Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6634178.5                      13 END     1          25        7                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:6871429.5                      43 PI      76          1      319                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:8539202.5                       5 PI      100         1      111                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012792436 Xl3.1-IMAGE:6631687.5 - 4 ESTs
                                                                       ....-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6631687.5                                                                                                                                                                                                                                                                                                                                                                             GTGCACAAGTCATTCCTTTCTTGTCCCAAGAGCACCAACAGCAAGTGGTACAGGCTGTGGAACGTGCCAAACAGGTGACCATGGCAGAGCTGAATGCTATCATTGGGCAGCAGCAACTCCAGGCACAGCATTTGTCTCACGCACATGGACTCCCAGTGCCTCTCACTCCGCATCCTTCTGGGCTTCAACCTCCAGCCATTCCTTCTATTGGGAGCAGTGCAGGATTGCTGGCTCTCTCCAGTGCCCTAGGCGGTCAGTCCCACCTTCCAATTAAGGATGAGAAAAAGCACCATGACAGCGACCATCAAAGAGATAGAGATTCCATCAAGAGTTCTTCTGTATCCCCGTCTGCAAGTTTCAGAGCTGCAGAAAAACATCGGAATTCAACAGATTATTCCTCAGAAAGCAAAAAGCAGAAGACTGAAGAAAAAGATATTGCAGCTCGTTATGACAGTGATGGAGAAAAAAGTGATGATAACCTGGTAGTGGATGTTTCCAATGAGGACCCTTCTTCTCCCAGAGGAAGCCCAGCACATTCTCCAAGGGAGAACGGCTTGGATAAACCACGCCTTTTAAAGAAAGATGCCCCCATCAGTCCAGCCTCCATTGCCTCATCCAGTAGTACCCCTTCTTCAAAATCCAAAGAACTCAGCCTTAATGAGAAGTCCACGACTCCTGTTTCAAAATCAAACACACCCACTCCACGAAGTGATGCTCCTACACCTGGCAGCAACTCATCTGGATTGCGACCTATTCCTGGCAAGCCACCAGGTGTTGATCCGTTATCAGGTCTTAGGACACCTATGGCTGTTCCGTGCCCTTATCCAACCCCTTTTGGGATTGTGCCACATGCTGGGATGAATGGTGATCTGACCAGTCCAGGACCTGCTTATGCCAGTCTTCATAATATCTCCCCACAAATGAGTGCAGCGGCGGCTGCAGCTGCGGCGGCTGCTGCTT
                                                  Xl3.1-CHK-1012707317                                                                                                                                                                                                                                                                                                                                                                                   AAGTCATTCCTTTCTTGTCCCAAGAGCACCAACAGCAAGTGGTACAGGCTGTGGAACGTGCCAAACAGGTGACCATGGCAGAGCTGAATGCTATCATTGGGCAGCAGCAACTCCAGGCACAGCATTTGTCTCACGCACATGGACTCCCAGTGCCTCTCACTCCGCATCCTTCTGGGCTTCAACCTCCAGCCATTCCTTCTATTGGGAGCAGTGCAGGATTGCTGGCTCTCTCCAGTGCCCTAGGCGGTCAGTCCCACCTTCCAATTAAGGATGAGAAAAAGCACCATGACAGCGACCATCAAAGAGATAGAGATTCCATCAAGAGTTCTTCTGTATCCCCGTCTGCAAGTTTCAGAGCTGCAGAAAAACATCGGAATTCAACAGATTATTCCTCAGAAAGCAAAAAGCAGAAGACTGAAGAAAAAGATATTGCAGCTCGTTATGACAGTGATGGAGAAAAAAGTGATGATAACCTGGTAGTGGATGTTTCCAATGAGGACCCTTCTTCTCCCAGAGGAAGCCCAGCACATTCTCCAAGGGAGAACGGCTTGGATAAACCACGCCTTTTAAAGAAAGATGCCCCCATCAGTCCAGCCTCCATTGCCTCATCCAGTAGTACCCCTTCTTCAAAATCCAAAGAACTCAGCCTTAATGAGAAGTCCACGACTCCTGTTTCAAAATCAAACACACCCACTCCACGAAGTGATGCTCCTACACCTGGCAGCAACTCATCTGGATTGCGACCTATTCCTGGCAAGCCACCAGGTGTTGATCCGTTATCAGGTCTTAGGACACCTATGGCTGTTCCGTGCCCTTATCCAACCCCTTTTGGGATTGTGCCACATGCTGGGATGAATGGTGATCTGACCAGTCCAGGACCTGCTTATGCCAGTCTTCATAATATCTCCCCACAAATGAGTGCAGCGGCGGCTGCAGCTGCGGCGGCTGCTGCTTATGGAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                  1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     4     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2
                                                                                                                                                                    PROTEIN --- Dm ---- 4e-033     NP_996298.1 CG8384-PE, isoform E [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                PROTEIN --- Ci ---- 6e-035     NP_001071727.1 Groucho [Ciona intestinalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                  PROTEIN --- Ag ---- 3e-035     XP_318239.4 AGAP010324-PA [Anopheles gambiae str. PEST] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                             PREDICTED - Sp ---- 3e-049     XP_001190505.1 PREDICTED: similar to co-repressor protein groucho [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                          PROTEIN --- Dr ---- 8e-114     NP_571855.1 groucho 3 [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                          PREDICTED - ?? ---- 2e-114     XP_877614.3 PREDICTED: similar to transducin-like enhancer protein 3 isoform 4 [Bos taurus] ------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Cf ---- 1e-168     XP_533519.2 PREDICTED: similar to Transducin-like enhancer protein 4 (Groucho-related protein 4) (Grg-4) [Canis familiaris] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                        PROTEIN --- Hs ---- 4e-170     NP_008936.2 transducin-like enhancer protein 4; transducin-like enhancer of split 4;enhancer of split groucho 4; B lymphocyte gene 1 [Homo sapiens] ----------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                        PROTEIN --- Mm ---- 3e-170     NP_035730.2 transducin-like enhancer protein 4; transducin-like enhancer of split 4;transducin-like enhancer of split 4, E(spl) homolog (Drosophila); B lymphocytegene 1; groucho-related protein 4 [Mus musculus] -------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                        PROTEIN --- Gg ---- 3e-171     NP_989568.1 transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                        PROTEIN --- Bt ---- 4e-172     NP_001075052.1 transducin-like enhancer protein 4 [Bos taurus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                          PROTEIN --- Xt ---- 4e-173     CAL49370.1 transducin-like enhancer of split 4 homolog of Drosophila E(spl) [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                     PROTEIN --- Xl ---- 5e-177     O42478.2 Transducin-like enhancer protein 4 (Groucho-related protein 4) (Grg-4) (XGrg-4) (Enhancer of split groucho-like protein 2) (ESG2) (xESG2) [Xenopus laevis]  --------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6631687.5                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                             ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ...
  5   1   1       add Emb1                   IMAGE:6631687-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                             GTGCACAAGTCATTCCTTTCTTGTCCCAAGAGCACCAACAGCAAGTGGTACAGGCTGTGGAACGTGCCAAACAGGTGACCATGGCAGAGCTGAATGCTATCATTGGGCAGCAGCAACTCCAGGCACAGCATTTGTCTCACGCACATGGACTCCCAGTGCCTCTCACTCCGCATCCTTCTGGGCTTCAACCTCCAGCCATTCCTTCTATTGGGAGCAGTGCAGGATTGCTGGCTCTCTCCAGTGCCCTAGGCGGTCAGTCCCACCTTCCAATTAAGGATGAGAAAAAGCACCATGACAGCGACCATCAAAGAGATAGAGATTCCATCAAGAGTTCTTCTGTATCCCCGTCTGCAAGTTTCAGAGCTGCAGAAAAACATCGGAATTCAACAGATTATTCCTCAGAAAGCAAAAAGCAGAAGACTGAAGAAAAAGATATTGCAGCTCGTTATGACAGTGATGGAGAAAAAAGTGATGATAACCTGGTAGTGGATGTTTCCAATGAGGACCCTTCTTCTCCCAGAGGAAGCCCAGCACATTCTCCAAGGGAGAACGGCTTGGATAAACCAAGGCTTTTGAAGAAGGATGCCCCAATCAGTCCAGCCTCCATTGCCTCATCCAGTAGTACCCCTTCTTCAAAATCCAAAGAACACAGCCATAATGAGAAGTCCACGACTCCTGTTTCAAAATCAAACACACCCACACCACGAACTGATGCTC
  5   1   1       add Emb1                            IMAGE:6631687.5p                                                                                                                                                                                                                                                                                                                                                                               GCACAAGTCATTCCTTTCTTGTCCCAAGAGCACCAACAGCAAGTGGTACAGGCTGTGGAACGTGCCAAACAGGTGACCATGGCAGAGCTGAATGCTATCATTGGGCAGCAGCAACTCCAGGCACAGCATTTGTCTCACGCACATGGACTCCCAGTGCCTCTCACTCCGCATCCTTCTGGGCTTCAACCTCCAGCCATTCCTTCTATTGGGAGCAGTGCAGGATTGCTGGCTCTCTCCAGTGCCCTAGGCGGTCAGTCCCACCTTCCAATTAAGGATGAGAAAAAGCACCATGACAGCGACCATCAAAGAGATAGAGATTCCATCAAGAGTTCTTCTGTATCCCCGTCTGCAAGTTTCAGAGCTGCAGAAAAACATCGGAATTCAACAGATTATTCCTCAGAAAGCAAAAAGCAGAAGACTGAAGAAAAAGATATTGCAGCTCGTTATGACAGTGATGGAGAAAAAAGTGATGATAACCTGGTAGTGGATGTTTCCAATGAGGACCCTTCTTCTCCCAGAGGAAGCCCAGCACATTCTCCAAGGGAGAACGGCTTGGATAAACCAAGGCTTTTGAAGAAGGATGCCCCAATCAGTCCAGCCTCCATTGCCTCATCCAGTAGTACCCCTTCTTCAAAATCCAAAGAACACAGCCATAATGAGAAGTCCACGACTCCTGGTTCAAAATCAAACACACCCACACCACGAACTGATGCTCCTACACCTGGCAGCAACTCGTCTGGATTGCGACCTGTTCCTGGCAAGCCACCCAGTGTTGATCCATTAACAGGGTCTTCGGACACCTATGGCTGGTTCCGTGCCCTTATCCAACCCCATTTCGGGGATGGTGCCACATGCCTGGGAATGAAACGGTGAATCTGACCCAGGTCCAAGAACCTGCT
  5   1   2      seed DMZ       out                        xl225j16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCATGACAGCGACCATCAAAGAGATAGAGATTCCATTAAGAGTTCTTCTGTATCTCCGTCTGCAAGTTTCAGAGCTGCAGAAAAACATCGAAATTCAACGGATTATCCCTCAGACAGCAAAAAGCAGAAGACTGAAGAAAAAGATATTGCAGCTCGCTATGACAGTGATGGCGAAAAAAGCGATGATAACCTGGTAGTGGATGTTTCCAATGAGGACCCTTCTTCTCCCAGAGGAAGCCCAGCACATTCTCCGAGGGAAAACGGCTTGGATAAACCACGCCTTTTAAAGAAAGATGCCCCCATCAGTCCAGCCTCCATTGCCTCATCCAGTAGTACCCCTTCTTCAAAATCCAAAGAACTCAGCCTTAATGAGAAGTCCACGACTCCTGTTTCAAAATCAAACACACCCACTCCACGAAGTGATGCTCCTACACCTGGCAGCAACTCATCTGGATTGCGACCTATTCCTGGCAAGCCACCAGGTGTTGATCCGTTATCAGGTCTTAGGACACCTATGGCTGTTCCGTGCCCTTATCCAACCCCTTTTGGGATTGTGCCACATGCTGGGATGAATGGTGATCTGACCAGTCCAGGACCTGCTTATGCCAGTCTTCATAATATCTCCCCACAAATGAGTGCAGCGGCGGCTGCAGCTGCGGCGGCTGCTGCTTATGGA
  5   1   2       bld DMZ                                  xl225l16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGACCATCAAAGAGATAGAGATTCCATTAAGAGTTCTTCTGTATCTCCGTTCTGCAAGTTTCAGAGCTGCAGAAAAACATCGAAATTCAACGGATTATCCCTCAGACAGCANAAAGCAGAAGACTGAAGAAAAAGATATTGCAGCTCGCTATGACAGTGATGGCGAAAAAAGCGATGATAACCTGGTAGTGGATGTTTCCAATGAGGACCCTTCTTCTCCCAGAGGAAGCCCAGCACATTCTCCGAGGGAAAACGGCTTGGATAAACCACGCCTTTTAAAGAAAGATGCCCCCATCAGTCCAGCCTCCATTGCCTCATCCAGTAGTACCCCTTCTTCAAAATCCAAAGAACTCAGCCTTAATGAGAAGTCCACGACTCCTGTTTCAAAATCAAACACACCCACTCCACGAAGTGATGCTCCTACACCTGGCAGCAACTCATCTGGATTGCGACCTATTCCTGGCAAGCCACCAGGTGTTGATCCGTTATCAGGTCTTAGGACACCTATGGCTGTTCCGTGCCCTTATCCAACCCCTTTTGGGATTGTGCCACATGCTGGGATGAATGGTGATCTGACCAGTCCAGGACCTGCTTATGCCAGTCTTCATAATATCTCCCCACAAATGAGTGCAGCGGCGGCTGCAGCTGCGGCGGCTGCTGCTTATGGAAGAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)