Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 26 Jul 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   0.0    0Xl3.1-XL409f06ex.5                         12 END     1          33        8                hypothetical protein LOC398915 [Xenopus laevis]
     2   2.0    0Xl3.1-IMAGE:8321115.5                       2 END     1          33       50                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012798247 Xl3.1-XL051a21.3 - 3 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL051a21.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGGATTATCATGGGCACCTTCACCCTGTGCTGGTTGCCCTTCTTCTTGGCCAACGTGGTCAATGTCTTCTACAGGAACCTGATCCCAGACAAACTCTTCCTCTTCCTCAACTGGCTGGGTACGCCAACTCCCGCGTTTAACCCCATCATCTACTGCAGGAGCCCAGACTTCAGGAAGGCTTTCAAGAGACTCCTGTGTTGCCCCAAAAGGGCAGATTGGCACCTGCAGACCACTGGGGAGCTCTCCCGAACCTCAGGGGGCTTTGTTAACTCTTTAGACACCAATGCTTTGGGTACGTGTTCTGAATGTAATGGGGTGCGGACGTCATTGGACTGAAATTAATTATTTATTGTGGGTCGGAGGGAGATTGAATAACTGGGTGCAGGGGCTGCAAATAACGGGTACGTTTATAGCAATCTCACGGCAGCTTATTGGAATCTAGAGGTTTTCCCGGGATAGGAGTGAACTCCGGAAAATGTCATCTCAATGGCTGCGGAGCTATTACATCCCGGGGATATTCACCAATACATGCCCAATGCTGATTGGTCAGTTTGACTTTCACTGTGTTACTGCCTACCAATGGGGTCAGTTGTGGGGTTGTTCCGACTAAT
                                                  Xl3.1-CHK-1012710862                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TATCATGGGCACCTTCACCCTGTGCTGGTTGCCCTTCTTCTTGGCCAACGTGGTCAATGTCTTCTACAGGAACCTGATCCCAGACAAACTCTTCCTCTTCCTCAACTGxxxGGxTACGCCxAxxxCCGCGTTTAACCCCATCATCTACTGCAGGAGCCCAGACTTCAGGAAGGCTTTCAAGAGACTCCTGTGTTGCCCCAAAAGGGCAGATTGGCACCTGCAGACCACTGGGGAGCTCTCCCGAACCTCAGGGGGCTTTGTTAACTCTTTAGACACCAATGCTTTGGGTACGTGTTCTGAATGTAATGGGGTGCGGACGTCATTGGACTGAAATTAATTATTTATTGTGGGTCGGAGGGAGATTGAATAACTGGGTGCAGGGGCTGCAAATAACGGGTACGTTTATAGCAATCTCACGGCAGCTTATTGGAATCTAGAGGTTTTCCCGGGATAGGAGTGAACTCCGGAAAATGTCATCTCAATGGCTGCGGAGCTATTACATCCCGGGGATATTCACCAATACATGCCCAATGCTGATTGGTCAGTTTGACTTTCACTGTGTTACTGCCTxxCxAxGGGGTCAGTTGTGGGGTTGTTCCGACTAATACACTT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ce ---- 1e-011     NP_001024580.1 DOPamine receptor family member (dop-1) [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 1e-012     NP_477007.1 CG9652-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                    PREDICTED - Ag ---- 8e-014     XP_315207.3 putative dopamine receptor 1 (AGAP004613-PA) [Anopheles gambiae str. PEST] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                          PREDICTED - Sp ---- 9e-014     XP_001194944.1 PREDICTED: similar to dopamine D1/beta receptor [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================
                                                                                                       PROTEIN --- Cf ---- 2e-029     NP_001008713.1 adrenergic, beta-1-, receptor [Canis familiaris] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================
                                                                                              PROTEIN --- Hs ---- 2e-029     NP_000675.1 beta-1-adrenergic receptor [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================
                                                                                                                                     PROTEIN --- Bt ---- 6e-030     NP_919242.1 adrenergic, beta-1-, receptor [Bos taurus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================
                                                                                                                               PROTEIN --- Mm ---- 4e-030     NP_031445.2 adrenergic receptor, beta 1 [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 4e-031     XP_428541.2 PREDICTED: similar to beta-4C-adrenergic receptor [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                           PROTEIN --- Dr ---- 2e-037     NP_001122161.1 beta-1-adrenergic receptor [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                          PROTEIN --- Xl ---- 1e-056     NP_001084152.1 beta-1 adrenergic receptor [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-XL051a21.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---TAA------------------------------TAA---------------------------------------------------------------------------------TAG---TGA---------------------ATG---------------------------------------ATG---------------------TGA
  3   1   2       bld Neu7                                 XL018g05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGGATTATCATGGGCACCTTCACCCTGTGCTGGTTGCCCTTCTTCTTGGCCAACGTGGTCAATGTCTTCTACAGGAACCTGATCCCAGACAAACTCTTCCTCTTCCTCAACTGGCTGGGNTACGCCAACTCCGCGTTTAACCCCATCATCTACTGCAGGAGCCCAGACTTCAGGAAGGCTTTCAAGAGACTCCTGTGTTGCCCCAAAAGGGCAGATTGGCACCTGCAGACCACTGGGGAGCTCTCCCGAACCTCAGGGGGCTTTGTTAACTCTTTAGACACCAATGCTTTGGGTACGTGTTCTGAATGTAATGGGGTGCGGACGTCATTGGACTGAAATTAATTATTTATTGTGGGTCGGAGGGAGATTGAATAACTGGGTGCAGGGGCCCCAAATAACGGGTACGTTTATAGCAATCTCACGGCAGCTTATTGGAATCTAGAGGTTTTCCCAGGATAGGAGTGAACTCCGGAAAATGTCATCTCAATGGCTGCGGAGCTATTACATCCCGGGGATATTCACCAANACATGCCAAATGCTGATTGGTCAGTTTGACTTTCACTGTGTTACTGCCTGACCAATGGGGTCAGTTGTGGGGTTGTTCCGACTAATACAC
  3   1   2      seed Tbd7      out                        XL051a21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTGCTGGTTGCCCTTCTTCTTGGCCAACGTGGGTCAATGTCTGCTACAGGAACCTGATCCCAGACAAACTTCTTCCTCAACTGGCTGGGCTACGCCAACTCCGCGTTTAACCCCATCATCTACTGCAGGAGCCCAGACTTCAGGAAGGCTTTCAAGAGACTTCCTGTGTTGCCCCAAAAAGGCAGATTGGCACCTGCAGACCACTGGGGAGCTCTCCCGAACCTCAGGGGGCTTTGTTAACTCTTTAGACACCAATGCTTTGGGTACGTGTTCTGAATGTAATGGGGTGCGGACGTCATTGGACTGAAATTAATTATTTATTGTGGGTCGGAGGGAGATTGAATAACTGGGTGCAGGGGCTGCAAATAACGGGTACGTTTATAGCAATCTCACGGCAGCTTATTGGAATCTAGAGGTTTTCCCGGGATAGGAGTGAACTCCGGAAAATGTCATCTCAATGGCTGCGGAGCTATTACATCCCGGGGATATTCACCAATACATGCCCAATGCTGATTGGTCAGTTTGACTTTCACTGTGTTACTGCCNACCAATGGGGTCAGTTGTGGGGTTGTTCCGACTAATACACTT
  3   1   2       bld Tbd7      out                        XL051e20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCTTTGTTAACTCTTTAGACACCAATGCTTTGGGTACGTGTTCTGAATGTAATGGGGTGCGGACGTCATTGGACTGAAATTAATTATTTATTGTGGGTCGGAGGGAGATTGAATAACTGGGTGCAGGGGCTGCAAATAACGGGTACGTTTATAGCAATCTCACGGCAGCTTATTGGAATCTAGAGGTTTTCCCGGGATAGGAGTGAACTCCGGAAAATGTCATCTCAATGGCTGCGGAGCTATTACATCCCGGGGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)