Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:8074673.5                       6 END     2         100       33                hypothetical protein LOC779128 [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL211d08.3.5                         38 PI      94        642      775                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:4030877-IMAGp.5.5              35 PI      95        591      775                Cyb561 protein [Xenopus laevis]
     4   0.0    0Xl3.1-IMAGE:7206741.5                      20 PI      85        577      775                (no blast hit)
     5   0.0    0Xl3.1-IMAGE:6871728.5                      18 PI      89        589      775                (no blast hit)
     6   0.0    0Xl3.1-xlk62e21ex.3                         17 PI      94        577      775                (no blast hit)
     7   0.0    0Xl3.1-XL199l21.5                           12 PI      84        577      775                Forkhead box protein K2 (FoxK2) (Interleukin enhancer-binding factor 1) (ILF1) (xFoxK1)
     8   0.0    0Xl3.1-IMAGE:6956507.3                      11 PI      89        577      775                (no blast hit)
     9   0.0    0Xl3.1-XL456o04ex.5                         11 PI      88        577      775                (no blast hit)
    10   0.0    0Xl3.1-IMAGE:4202174.5                      10 PI      90        589      775                (no blast hit)
    11   0.0    0Xl3.1-XL042p16.3.5                          9 PI      90        576      717                (no blast hit)
    12   0.0    0Xl3.1-XL097a05.3                            9 PI      89        577      755                (no blast hit)
    13   0.0    0Xl3.1-IMAGE:7982665.5                       8 PI      93        589      775                (no blast hit)
    14   0.0    0Xl3.1-XL019j21.3                            6 PI      94        577      734                (no blast hit)
    15   0.0    0Xl3.1-IMAGE:8070843.3                       4 PI      94        577      775                (no blast hit)
    16   0.0    0Xl3.1-IMAGE:5085085.5                       4 PI      93        577      722                (no blast hit)
    17   0.0    0Xl3.1-IMAGE:8550168.5                       4 PI      90          5      366                (no blast hit)
    18   0.0    0Xl3.1-XL064p08.5                            4 PI      90        577      756                (no blast hit)
    19   0.0    0Xl3.1-XL504l17ex.3                          4 PI      89        577      775                (no blast hit)
    20   0.0    0Xl3.1-IMAGE:6871952.3                       4 PI      86        577      775                (no blast hit)
    21   0.0    0Xl3.1-IMAGE:8526497.5                       4 PI      85        576      775                (no blast hit)
    22   0.0    0Xl3.1-XL516h19ex.3                          3 PI      92        589      773                (no blast hit)
    23   0.0    0Xl3.1-IMAGE:6877910.3                       3 PI      91        577      774                (no blast hit)
    24   0.0    0Xl3.1-PBX0015G12.5                          3 PI      90        576      772                (no blast hit)
    25   0.0    0Xl3.1-XL083l04.3                            3 PI      89        577      775                (no blast hit)
    26   0.0    0Xl3.1-PBX0100F03.5                          3 PI      86        577      775                PREDICTED: similar to CG14483-PA [Canis familiaris]
    27   0.0    0Xl3.1-XL403i06ex.3                          2 PI      96        577      775                (no blast hit)
    28   0.0    0Xl3.1-IMAGE:3580064-IMAGp.5                 2 PI      89        577      775                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012793884 Xl3.1-xl340e05.3 - 2 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl340e05.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACCCTGAGATTGCCCTATCTCAATCAGTTCTCTTGCTGGTGTCCGACTCGGCAAATCACCCTGCTGCAGTGCTTATGGCTGAAGGGCACCCACTGGTGGTCAGCTCCGATGACCCATCCATCTTCGGTGCTCAGGGAATTTCGTATGACTTTTACGAGATGTTTATGGGAATTGGAGGTGCCAAGGCAGATCTGAGGACCCTCAAAAAGCTCGCTGAGAATTCTATCAAGTACAGCGCTTTGTCGAAGGAGGGAAAAGAGAAACTTACAGAAATATGGCAGAAGAAATGGGACAAGTTTATAAAAGATCTGGCCATGAACTGGAAGAAGGAGCTGTAGGGTGGTGTGTGAGTGCTTTTGCTTCAGGATTTGCTTTTGCCAATCAGGATTTGGTAATGGAGACCAGCGGGTCTGGAAACATTTTCGCATAAAAAGGGAAGCGAGTTTATAAATTCCCAGCATTCCTCATATAAAGATAAGGACATTTTTACCCACACTCCCATCTGCATAGACCATTCACAGCTATTCTGAGCCCACCTATAAGCCACCTAAATCCTGTCCCTTCTGAATCCAGAGTTTAAAGGGAAACTAAAGTCTCAAATAGAATAAGGTTAGAAATGCTGTATTTTGTATACTAAACATAAACATGAACTTACTGCACCACAAGCCTAATCAAACAAATGATTTATGCTTTCAAAGTTGGCCACAGGGGGTCACCATCTTGTAACTTTGTTATATATCTTTGCAAGACCAAGACTGTGCACATGCTCAGTGTGTCGGGCGCTAGGATGATACTCACCTTTTT
                                                  Xl3.1-CHK-1012715724                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGATTGCCCTATCTCAATCAGTTCTCTTGCTGGTGTCCGACTCGGCAAATCACCCTGCTGCAGTGCTTATGGCTGAAGGGCACCCACTGGTGGTCAGCTCCGATGACCCATCCATCTTCGGTGCTCAGGGAATTTCGTATGACTTTTACGAGATGTTTATGGGAATTGGAGGTGCCAAGGCAGATCTGAGGACCCTCAAAAAGCTCGCTGAGAATTCTATCAAGTACAGCGCTTTGTCGAAGGAGGGAAAAGAGAAACTTACAGAAATATGGCAGAAGAAATGGGACAAGTTTATAAAAGATCTGGCCATGAACTGGAAGAAGGAGCTGTAGGGTGGTGTGTGAGTGCTTTTGCTTCAGGATTTGCTTTTGCCAATCAGGATTTGGTAATGGAGACCAGCGGGTCTGGAAACATTTTCGCATAAAAAGGGAAGCGAGTTTATAAATTCCCAGCATTCCTCATATAAAGATAAGGACATTTTTACCCACACTCCCATCTGCATAGACCATTCACAGCTATTCTGAGCCCACCTATAAGCCACCTAAATCCTGTCCCTTCTGAATCCAGAGTTTAAAGGGAAACTAAAGTCTCAAATAGAATAAGGTTAGAAATGCTGTATTTTGTATACTAAACATAAACATGAACTTACTGCACCACAAGCCTAATCAAACAAATGATTTATGCTTTCAAAGTTGGCCACAGGGGGTCACCATCTTGTAACTTTGTTATATATCTTTGCAAGACCAAGACTGTGCACATGCTCAGTGTGTCGGGCGCTAGGATGATACTCAC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     1     1     1     1     1
                                               BLH MIN      14      35                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PROTEIN --- ?? ---- 4e-012     XP_643866.1 adenosine deaminase-related growth factor [Dictyostelium discoideum AX4] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Sp ---- 6e-018     XP_001186369.1 PREDICTED: similar to mollusk-derived growth factor; MDGF, partial [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ag ---- 8e-021     XP_308848.4 AGAP006907-PA [Anopheles gambiae str. PEST] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 3e-024     NP_524345.2 Adenosine deaminase-related growth factor D CG9621-PA [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 2e-025     NP_001025938.1 hypothetical protein LOC418160 [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 4e-031     XP_687719.1 PREDICTED: cat eye syndrome chromosome region, candidate 1b [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 4e-032     XP_875219.3 PREDICTED: similar to CECR1 [Bos taurus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 4e-033     XP_854797.1 PREDICTED: similar to cat eye syndrome critical region protein 1 isoform a precursor [Canis familiaris] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Hs ---- 5e-035     NP_803124.1 cat eye syndrome critical region protein 1 isoform b [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 2e-053     NP_001090531.1 insect-derived growth factor-B-like protein [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-xl340e05.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATG---------------------------------------------------------------------------------ATG---ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------TAG---------TGA------------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------TGA---------TAA------TAA------------------------------------------------------TAA---TAG------------------------------------------------------TAA---------TGA---ATG---------------------------------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ... open reading frame                                                                                                                                                                                                                                              ]
  3   1   2       bld FaBN 5g3  out                   IMAGE:8074673.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACCCTGAGATTGCCCTATCTCAATCAGTTCTCTTGCTGGTGTCCGACTCGGCAAATCACCCTGCTGCAGTGCTTATGGCTGAAGGGCACCCACTGGTGGTCAGCTCCGATGACCCATCCATCTTCGGTGCTCAGGGAATTTCGTATGACTTTTACGAGATGTTTATGGGAATTGGAGGTGCCAAGGCAGATCTGAGGACCCTCAAAAAGCTCGCTGAGAATTCTATCAAGTACAGCGCTTTGTCGAAGGAGGGAAAAGAGAAACTTACAGAAATATGGCAGAAGAAATGGGACAAGTTTATAAAAGATCTGGCCATGAACTGGAAGAAGGAGCTGTAGGGTGGTGTGTGAGTGCTTTTGCTTCAGGATTTGCTTTTGCCAATCAGGATTTGGTAATGGAGACCAGCGGGTCTGGAAACATTTTCGCATAAAAAGGGAAGCGAGTTTATAAATTCCCAGCATTCCTCATATAAAGATAAGGACATTTTTACCCACACTCCCATCTGCATAGACCATTCACAGCTATTCTGAGCCCACCTATAAGCCACCTAAATCCTGTCCCTTCTGAATCCAGAGTTTAAAGGGAAACTAAAGTCTCAAATAGAATAAGGTTAGAAATGCTGTATTTTGTATACTAAACATAAACATGAACTTACTGCACCACAAGCCTAATCAAACAAATGATTTATGCTTTCAAAGTTGGCCACAGGGGGTCACCATCTTGTAACTTTGTTATATATCTTTGCAAGACCAAGACTGTGCACATGCTCAGTGTGTCGGGCGCTAGGATGATACTCACCTTTTT
  3   1   2      seed DMZ  5g3  out                        xl340e05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCGCAATCACCCTGCTGCAGTGCTTATGGCTGAAGGGCACCCACTGGTGGTCAGCTCCGATGACCCATCCATCTTCGGTGCTCAGGGAATTTCGTATGACTTTTACGAGATGTTTATGGGAATTGGAGGTGCCAAGGCAGATCTGAGGACCCTCAAAAAGCTCGCTGAGAATTCTATCAAGTACAGCGCTTTGTCGAAGGAGGGAAAAGAGAAACTTACAGAAATATGGCAGAAGAAATGGGACAAGTTTATAAAAGATCTGGCCATGAACTGGAAGAAGGAGCTGTAGGGTGGTGTGTGAGTGCTTTTGCTTCAGGATTTGCTTTTGCCAATCAGGATTTGGTAATGGAGACCAGCGGGTCTGGAAACATTTTCGCATAAAAAGGGAAGCGAGTTTATAAATTCCCAGCATTCCTCATATAAAGATAAGGACATTTTTACCCACACTCCCATCTGCATAGACCATTCACAGCTATTCTGAGCCCACCTATAAGCCACCTAAATCCTGTCCCTTCTGAATCCAGAGTTTAAAGGGAAACTAAAGTCTCAAATAGAATAAGGTTAGAAATGCTGTATTTTGTATACTAAACATAAACATGAACTTACTGCACCACAAGCCTAATCAAACAAATGATTTATGCATCCAAAGTTGGCCACAGGGGGTCACCATCTTGTAACTTTGTTATATATCTTTGCAAGACCAAGACCTGTGCACATGCTCAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)