Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 26%

 1012798865 Xl3.1-IMAGE:8546690.5 - 3 ESTs
                                                                       ...-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8546690.5                                                                                                                            CTCCCGAAGCTGATGCTGGTGCTAGGGGGAAACCGGAGAGCGAAAGGCCCCGGTCAGACATACCCGGAGTGAAGACGCGGGTCGGATCACTTTGACCCTGTCATCCATCCCAATGCCTGTTTACCCTGTGTTCAGCTTGTGTAGTGCAAGGTGTGAATGATATCCATTGAGGCCGAACCTGTATTCCTGTTGCTACTAGGGAAGTGTCCTTGATGCGAGAGCTATACTACGTGGACCATGTATGGGGTTGGGCTGAAAGTGGCCCCCAGGAAGCTGAGTCTGGTCCTGTGGGTTCTGAGTGTCACGTCATGTGTCCTGTCCACTCATGCACAGGTGTATTCTCAGACTGTCAACACACACTACGGAAAACTGCGTGGCATGCGTGTGCCTTTACCAAGCGAAATCCTGGGTCCTGTGGATCAGTACCTGGGAGTTCCCTATGCTGCACCTCCTGTGGGAGAGAAACGTTTCCTCCCACCAGAGCCACCACCCTCCTGGTCCGGAATTAGGAATGCCACCCATTTCTCGCCAGTGTGCCCTCAGAACATACAAAATGCAGTACCAGATATTATGATGCCAGTTTGGTTCACTTCAAACTTGGACACTGTAACAGGGTACTTGCAGGAACAGAGTGAGGATTGCTTGTATCTCAATATCTATGTGCCCACAGAGGATGATATCCGGGACACTGGAGCCAAGCCAGTCATGGTTTATATACATGGAGGATCATACATGGAGGGCAGTGGAAACATGATCGATGGCAGTGTACTGGCCAGCTATGGGAATGTTGTAGTCATCACCTTTAATGGCCCAGTTGCCAAGTGGGACCCAGAACTAGATCCTGTAGACCCTGTGGTAATCCAGGATCCACGGGACTACTCAACAGAGTTAAGTGTTACAATTGCTGTGGGAGCCTCCCTTCTGTTTCTCAATGTCTTGGCCTTTGCTGCTTTGTACTACCGCAATGATAAAAGACGTCAGGACACTCAAAGGCAACCAACCCCACAACGCCCAGCTGTCGCTCGGGATCCAGCACACAGTCCTCTTCCTCCTGAGGAGCTAAACTCTCTGCAGATAAATGCAGGACATCCTGAAAGTGAAGGCGGGGGTGTCTCCAGCCATGATAACCTGCGTCTCCCCACCCTTCCCGATTATACACTTACTTTGCGCAGATCTCCTGATGACATCCCACTCATGACACCTAACACCATCACCATGATCCCCAACTCACTGGTGGGACTGCAAAGCCTTCACCCATACAACACCTTTTCTGCTGGCTTCAACAACACTGGCCTCCCGCACTCACACTCCACCACTAGAGTATAGCGTCCCATTATGCTGCCCTTCCCCTTGCCCTAACAAAGAGCCACCACAAGATGTCTGCAGACAGGGGAGGGATATAAAACATTCCATACCTCCTAAAGAGGGGATAGGTGATGGAAACTTTCTTCTTAAGGAAAAGTGCTGCTCAGTTATAGCTTTCAAGGAACCACATGTCCCTGATTTTTGCTCTAAGGTGGCTTT
                                                  Xl3.1-CHK-1012713508                                                                                                                                  AAGCTGATGCTGGTGCTAGGGGGAAACCGGAGAGCGAAAGGCCCCGGTCAGACATACCCGGAGTGAAGACGCGGGTCGGATCACTTTGACCCTGTCATCCATCCCAATGCCTGTTTACCCTGTGTTCAGCTTGTGTAGTGCAAGGTGTGAATGATATCCATTGAGGCCGAACCTGTATTCCTGTTGCTACTAGGGAAGTGTCCTTGATGCGAGAGCTATACTACGTGGACCATGTATGGGGTTGGGCTGAAAGTGGCCCCCAGGAAGCTGAGTCTGGTCCTGTGGGTTCTGAGTGTCACGTCATGTGTCCTGTCCACTCATGCACAGGTGTATTCTCAGACTGTCAACACACACTACGGAAAACTGCGTGGCATGCGTGTGCCTTTACCAAGCGAAATCCTGGGTCCTGTGGATCAGTACCTGGGAGTTCCCTATGCTGCACCTCCTGTGGGAGAGAAACGTTTCCTCCCACCAGAGCCACCACCCTCCTGGTCCGGAATTAGGAATGCCACCCATTTCTCGCCAGTGTGCCCTCAGAACATACAAAATGCAGTACCAGATATTATGATGCCAGTTTGGTTCACTTCAAACTTGGACACTGTAACAGGGTACTTGCAGGAACAGAGTGAGGATTGCTTGTATCTCAATATCTATGTGCCCACAGAGGATGATATCCGGGACACTGGAGCCAAGCCAGTCATGGTTTATATACATGGAGGATCATACATGGAGGGCAGTGGAAACATGATCGATGGCAGTGTACTGGCCAGCTATGGGAATGTTGTAGTCATCACCTTTAATGGCCCAGTTGCCAAGTGGGACCCAGAACTAGATCCTGTAGACCCTGTGGTAATCCAGGATCCACGGGACTACTCAACAGAGTTAAGTGTTACAATTGCTGTGGGAGCCTCCCTTCTGTTTCTCAATGTCTTGGCCTTTGCTGCTTTGTACTACCGCAATGATAAAAGACGTCAGGACACTCAAAGGCAACCAACCCCACAACGCCCAGCTGTCGCTCGGGATCCAGCACACAGTCCTCTTCCTCCTGAGGAGCTAAACTCTCTGCAGATAAATGCAGGACATCCTGAAAGTGAAGGCGGGGGTGTCTCCAGCCATGATAACCTGCGTCTCCCCACCCTTCCCGATTATACACTTACTTTGCGCAGATCTCCTGATGACATCCCACTCATGACACCTAACACCATCACCATGATCCCCAACTCACTGGTGGGACTGCAAAGCCTTCACCCATACAACACCTTTTCTGCTGGCTTCAACAACACTGGCCTCCCGCACTCACACTCCACCACTAGAGTATAGCGTCCCATTATGCTGCCCTTCCCCTTGCCCTAACAAAGAGCCACCACAAGATGTCTGCAGACAGGGGAGGGATATAAAACATTCCATACCTCCTAAAGAGGGGATAGGTGATGGAAACTTTCTTCTTAAGGAAAAGTGCTGCTCAGTTATAGCTTTCAAGGAACCACATGTCCCTGATTTTTGCTCTAAGGTGGCTTTTACCCT
                                                      consensus depths                                                                                                                                 1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     3     1     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     156      38                                                                                                                            
                                               BLH MIN     231      87                                                                                                                            
                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ci ---- 4e-020     NP_001122349.1 acetylcholinesterase [Ciona intestinalis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Xt ---- 1e-021     NP_001120019.1 hypothetical protein LOC100144981 [Xenopus tropicalis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ce ---- 3e-023     NP_872254.1 NeuroLiGin family member (nlg-1) [Caenorhabditis elegans] ========================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Ag ---- 6e-032     XP_313317.4 AGAP003570-PA [Anopheles gambiae str. PEST] ==========================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 3e-033     NP_001036685.1 CG34127-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Sp ---- 1e-035     XP_001192426.1 PREDICTED: similar to neuroligin 2 [Strongylocentrotus purpuratus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - ?? ---- 6e-065     XP_608505.4 PREDICTED: neuroligin 1 [Bos taurus] -==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Gg ---- 5e-066     XP_425576.2 PREDICTED: similar to neuroligin X isoform 2 [Gallus gallus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Mm ==== 1e-077     NP_766520.1 neuroligin 3 [Mus musculus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Dr ==== 6e-078     XP_691171.2 PREDICTED: similar to neuroligin 3 isoform 2 [Danio rerio] ======================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Hs ---- 1e-078     NP_061850.2 neuroligin 3 [Homo sapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Bt ---- 4e-082     NP_001068972.1 neuroligin 3 [Bos taurus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Cf ---- 1e-082     XP_857490.1 PREDICTED: similar to neuroligin 3 isoform 6 [Canis familiaris] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Xl ==== 2e-109     NP_001087416.1 MGC84475 protein [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:8546690.5                                                                                                                                        ATG------------------------------------------------------TGA---------------------------------------------------------------------TAG---------TGAATG---------------------------------------------------TGA------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG---------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG---------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG---------------------------------------------------------------------------------------------------------TAG---------ATG------------------TAA------------------------------------------------------------TAA------------TGA---------------TAA---------------------------------------------TGA---------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                         ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  5   1   1       add Eye1 5g                         IMAGE:7020561.5p                                                                                                                            CTCCCGAAGCTGATGCTGGTGCTAGGGGGAAACCGGAGAGCGAAAGGCCCCGGTCAGACATACCCGGAGTGAAGACGCGGGTCGGATCACTTTGACCCTGTCATCCATCCCAATGCCTGTTTACCCTGTGTTCAGCTTGTGTAGTGCAAGGTGTGAATGATATCCATTGAGGCCGAACCTGTATTCCTGTTGCTACTAGGGAAGTGTCCTTGATGCGAGAGCTATACTACGTGGACCATGTATGGGGTTGGGCTGAAAGTGGCCCCCAGGAAGCTGAGTCTGGTCCTGTGGGTTCTGAGTGTCACGTCATGTGTCCTGTCCACTCATGCACAGGTGTATTCTCAGACTGTCAACACACACTACGGAAAACTGCGTGGCATGCGTGTGCCTTTACCAAGCGAAATCCTGGGTCCTGTGGATCAGTACCTGGGAGTTCCCTATGCTGCACCTCCTGTGGGAGAGAAACGTTTCCTCCCACCAGAGCCACCACCCTCCTGGTCCGGAATTAGGAATGCCACCCATTTCTCGCCAGTGTGCCCTCAGAACATACAAAATGCAGTACCAGATATTATGATGCCAGTTTGGTTCACTTCAAACTTGGACACTGTAACAGGGTACTTGCAGGAACAGAGTGAGGATTGCTTGTATCTCAATATCTATGTGCCCACAGAGGATGATATCCGGGACACTGGAGCCAAGCCAGTCATGGTTTATATACATGGAGGATCATACATGGAGGGCAGTGGAAACATGATCGATGGCAGTGTACTGGCCAGCTATGGAAATGTTGTAGTCATCACCTTGAATTATTGTGTGGGAAGTTCTGGGTTTTTCTGAACCTTGGAGATCAAGGCCG
  5   1   2       bld FaB                             IMAGE:8074185.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGCTCTATCTGCACATAGGCTTAAAACCACGAGTGCGTGATCACTACAGGGCCACAAAAGTGGCATTCTGGAAGCATCTAGTACCACACCTGTACAATCTACATGATATGTTTCACTACACCTCTACTACTACCAAGGTTCCACCATCGGACACAACTCAGAACTCTCACATTACACGTCGGCCCAAGGTCTGGGAAACAAAGCGCCCAGGTGTCTCACCAACCTTTAATGGCCCAGTTGCCAAGTGGGACCCAGAACTAGATCCTGTAGACCCTGTGGTAATCCAGGATCCACGGGACTACTCAACAGAGTTAAGTGTTACAATTGCTGTGGGAGCCTCCCTTCTGTTTCTCAATGTCTTGGCCTTTGCTGCTTTGTACTACCGCAATGATAAAAGACGTCAGGACACTCAAAGGCAACCAACCCCACAACGCCCAGCTGTCGCTCGGGATCCAGCACACAGTCCTCTTCCTCCTGAGGAGCTAAACTCTCTGCAGATAAATGCAGGACATCCTGAAAGTGAAGGCGGGGGTGTCTCCAGCCATGATAACCTGCGTCTCCCCACCCTTCCCGATTATACACTTACTTTGCGCAGATCTCCTGATGACATCCCACTCATGACACCTAACACCATCACCATGATCCCCAACTCACTGGTGGGACTGNCAAGCCTTCACCCATACAACACCTTTTCTGCTGGCTTCAACAACACTGGCCTCCCGCACTCACACTCCACCACTAGAGTATAGCGTCCCATTATGCTGCCCTTCCCCTTGNCCCTAACAAGAC
  5   1   2      seed Thy                             IMAGE:8546690.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCCTCCAGCCATCAGATCACCCAGAAACAATATCCGGGACACTGGAGCCAAGCCAGTCATGGTTTATATACATGGAGGATCATACATGGAGGGCAGTGGAAACATGATCGATGGCAGTGTACTGGCCAGCTATGGGAATGTTGTAGTCATCACCTTTAATGGCCCAGTTGCCAAGTGGGACCCAGAACTAGATCCTGTAGACCCTGTGGTAATCCAGGATCCACGGGACTACTCAACAGAGTTAAGTGTTACAATTGCTGTGGGAGCCTCCCTTCTGTTTCTCAATGTCTTGGCCTTTGCTGCTTTGTACTACCGCAATGATAAAAGACGTCAGGACACTCAAAGGCAACCAACCCCACAACGCCCAGCTGTCGCTCGGGATCCAGCACACAGTCCTCTTCCTCCTGAGGAGCTAAACTCTCTGCAGATAAATGCAGGACATCCTGAAAGTGAAGGCGGGGGTGTCTCCAGCCATGATAACCTGCGTCTCCCCACCCTTCCCGATTATACACTTACTTTGCGCAGATCTCCTGATGACATCCCACTCATGACACCTAACACCATCACCATGATCCCCAACTCACTGGTGGGACTGCAAAGCCTTCACCCATACAACACCTTTTCTGCTGGCTTCAACAACACTGGCCTCCCGCACTCACACTCCACCACTAGAGTATAGCGTCCCATTATGCTGCCCTTCCCCTTGCCCTAACAAAGAGCCACCACAAGATGTCTGCAGACAGGGGAGGGATATAAAACATTCCATACCTCCTAAAGAGGGGATAGGTGATGGAAACTTTCTTCTTAAGGAAAAGTGCTGCTCAGTTATAGCTTTCAAGGAACCACATGTCCCTGATTTTTGCTCTAAGGTGGCTTTTACCCTTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)