Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL421a16ex.5                          3 END     2         100       66                G-protein coupled receptor [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL412a11ex.5                         13 PI      86         25      537                (no blast hit)
     3   0.0    0Xl3.1-XL421a16ex.5                          3 PI      85         25      221                G-protein coupled receptor [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012798636 Xl3.1-xlk121h02ex.3 - 2 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xl3.1-xlk121h02ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         NTATGGGTGCTG------------TCTGCCCCTGTCTTTTTNTTCTCAAAACTGCAAGTGGAAAATAACAAAACAGAGTGTTTGGGGACAGCTGTCAATAGTGAGCTGNCATCTTATTTT------------TTCCTGGCTGGCTTTGGTTGTGCTCTTCCATTCCTGATCACCTTCTTGTCCTACATTGGA------------TATGGAAAATCCATGGGTTAGAACCCCGGGAGAAAAGAAAGGTGGTGACTCTGGTGTGTGTGGTTGTGCTACTCTACGCCATCTCCTTTGTGCCCTATCACATTCTGAGGAATCTCAACCAAGAACCGGCATTAGCCACATCAGATTGCAAGTGGTCTCTAAAGATCCATTCTGCTTTCAGGTGGCCAAAGCTCTTGTTTCTTTGAATCCCTGTATCCACCCACTGCTCTACACAGCCGTGATAGACAATGTCAGGGCCAAACTTGGCTGCTACCAGGAGAGCCAAGATGTGAAGTCCCAAGGAGAGAGTAGACTTTAAACCCCATGAAGTCCAAGGAGAGAGTAGACTTTAAACCCCATGAAGTCCTAAAAACATGATAAAACACAGTGCCTCAACCTAAATTCATAGGCTGAATAGATAAAGAATATGTGGGATCCATTGTACATATCAAGGAATACAGTAGCTGTGCTTAAATTTAAGTGATTCCAGGAGATCATTTGGAAGCATCCTCTTGAACCCAAAGACTGGAAGAATTCAGTAACTCTCAAACAATCAAACAGCAGGGAGTAAAGAACAATTGGACTCAAATGTATAAATGTATATATTATAACGTGTGTGTGTGTGTTATTCTTCTGTAGCATTTTTTGGCTACTTCTTTTCCATATTTGAATATTATTTTAGAATTTGAATTCTGGAGATGATTTCCTTTGTCGATGTCC
                                                  Xl3.1-CHK-1012715758                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGCTGGTAGCT------------CCTGTCTTTTTNTTCTCAAAACTGCAAGTGGAAAATAACAAAACAGAGTGTTTGGGGACAGCTGTCAATAGTGAGCTGNCATCTTATTTTCCTTAC------------GCTGGCTTTGGTTGTGCTCTTCCATTCCTGATCACCTTCTTGTCCTAC------------NGGCTGTATGGAAAATCCATGGGTTAGAACCCCGGGAGAAAAGAAAGGTGGTGACTCTGGTGTGTGTGGTTGTGCTACTCTACGCCATCTCCTTTGTGCCCTATCACATTCTGAGGAATCTCAACCxxxAxxCGGCATxxxCxxCATCAGATTGCAAGTGGTCTCTAAAGATCCATTCTGCTTTCAGGTGGCCAAAGCTCTTGTTTCTTTGAATCCCTGTATCCACCCACTGCTCTACACAGCCGTGATAGACAATGTCAGGGCCAAACTTGGCTGCTACCAGGAGAGCCAAGATGTGAAGTCCCAAGGAGAGAGTAGACTTTAAACCCCATGAAGTCCAAGGAGAGAGTAGACTTTAAACCCCATGAAGTCCTAAAAACATGATAAAACACAGTGCCTCAACCTAAATTCATAGGCTGAATAGATAAAGAATATGTGGGATCCATTGTACATATCAAGGAATACAGTAGCTGTGCTTAAATTTAAGTGATTCCAGGAGATCATTTGGAAGCATCCTCTTGAACCCAAAGACTGGAAGAATTCAGTAACTCTCAAACAATCAAACAGCAGGGAGTAAAGAACAATTGGACTCAAATGTATAAATGTATATATTATAACGTGTGTGTGTGTGTTATTCTTCTGTAGCATTTTTTGGCTACTTCTTTTCCATATTTGAATATTATTTTAGAATTTGAATTCTGGAGATGATTTCCTTTGTCG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     0     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     0     1     1     1     1     1     1     1     1     1     1     1     0     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH MIN     206      12                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Mm ---- 8e-007     NP_032799.2 purinergic receptor P2Y, G-protein coupled 2 [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Gg ---- 1e-010     NP_990664.1 ATP receptor P2Y1 [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 3e-012     NP_001035754.1 PPAN-P2RY11 protein [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Dr ---- 2e-018     XP_001923750.1 PREDICTED: hypothetical protein [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Xt ---- 2e-068     NP_001005433.1 purinergic receptor P2Y, G-protein coupled, 1 [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Xl ---- 3e-025     NP_001089146.1 G-protein coupled receptor [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================
                                                   Xl3.1-xlk121h02ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATG---TAG------------------------TGA---------------------------------------------------------TGA---------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------TAG------------ATG------------------------------------------------TGATAA------------------------------TGA---------------------------------------------------------TAA---TAA---------------------------------TGA------------------------------------------------------------------------ATG---------------------------------------------TAG------------------------------------------------------------TGA------------ATG
  3   1   2      seed Ga18 5g3  out                     xlk121h02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTNCNTGGGCATCNNNNNCNTTTNCNCAGAGGTAGNNNNGAGNNNAANCATNCNAAATNGGTCAGTTTGGNNNTATGGGTGCTGGTAGCTGCCNNCTCTGCCCCTGTCTTTTTNTTCTCAAAACTGCAAGTGGAAAATAACAAAACAGAGTGTTTGGGGACAGCTGTCAATAGTGAGCTGNCATCTTATTTTCCTTACANNCTTTTCCTGGCTGGCTTTGGTTGTGCTCTTCCATTCCTGATCACCTTCTTGTCCTACATTGGAANNNNNNGGCTGTATGGAAAATCCATGGGTTAGAACCCCGGGAGAAAAGAAAGGTGGTGACTCTGGTGTGTGTGGTTGTGCTACTCTACGCCATCTCCTTTGTGCCCTATCACATTCTGAGGAATCTCAACCTGAAGAACCGNATAGCCACATCAGATTGCAAGTGGTCTCTAAAGATCCATTCTGCTTTCAGGTGGCCAAAGCTCTTGTTTCTTTGAATCCCTGTATCCACCCACTGCTCTACACAGCCGTGATAGACAATGTCAGGGCCAAACTTGGCTGCTACCAGGAGAGCCAAGATGTGAAGTCCCAAGGAGAGAGTAGACTTTAAACCCCATGAAGTCCAAGGAGAGAGTAGACTTTAAACCCCATGAAGTCCTAAAAACATGATAAAACACAGTGCCTCAACCTAAATTCATAGGCTGAATAGATAAAGAATATGTGGGATCCATTGTACATATCAAGGAATACAGTAGCTGTGCTTAAATTTAAGTGATTCCAGGAGATCATTTGGAAGCATCCTCTTGAACCCAAAGACTGGAAGAATTCAGTAACTCTCAAACAATCAAACAGCAGGGAGTAAAGAACAA
  3   1   2       bld Ga15 5g3  out                      XL421a16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTACGCCATCTCCTGTTGTGCCCTATCACATTNTGAGGAATCTCAACCTGAAGAACCGGCATAGCCACATCAGATTGCAAGTGGTCTCTAAAGATCCATTCTGCCTTTCAGGTGGCCAAAGCTCTTGTTTCTTTGAATCCCTGTATCCACCCACTGCTCTACACAGCCGTGATAGACAATGTCAGGGCCAAACTTGGCTGCTACCAGGAGAGCCAAGATGTGAAGTCCCAAGGAGAGAGTAGACTTTAAACCCCATGAAGTCCAAGGAGAGAGTAGACTTTAAACCCCATGAAGTCCTAAAAACATGATAAAACACAGTGCCTCAACCTAAATTCATAGGCTGAATAGATAAAGAATATGTGGGATCCATTGTACATATCAAGGAATACAGTAGCTGTGCTTAAATTTAAGTGATTCCAGGAGATCATTTGGAAGCATCCTCTTGAACCCAAAGACTGGAAGAATTCAGTAACTCTCAAACAATCAAACAGCAGGGAGTAAAGAACAATTGGACTCAAATGTATAAATGTATATATTATAACGTGTGTGTGTGTGTTATTCTTCTGTAGCATTTTTTGGCTACTTCTTTTCCATATTTGAATATTATTTTAGAATTTGAATTCTGGAGATGATTTCCTTTGTCGATGTCCTTGT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)