGCACTTCCAACATTTCTCCCCCCAACAAATATATAAAAATCCTGtttttgtttttttAAATAAATTATTTCCCAAAACTTGAATTGCATGACAAATGGGTTTACACGATGTTCTAACTACCCCTCCCCAATAAAACAGGTAACTTTATAATTTAAGAGAAATAGTTTCACTTCTAACCAACGCCCCCCATCCCAGAGCCAATGAAAGGCTTTGGTCACTGCAGCACCTCTTGCGTCACCCTACAGATTCCTGACGTCATGGAGAGTGCAATATGACGACTGAAACCCTAGTTGGCCAAGATGTTCTGCAGCAGCAGTAGCTGAAATAAATCTTTACACGAGAGTCGCACTGAGTTTTGGTG
  5   1   2       bld Egg1                               PBX0114A05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATAAGGACAACTCGTTTCTTTTGCACTTCCAACATTTCTCCCCCCAACATATATATAAAAATCCTGtttttgtttttttAAATAAATTATTTCCCAAAACTTGAATTGCATGACAAATGGGTTTACACGATGTTCTAACTACCCCTCCCCAATAAAACAGGTAACTTTATAATTTAAGAGAAATAGTTTCACTTCTAACCAACGCCCCCCATCCCAGAGCCAATGAAAGGCTTTGGTCACTGCAGCACCTCTTGCGTCACCCTACAGATTCCTGACGTCATGGAGAGTGCAATATGACGACTGAAACCCTAGTTGGCCAAGATGTTCTGCAGCAGCAGTAGCTGAAATAAATCTTTACACGAGAGTCGCACTGAGTTTTGGTGCGATAATATAGGGGGTCAGGAATGCGAtttttttttAAAGACATCTTTCCAAAATATTCTGGAATTTTATTGATCGTACAGAAATCAGTaaaaaaaaaaTATTTTGAATGCTGCAGAAATAATCAGAGGGGAGTGTTTGTGTGGACTTGGACCTGAAGCATTT
  3   1   0       add Neu7      in                         XL019n12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTGGGGGGGTCAGGATTNTGAATTCAAGTNATATTNNCAAAATTATTTGGCATTTTATTGATNGNACANAAATCNCAGTTGTTCAGTAAAAAAAAAAAATATTTTGAAATGCTGCAGAAATAAACAGAGGGGAGTGTTTGTGTGGACTTGNATCTGAAGCATTTCCCACGGTGTCTGGTGCTTTAACCCTACAGACTTGGCACAAGGAGTCGCCAAAAATGACAGTTTAATGGATCATTTTGCAGAACTGATCACTTTGGGGTTTTTTTGGCAGTACTTCGNAAGCACTGAGATTTTATTCTTCCCNATAGTAAAAAAAACGCTACTANACATGGACAACANCAACACAAATATCCTAATGNTTCCCTAATGTCTTCTACACCAGATTGTACATATTTTTGTGTTTGTGTTCATTTGTTAGAATTCTAACACACCATACCTTGCCAAGAAGTA
  3   1   2       bld Tbd7      in                         XL091f14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGAGTTTTGGTGCGATAATATAGGGGGTCAGGAATGCGATTTTTTTTAAAGACATCTTTCCAAAATATTNTGGAATTTTATTGATCGTACAGAAATCAGTAAAAAAAAAAATATTTTGAATGCTGCAGAAATAATCAGAGGGGAGTGTTTGTGTGGACTTGGACCTGAAGCATTTCCCACGGTGTCTGGTGCTTTAATTAAACCCACAGACTTGGCACAAGGAGTCTCCAAAAATGACAGTTTCATGGATCATTTTGTAGAACTGATCACTTTTGGCAGCAATTCGGAAGCACTGAGATTTTTATTTTCCACAATAGTAAAAACTCTATTAAATATGGACAACAACATCCTAATGTTTCCCCAGTGTCTTCTCCACCAGATTGTACATATTTTTGTGTTTGTGTTCATTTGTTAGAATTCTAACTCACTATAACTTCCAAGAAGTA
  3   1   2      skin Tbd1                                 AW764878.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACATCTTTCCAAAATATTCTGGAATTTTATTGATCGTACAGAAATCAGTAAAAAAAAAAATATTTTGAATGCTGCAGAAATAATCAGAGGGGAGTGTTTGTGTGGACTTGGACCTGAAGCATTTCCCACGGTGTCTGGTGCTTTAATTAAACCCACAGACTTGGCACAAGGAGTCTCCAAAAATGACAGTTTCATGGATCATTTTGTAGAACTGATCACTTTTGGCAGCAATTCGGAAGCACTGAGATTTTTATTTTCCACAATAGTAAAAACTCTATTAAATATGGACAACAACAACATCCTAATGTTTCCCCAGTGTCTTCTCCACCAGATTGTACATATTTTTGTGTTTGTGTTCATTTGTTAGAATTCTAACTCACTATATACTTCCAAGAAGTATGTGTCAATATTTTGTCAATAAAGATTTATCCAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)