Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   0.0    0Xl3.1-XL477k01ex.3.5                       71 END     1          16        1                (no blast hit)
     2   2.0    0Xl3.1-XL064i22.5                            2 END     1          16       50                PREDICTED: similar to receptor tyrosine kinase [Gallus gallus]

 This cluster: approximate FL confidence score = 0%

 1012793751 Xl3.1-IMAGE:6875560.5 - 6 ESTs
                                                                       .-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6875560.5                                                                                                      ATACATCAAACAGTGATGTATGGTCCTTTGGAGTATTATTGTGGGAAATTGTAAGCCTTGGTGGAACACCATATTGTGGGCTGACGTGTGCAGAACTCTATGAAAAGCTTCCACAAGGATACAGACTTGAGCAGCCTCTGAATTGTGATGATGAAGTGTATGACCTTATGCGGCAGTGCTGGCGTGAGAAACCATATGAAAGACCATCATTTGCTAAAATTGTGGTGTCCCTTAACCGAATGTTAGAAGAAAGAAAGACTTATGTGAATACAACACTCTATGAAAAGTTCACGTATGCTGGGATTGACTGTTCTGCTGAGGAGGCTGCATAGTTTTAATACAGCGCATTCCCAATCTGTCGGTCCAGTTCATTGAGTGGAAATGTTAAAATGTATTTTTGCGGTGTATAGAAGATATGTAGGATACTTTGTTTAAATGAGCATATATTTTTATCACTATGTAAATATGTTTGTATCTGTAAGCTGCTTCAATAGTTCAACTGTTAGAAGCAAACTTTTTTATTGATAGAATCCTATAATACTGCCTTATACACGTAACAAAGTTTACTCTTAATAGCAACAAGAGAATTTGATGAAAACTGTGTTGATGTTTTTGAAAATGGCGTGCTTGTAAATTCTCCATTTAACAAATTCAGCATTCACAACGTTTTGCTTTCGCATTTTTCCCTATTTGTTTTATTTTATGTTGTTGCTGAAATAAGCTTTATACAAC
                                                  Xl3.1-CHK-1012703044                                                                                                            CAAACAGTGATGTATGGTCCTTTGGAGTATTATTGTGGGAAATTGTAAGCCTTGGTGGAACACCATATTGTGGGCTGACGTGTGCAGAACTCTATGAAAAGCTTCCACAAGGATACAGACTTGAGCAGCCTCTGAATTGTGATGATGAAGTGTATGACCTTATGCGGCAGTGCTGGCGTGAGAAACCATATGAAAGACCATCATTTGCTAAAATTGTGGTGTCCCTTAACCGAATGTTAGAAGAAAGAAAGACTTATGTGAATACAACACTCTATGAAAAGTTCACGTATGCTGGGATTGACTGTTCTGCTGAGGAGGCTGCATAGTTTTAATACAGCGCATTCCCAATCTGTCGGTCCAGTTCATTGAGTGGAAATGTTAAAATGTATTTTTGCGGTGTATAGAAGATATGTAGGATACTTTGTTTAAATGAGCATATATTTTTATCACTATGTAAATATGTTTGTATCTGTAAGCTGCTTCAATAGTTCAACTGTTAGAAGCAAACTTTTTTATTGATAGAATCCTATAATACTGCCTTATACACGTAACAAAGTTTACTCTTAATAGCAACAAGAGAATTTGATGAAAACTGTGTTGATGTTTTTGAAAATGGCGTGCTTGTAAATTCTCCATTTAACAAATTCAGCATTCACAACGTTTTGCTTTCGCATTTTTCCCTATTTGTTTTATTTTATGTTGTTGCTGAAATAAGCTTTA
                                                      consensus depths                                                                                                           2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     5     3     5     3     5     3     5     3     6     3     6     6     6     4     6     6     6     6     6     6     6     6     6     6     6     4     6     4     6     4     6     6     6     6     6     6     6     6     6     6     6     4     6     3     6     3     5     3     5     3     5     3     5     3     5     3     5     3     5     2     5     2     5     2     5     2     5
  3   1   2       bld Tad2      in                    IMAGE:6875560.3p TCGGGGGGGTTTATTTCTCCTCCAACACCCCGGGGGGGGGGTGGGGCGCTCCCCTTTTGGGGGGATATTTATTTGGGGGGGGAAAAAATTTTTAAAACCCCCTTGGGTGGGGCCCCCCCCCCCTTTTTTTTGGGGGGGTTAAAACCGTTGTCCACAAAAAATTTTTTTGGAAAAAAAGCTTTCCCCCACAGGGATTACCGAAACTTGAGCCCACCCTTCGAAAATTTTGGAAGGAAAAAAGGTTTACCCCCCTTTATTCGGGCCATTGTTGGGCGTGAGGAAAACCATTTGGAAAAGGCCCTTCATTTGGTTAAAAATTGGGGGGTTTCTTTAACCCGGAAGTTGAAGGAAAGAAAGACTTATGTGAATACAACACTTTATGAAAAGTTCACGTATGCTGGGATTGACTGTTCTGCTGAGGAGGCTGCATAGTTTTAATACAGCGCATTCNCAATCTGTCGGTCCAGTTCATTGAGTGGAAATGTTAAAAATGTATTTTTGCGGTGTATAGAAGATATGTAGGATACTTTGTTTAAATGAGCATATATTTTTATCACTATGTAAATATGTTTGTATCTGTAAGCTGCTTCAATAGTTCAACTGTTAGAAGCAAACTTTTTTATTGATAGAATCCTATAATACTGCCTTATACACGTAACAAAGTTTACTCTTAATAGCAACAAGAGAATTTGATGAAAACTGTGTTGATGTTTTTGAAAATGGCGTGCTTGTAAATTCTCCATTTAACAAATTCAGCATTCACAACGTTTTGCTTTCGCATTTTTCCCTATTTGTTTTATTTTATGTTGTTGCTGAAATAAGCTTTATACAAC
  3   1   2       bld Tbd7      out                        XL064i22.3p                                                                                          ACTACAGTGTCTATACATCAAACAGTGATGTATGGTCCTTTGGAGTATTATTGTGGGAAATTGTAAGCCTTGGTGGAACACCATATTGTGGGCTGACGTGTGCAGAACTCTATGAAAAGCTTCCACAAGGATACAGACTTGAGCAGCCTCTGAATTGTGATGATGAAGTGTATGACCTTATGCGGCAGTGCTGGCGTGAGAAACCATATGAAAGACCATCATTTGCTAAAATTGTGGTGTCCCTTAACCGAATGTTAGAAGAAAGAAAGACTTATGTGAATACAACACTCTATGAAAAGTTCACGTATGCTGGGATTGACTGTTCTGCTGAGGAGGCTGCATAGTTTTAATACAGCGCATTCCCAATTTGTCGGTCCAGTTCATTGAGTGGAAATGTGTAAATGTATTTTTGCGGTGTATAGACGATATGTAGGATACTTTGTTTAAATGAGCATATATTTTTATCACTATGTAAATATGTTTGTATCTGTAAGCTGCTTCAATAGTTCAACTTTTAGAAGCAAACTTTTTTATTGATAGAATCCTATAATACTGCCTTATACACGTAACAAAGTTTACTCTTAATAGTAACAANAGAATTNATAAACTGAATGATGTG
  5   1   2      seed Tad2      in                    IMAGE:6875560.5p                                                                                                     TATACATCAAACAGTGATGTATGGTCCTTTGGAGTATTATTGTGGGAAATTGTAAGCCTTGGTGGCACACCATATTGTGGGCTGACGTGTGCAGAACTCTATGAAAAGCTTCCACAAGGATACAGACTTGAGCAGCCTCTGAATTGTGATGATGAAGTGTACGACCTTATGCGGCAGTGCTGGCGTGAGAAACCATATGAAAGACCATCATTTGCTAAAATTGTGGTGTCCCTTAACCGAATGTTAGAAGAAAGAAAGACTTATGTGAATACAACACTCTATGAAAAGTTCACGTATGCTGGGATTGACTGTTCTGCTGAGGAGGCTGCATAGTTTTAATACAGCGCATTCCCAATCTGTCGGTCCAGTTCATTGAGTGGAAATGTTAAAATGTATTTTTGCGGTGTATAGAAGATATGTAGGATACTTTGTTTAAATGAGCATATATTTTTATCACTATGTAAATATGTTTGTATCTGTAAGCTGCTTCAATAGTTCAACTGTTAGAAGCAAACTTTTTTATTGATAGAATCCTATAATACTGCCTTATACACGTAACAAAGTTTACTCTTAATAGCAACAAGAGAATTTGATGAAAACTGTGTTGATGTTTTTGAAAATGGCGTGCTTGTAAATTCTCCATTTAACAAATTCAGCATTCACAACGttttgctttcgcatttttcccctatttgnttttatttttATGGTGGTGGCTGAAAATAAGCTTTTATACCACCCGAGGTAGGAAAATATAATTTAT
  3   1   2       bld Egg6                            IMAGE:4435041.3p                                                                                                                                                                                                                                                                         CCTTATGCGGCAGTGCTGGCGTGAGAAACCATATGAAAGACCATCATTTGCTAAAATTGTGGTGTCCCTTAACCGAATGTTAGAAGAAAGAAAGACTTATGTGAATACAACACTCTATGAAAAGTTCACGTATGCTGGGATTGACTGTTCTGCTGAGGAGGCTGCATAGTTTTAATACAGCGCATTCCCAATCTGTCGGTCCAGTTCATTGAGTGGAAATGTTAAAATGTATTTTTGCGGTGTATAGACGATATGTAGGATACTTTGTTTAAATGAGCATATATTTTTATCACTATGTAAATATGTTTGTATCTGTAAGCTGCTTCAATAGTTCAACTGTTAGAAGCAAACTTTTTTATTGATAGAATCCTATAATACTGCCTTATACACGTAACAAAGTTTACTCTTAATAGCAACAAGAGAATTTGATGAAAACTGTGTTGATGTTTTTGAAAATGGCGTGCTTGTAAATTCTCCATTTAACAAATTCAGCATTCACAACGTTTTGCTTTCGCATTTTTCCCTATTTGTTTTATTTTATGTTGTTGCTGAAATAAGCTTTATACAACAGAGTAGAAAATA
  3   1   2       add Ov1                             IMAGE:5074785.3p                                                                                                                                                                                                                                                                                                                                                                                                                                        ATGCTGGGATTGACTGTTCTGCTGAAGAGGCTGCATAAGATTAATACAGCGCCTTCATCATGTTAAAATATATTTTTGTTGTGTATAGTCAATATGTAGGATACTTTTTTTAAATTAGCATATATTTTTATCACTGTGTAAATATATTTTTATCTGTAAGATGACATATATTTGTAATGTTAGAAGAAACATTTTTTTATAGATAAAACCCTATAATAGTGCATTATACATATCACAAAGTTCACTTTTAATAGTAACGCGAGTTTATGTTTTTGAAAATGGTGTGCGTGTAAACTGTCCATTTCACAAATTAAGCAATCATAACATATTGGTTTAGCATTTCCCCCTCTTTTGTGTTTTTTTAATGCTGTTGCTGAAATAAGCGTTTTACAACAGAGTAGAACATATATTTATTTAAACAGTTTCTGTCTAAAAAAAAACAGCAACAGTGCAGTGCAATTGTCTGAGCTTTTTCTCTATCAATCATGTATAAGCTTTCTATATAATTTTTTTAAGAAAATGAAAATTATGTTCCTAGCTTTAAGCATGTTGTTTAAAGGGGATCTAAAGTCCTGAACAAAAAAAAAAAAAAAG
  3   1   1       add Tbd7      out                        XL088g23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCCTTCATCATGTTAAAATANATTTTTGTTGTGTATAGTCAATATGTAGGATACTTTTTTTAAATTAGCATATATTTTTATCACTGTGTAAATATATTTTTATCTGTAAGATGACATATATTTGTAATGTTAGAAGAAACATTTTTTTATAGATAAAACCCTATAATAGTGCATTATACATATCACAAAGTTCACTTTTAATAGTAACGCGAGTTTGATGAACATTAATGATGTTCTTATGTTTTTGAAAATGGTGTGCGTGTAAACTGTCCATTTCACAAATTAAGCAATCATAACATATTGGTTTAGCATTTCCCCCTCTTTTGTGTTTATTAATGCTGTTGCTGAAATAAGCGTAAGAGTAGAACATATATTTATTTAAACAGTTTCTGTCTAAAAAAAAAACAGCTGCAGTGCAATTGTCTGAGCTTTTTCTCTATCAATCATGTATAAGCTTTCTATATAATTTTTTTAAGAAAATGAAAATTATGTTCCTAGCTTTAAGCATGTTGTTTAAAGGGGATCTAAAGTCCTGAACAAAAAAAATAAAATTATGTTTGCCACATTCAAATAAAGTACTATGTAAAATAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)