Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 94%

 1012795650 Xl3.1-IMAGE:8317626.5 - 5 ESTs
                                                                       -40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8317626.5                                         GCATCATGTCCGACTCAGGACACAGTCAGCCCAATGTGTTTATCCCTGGCCGCAACCGAAGGCGACGCTGGATGGACCAAGGACCGGCGGGAAACCTGAACCTGTCAGAGCCGGGACGAGAGAAAGACTCAGTGCTCCGGGACAGAGATCAGGAAAGATGGGAGGGGAATGATGAAGGCTGTGGCTACACAATTCAGAAAACGCCTATTATCCTCGCCAAGCCAGCCTCCGACAGGGCAAAGGCAGCAACCCCTGCGGCACCGGCTCCTATAGAAAAGCCCATTGTCCTGATGAAGGCCAGGGAAGAAGGAAAACCAACAGCCCCTGCAGAGGGCGCCGCCGTTCCCCCTGCTGCTGCAGTAGCCAAGGTAGAGAAAGAAGGACAGCGACCCACCCAACCAGTGTATCAAATACAGAACCGGGGCATGGGAGCTGCAGCAAGTGCCGGTGGCAGTGTGGATCCTGTTGTTGGTCAGGCCAAGCTGCTGCCTCCTCAGAAGATGAAACACAGCATCAAACTGGTGGATGAATACATGAACTGGTGTGACAGCGCTATTGAGTTCCTCCTGGACCAGACGGATGTGCTTGTAGTTGGGGTGCTAGGATTACAAGGCACAGGAAAGTCCACCTTGATGTCCCTGTTATCAGCAAACTCTCCGGATGATGATCAAAGGTCTTACGTGTTCCGGATGCAGAGCCAGGAGGTGAGGGAAAGAGCTGGGAACCAGACTAGCGGCATTGATTTCTTCATTAGCCAGGAGAGAATCATCTTCCTTGATACCCAGCCTATTCTCAGCCCAGCAATACTGGATCATTTGATCAATAATGACCGAAAACTGCCCCCAGAATACAATCTCCCCCACACCTACGTTGAGATGCAGTCTCTACAAATTGCTGCCTTTTTGTTCACAGTTTGTCATGTTGTCATCGTTGTACAGGATTGGTTCACAGACTTCAATTTATACCGCTTTCTTCAGACAGCCGAAATGCTGAAGCCATCGACTCCCTCTCCCAGTCATGAGTCAAGTGGCTCCTCTGGCTCAGATGAAGGCATTGAGTATTATCCACACATAGTTTTTGTGCAGAATAAATCCAAGAGAGAGGATTTCTGCCCCCGCACTTTGAAGCAGATGCACACGGTTATGGATAAACTAATGCTCCATTCACACCTGAGATACAAAGGCACCCTTTCCATGCTGGACTGCAACATCTTCCCAGGTCTGCCCTATGACTTTGTCGAGTCAGAAGTGAACTTATTCCTCATCCCAACCATGGAGAGTGACGCTGATGAGACCATATCCAGGGCAGGCACCAGTGGAATCCCCCTGTTCTCCCTCCTGCCGGCATACAAGGGGCACCCCAGCTTCCATTCCCTCGTCAGCAGACTGCGCAGCCAGATCATGT
                                                  Xl3.1-CHK-1012705429                                               TGTCCGACTCAGGACACAGTCAGCCCAATGTGTTTATCCCTGGCCGCAACCGAAGGCGACGCTGGATGGACCAAGGACCGGCGGGAAACCTGAACCTGTCAGAGCCGGGACGAGAGAAAGACTCAGTGCTCCGGGACAGAGATCAGGAAAGATGGGAGGGGAATGATGAAGGCTGTGGCTACACAATTCAGAAAACGCCTATTATCCTCGCCAAGCCAGCCTCCGACAGGGCAAAGGCAGCAACCCCTGCGGCACCGGCTCCTATAGAAAAGCCCATTGTCCTGATGAAGGCCAGGGAAGAAGGAAAACCAACAGCCCCTGCAGAGGGCGCCGCCGTTCCCCCTGCTGCTGCAGTAGCCAAGGTAGAGAAAGAAGGACAGCGACCCACCCAACCAGTGTATCAAATACAGAACCGGGGCATGGGAGCTGCAGCAAGTGCCGGTGGCAGTGTGGATCCTGTTGTTGGTCAGGCCAAGCTGCTGCCTCCTCAGAAGATGAAACACAGCATCAAACTGGTGGATGAATACATGAACTGGTGTGACAGCGCTATTGAGTTCCTCCTGGACCAGACGGATGTGCTTGTAGTTGGGGTGCTAGGATTACAAGGCACAGGAAAGTCCACCTTGATGTCCCTGTTATCAGCAAACTCTCCGGATGATGATCAAAGGTCTTACGTGTTCCGGATGCAGAGCCAGGAGGTGAGGGAAAGAGCTGGGAACCAGACTAGCGGCATTGATTTCTTCATTAGCCAGGAGAGAATCATCTTCCTTGATACCCAGCCTATTCTCAGCCCAGCAATACTGGATCATTTGATCAATAATGACCGAAAACTGCCCCCAGAATACAATCTCCCCCACACCTACGTTGAGATGCAGTCTCTACAAATTGCTGCCTTTTTGTTCACAGTTTGTCATGTTGTCATCGTTGTACAGGATTGGTTCACAGACTTCAATTTATACCGCTTTCTTCAGACAGCCGAAATGCTGAAGCCATCGACTCCCTCTCCCAGTCATGAGTCAAGTGGCTCCTCTGGCTCAGATGAAGGCATTGAGTATTATCCACACATAGTTTTTGTGCAGAATAAATCCAAGAGAGAGGATTTCTGCCCCCGCACTTTGAAGCAGATGCACACGGTTATGGATAAACTAATGCTCCATTCACACCTGAGATACAAAGGCACCCTTTCCATGCTGGACTGCAACATCTTCCCAGGTCTGCCCTATGACTTTGTCGAGTCAGAAGTGAACTTATTCCTCATCCCAACCATGGAGAGTGACGCTGATGAGACCATATCCAGGGCAGGCACCAGTGGAATCCCCCTGTTCTCCCTCCTGCCGGCATACAAGGGGCACCCCAGCTTCCATTCCCTCGTCAGCAGACTGCGCAGCCAGATCATGTCCATGT
                                                      consensus depths                                              2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     2     3     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     1     2     2     2     2     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG       5     224                                         
                                               BLH MPR       5     205                                         
                                               BLH OVR       5     168                                         
                                               ORF LNG       5      23                                         
                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ag ==== 3e-011     XP_313903.2 AGAP005036-PA [Anopheles gambiae str. PEST] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                  PROTEIN -== Dm ==== 3e-013     NP_996330.1 CG3857-PA [Drosophila melanogaster] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                          PREDICTED - ?? ---- 1e-015     XP_639079.1 hypothetical protein DDBDRAFT_0185525 [Dictyostelium discoideum AX4] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Ce ---- 7e-018     NP_497058.1 gluconokinase like (43.8 kD) (2P34) [Caenorhabditis elegans] -------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Os ---- 1e-025     NP_001056605.1 Os06g0114600 [Oryza sativa (japonica cultivar-group)] --------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                         PREDICTED - Sp ---- 9e-076     XP_001181324.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                    PREDICTED = Dr ==== 0          XP_001923815.1 PREDICTED: wu:fj67f05 isoform 1 [Danio rerio] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                    PREDICTED = Mm ==== 0          NP_082323.1 RIKEN cDNA 1500002O20 [Mus musculus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                    PREDICTED = Hs ==== 0          NP_061981.2 hypothetical protein LOC56006 [Homo sapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                    PREDICTED = Bt ==== 0          NP_001040024.1 hypothetical protein LOC615492 [Bos taurus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                    PREDICTED = Cf ==== 0          XP_533650.2 PREDICTED: hypothetical protein XP_533650 [Canis familiaris] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                    PREDICTED = Xl ==== 0          NP_001090489.1 hypothetical protein LOC779402 [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:8317626.5                                  TAA---------ATG---------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG------------------------------ATG------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG---------ATG------------------------------------ATG---------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG---ATG
                                                                   ORF                                              [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ...
  5   1   2       bld Emb4 5g                         IMAGE:4680245.5p TGCGGGTCTTTTCCGAAAATTGCGTCCGTCCCAGTAAAAGCGCGTCATGTCCGACTCAGGACACAGTCAGCCCAATGTGTTTATCCCTGGCCGCAACCGAAGGCGACGCTGGATGGACCAAGGACCGGCGGGAAACCTGAACCTGTCAGAGCCGGGACGAGAGAAAGACTCAGTGCTCCGGGACAGAGATCAGGAAAGATGGGAGGGGAATGATGTAGGCTGTGGCTACACAATTCAGAAAACGCCTATTATCCTCTTTTGCCAGCCTCCGACAGGGCAAAGGCAGCAACCCCTGCGGCACCGGCTCCTATAGAAAAGCCCATTGTCCTGATGAAGGCCAGGGAAGAAGGAAAACCAACAGCCCCTGCAGAGGGCGCCGCCGTTCCCCCTGCTGCTGCAGTAGCCAAAGTAGAGAAAGAAGGACAGCGACCCACCCAACCAGTGTATCAAATACAGAACCCGGGCATGGGAGCTGCAGCAAGTGCCGGTGGAAATGTGGATCCTGTTGTTGGGCCAGGCCAGCTGCTGCCTCCCCTCAAGAAGAAACACACCTTCAAA
  5   1   2      seed Em10 5g                         IMAGE:8317626.5p     GCTGTGTTCGAAAATTGCGTCCGTCCCAGTAAAAGCGCATCATGTCCGACTCAGGACACAGTCAGCCCAATGTGTTTATCCCTGGCCGCAACCGAAGGCGACGCTGGATGGACCAAGGACCGGCGGGAAACCTGAACCTGTCAGAGCCGGGACGAGAGAAAGACTCAGTGCTCCGGGACAGAGATCAGGAAAGATGGGAGGGGAATGATGAAGGCTGTGGCTACACAATTCAGAAAACGCCTATTATCCTCGCCAAGCCAGCCTCCGACAGGGCAAAGGCAGCAACCCCTGCGGCACCGGCTCCTATAGAAAAGCCCATTGTCCTGATGAAGGCCAGGGAAGAAGGAAAACCAACAGCCCCTGCAGAGGGCGCCGCCGTTCCCCCTGCTGCTGCAGTAGCCAAGGTAGAGAAAGAAGGACAGCGACCCACCCAACCAGTGTATCAAATACAGAACCGGGGCATGGGAGCTGCAGCAAGTGCCGGTGGCAGTGTGGATCCTGTTGTTGGTCAGGCCAAGCTGCTGCCTCCTCAGAAGATGAAACACAGCATCAAACTGGTGGATGAATACATGAACTGGTGTGACAGCGCTATTGAGTTCCTCCTGGACCAGACGGATGTGCTTGTAGTTGGGGTGCTAGGATTACAAGGCACAGGAAAGTCCACCTTGATGTCCCTGTTATCAGCAAACTCTCCGGATGATGNATCAAGGTCTTACGTGTTCCGGATGCAGAGCCAGGAGTGAGGGAAGAGCG
  5   1   2       bld Ooc3 5g                         IMAGE:3473026.5p                                AGTAAAAGCGCATCATGTCCGACTCAGGACACAGTCAGCCCAATGTGTTTATCCCTGGCCGCAACCGAAGGCGACGCTGGATGGACCAAGGACCGGCGGGAAACCTGAACCTGTCAGAGCCGGGACGAGAGAAAGACTCAGTGCTCCGGGACAGAGATCAGGAAAGATGGGAGGGGAATGATGAAGGCTGTGGCTACACAATTCAGAAAACGCCTATTATCCTCGCCAAGCCAGCCTCCGACAGGGCAAAGGCAGCAACCCCTGCGGCACCGGCTCCTATAGAAAAGCCCATTGTCCTGATGAAGGCCAGGGAAGAAGGAAAACCAACAGCCCCTGCAGAGGGCGCCGCCGTTCCCCCTGCTGCTGCAGTAGCCAAGGTAGAGAAAGAAGGACAGCGACCCACCCAACCAGTGTATCAAATACAGAACCGGGGCATGGGAGCTGCAGCAAGTGCCGGTGGCAGTGTGGATCCTGTTGGTGGTCAAGCCAAGCTGCTGCCTCCTCAGAAGATGAAA
  5   1   1       add Te2N                            IMAGE:7206092.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAAGTCCACCCTGATGTCCCTGTTATCAGCAAACTCTCCGGATGATGATCAAAGGTCTTACGTGTTCCGGATGCAGAGCCAGGAGGTGAGGGAAAGAGCTGGGAACCAGACTAGCGGCATTGATTTCTTCATTAGCCAGGAGAGAATCATCTTCCTTGATACCCAGCCTATTCTCAGCCCAGCAATACTGGATCATTTGATCAATAATGACCGAAAACTGCCCCCAGAATACAATCTCCCCCACACCTACGTTGAGATGCAGTCTCTACAAATTGCTGCCTTTTTGTTCACAGTTTGTCATGTTGTCATCGTTGTACAGGATTGGTTCACAGACTTCAATTTATACCGCTTTCTTCAGACAGCCGAAATGCTGAAGCCATCGACTCCCTCTCCCAGTCATGAGTCAAGTGGCTCCTCTGGCTCAGATGAAGGCATTGAGTATTATCCACACATAGTTTTTGTGCAGAATAAATCCAAGAGAGAGGATTTCTGCCCCCGCACTTTGAAGCAGATGCACACGGTTATGGATAAACTAATGCTCCATTCACACCTGAGATACAAAGGCACCCTTTCCATGCTGGACTGCAACATCTTCCCAGGTCTGCCCTATGACTTTGTCGAGTCAGAAGTGAACTTATTCCTCATCCCAACCATGGAGAGTGACGCTGATGAGACCATATCCAGGGCAGGCACCAGTGGAATCCCCCTGTTCTCCCTCCTGCCGGCATANCAGGGGCACCCCAGCTTCCATTCCCTCGTCAGCAGACTGCGCAGCCAGATCATGTCCATGTCACNGCCCTCACTCTCTCACACCATCCGAACCGAAAAGAACCTGGGTTCACTATGCTGCCCCGGGATTGGGGGAAGGGTGTAAAGAAAATC
  5   1   1       add Emb4                            IMAGE:5537080.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGAGATACAAGGCACCCTTTCCATGCTGGACTGCAACATCTTCCCAGGTCTGCCCTATGACTTTGTTGAGTCAGAAGTGAACTTATTCCTCATCCCAACCATGGAGAGTGACGCTGATGAGACCATATCCAGGGCAGGCACCAGTGGAATCCCCCTGTTCTCCCTCCTGCCGGCATACAAGGGGCACCCCAGCTTCCATTCCCTCGTCAGCAGACTGCGCAGCCAGATCATGTCCATGTCACGCCCTCAACTCTCTCACACCATCCTGACCGAAAAGAACTGGTTCCACTATGCTGCCCGGATTTGGGATGGTGTAAAGAAGTCATCAGCACTTTCAGAGTACAGCAGGTTACTGGGCTAATGTCACGCTTTTAAGAATGGCTAATAAAATGGTCGGCTGCTGGATGAGGGAAGACTGGCCAAGCTAAAAAGGGGCACAATATGAAGGCTCATCGATTTCCTTGGCATTCATGTTGTGCAAGGCGATGGGGACAGGAACGATCCTGAAGGAGAGAATGTTTGATACCGGGGCCGATGAAACAAATGGTTGTTCCTGGCTTTGGAAAAAAGCTGTATGAGCCCTTTAAAGGGATAACCTGTCCGGGGAAAAACttttttttttggtttatttttCGCAAAACGCCTCAGTTCAATAGCCGCTGCTCCCAGGAGAATTCTGGCCTGGAAATACCTTTTCTCCAAAAGAAACAAACTGAAGGGGTTTTAAAACTATAGATTTTCGAGAATTGCGGCGCCAGACCAAATTGTTCAGGTTtcccccgcttcccccccACGTTCGTGGGACCCCGTGGCCCTCGAGTACACGTTCGAATCCACTCTTTTCACTCGCTTGGACCCTCCCGAGCTTTGGAAGGACGATATTcccccccccACTCGATGTTTCCCGCCCACGAAGGCCGTAGCAAAGACCGACCGCTGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)