Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1  1.75    0Xl3.1-XL057m17.3                           20 END     4          80       20                Unknown (protein for IMAGE:6862511) [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012799873 Xl3.1-IMAGE:5515870.5 - 5 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5515870.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGGAAATTTGATTATAGATTTGGATGCTGATTTGGAGAAGGACAGACAGAAATTTGAGATGAGTAATTCAACAAGTAGCAGCTGCACTTCCAAGGACAGTGGCCATGGTTTGGCATCAAGTGGAGCAGTTAACTCTACCTCTTCTTCTTTAGCTGACAGCATCAAATTTGCTTCTGTTCAACAGCAATCATCTGGCCCTCAAGGGAACAGCCACAAAGACACTAGCAAATCAAAAGTGAAAAGGAGTAAAACTTCAAGGGATGTTAATAAGTCTTTGGCTTCTGCATCTTTTTATGGAATTCCTGAGATTGGTGTTGGGGCTGCCAAACGACAGCAAGAGGCTGGACGCCTTGGAGAAGTGGCATCCACAGTTGGCATGAGTGCAACACTGGGCCACAATAGTGGTGGAGCTGGCCTTAATGGAAACACTTCATGTAATAAAACTTTGAAAGATGAAAAAACAGGAGGAGGGAAAAGTCAGAGCACTAGGGGCTCAAAAAGGGATAAGGATTCTGGAAAATCAAGAAAGGACAACAGTAATAAGTTGTATGACCTTGCGCATGCAAACACTGGAGTGAATAGCCAAGCTGTTGTGCATTTGTATGGATTTGGAAGTGGAAAGGCCTCTGGGAATGGCAGTCCTTTTCACTGTGGCAATAGTTTGGCTGGAGAGATGGCAAAGAGTACAGTTGATTCAGGGATTATGGGGAACACAGCACTGGTTAAAAAAGAAGATGATGATGATGATGAAGAAGAAAGCCATAGGCGAAATAAGAAATTAAAAACTGAAAAAGTCGATCCCCTATTTACAGTGCCTGCCCCACCACCACCACCAGTCCATAGCAGCATTTCCCCTCAGATTCAGCCTTCCTACTTTTCTTCATCTTCAACAACTATTGCGGCCCCATTGGAACAGCTGTTGGTGCGAACTCGTTCAGTGGGTGTTAATACCTGTGATGCTGGAGTTGTAACAGAACCTGAATGCCTTGGACCTTGTGAACCTGGAACCAGTGTTAATTTAGAAGGAATTGTCTGGCACGAAACGGAAGAAGGTGTTCTAGTTGTGAATGTTACATGGCGAAATAAGACAT
                                                  Xl3.1-CHK-1012704596                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTTGATTATAGATTTGGATGCTGATTTGGAGAAGGACAGACAGAAATTTGAGATGAGTAATTCAACAAGTAGCAGCTGCACTTCCAAGGACAGTGGCCATGGTTTGGCATCAAGTGGAGCAGTTAACTCTACCTCTTCTTCTTTAGCTGACAGCATCAAATTTGCTTCTGTTCAACAGCAATCATCTGGCCCTCAAGGGAACAGCCACAAAGACACTAGCAAATCAAAAGTGAAAAGGAGTAAAACTTCAAGGGATGTTAATAAGTCTTTGGCTTCTGCATCTTTTTATGGAATTCCTGAGATTGGTGTTGGGGCTGCCAAACGACAGCAAGAGGCTGGACGCCTTGGAGAAGTGGCATCCACAGTTGGCATGAGTGCAACACTGGGCCACAATAGTGGTGGAGCTGGCCTTAATGGAAACACTTCATGTAATAAAACTTTGAAAGATGAAAAAACAGGAGGAGGGAAAAGTCAGAGCACTAGGGGCTCAAAAAGGGATAAGGATTCTGGAAAATCAAGAAAGGACAACAGTAATAAGTTGTATGACCTTGCGCATGCAAACACTGGAGTGAATAGCCAAGCTGTTGTGCATTTGTATGGATTTGGAAGTGGAAAGGCCTCTGGGAATGGCAGTCCTTTTCACTGTGGCAATAGTTTGGCTGGAGAGATGGCAAAGAGTACAGTTGATTCAGGGATTATGGGGAACACAGCACTGGTTAAAAAAGAAGATGATGATGATGATGAAGAAGAAAGCCATAGGCGAAATAAGAAATTAAAAACTGAAAAAGTCGATCCCCTATTTACAGTGCCTGCCCCACCACCACCACCAGTCCATAGCAGCATTTCCCCTCAGATTCAGCCTTCCTACTTTTCTTCATCTTCAACAACTATTGCGGCCCCATTGGAACAGCTGTTGGTGCGAACTCGTTCAGTGGGTGTTAATACCTGTGATGCTGGAGTTGTAACAGAACCTGAATGCCTTGGACCTTGTGAACCTGGAACCAGTGTTAATTTAGAAGGAATTGTCTGGCACGAAACGGAAGAAGGTGTTCTAGTTGTGAATGTTACATGGCGAAATA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     2     2     2     2     2     2
                                                                       ...PROTEIN --- Ag ---- 1e-020     XP_001230952.2 AGAP005030-PA [Anopheles gambiae str. PEST] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Sp ---- 2e-020     XP_001191948.1 PREDICTED: similar to DNA-repair protein complementing XP-A cells homolog (Xeroderma pigmentosum group A-complementing protein homolog) [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 7e-022     NP_995884.1 scribbler CG5580-PC, isoform C [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Xt ==== 3e-030     AAI28996.1 Unknown (protein for IMAGE:7642916) [Xenopus tropicalis] ==============================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Dr ---- 3e-044     NP_001091863.1 hypothetical protein LOC793767 [Danio rerio] --=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Bt ---- 5e-049     XP_870743.2 PREDICTED: similar to zinc finger protein 609 isoform 3 [Bos taurus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Gg ---- 8e-052     XP_413718.2 PREDICTED: similar to zinc finger protein 609 [Gallus gallus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Mm ---- 2e-115     NP_786927.2 zinc finger protein 608 [Mus musculus] --------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Hs ---- 8e-122     NP_065798.2 zinc finger protein 608 [Homo sapiens] --------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Cf ---- 5e-122     XP_859913.1 PREDICTED: similar to zinc finger protein 608 isoform 2 [Canis familiaris] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - ?? ---- 4e-123     XP_879104.2 PREDICTED: similar to Zinc finger protein 608 (Renal carcinoma antigen NY-REN-36) isoform 4 [Bos taurus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Xl ---- 0          AAI10971.1 Unknown (protein for IMAGE:6862511) [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:5515870.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ...
  5   1   1       add Emb4 5g                         IMAGE:5515870.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGGACTTTGAACCGGTCGGTCTTAATAACTAAAAAGACAAAACAGGCGTAAGAAAGGAGGTGTAATTAAAATAAAGAAAGATTATTGAACATTTATTGGGGTAAACATCTCTGAAGACAAAGACAATCCTTGTTTATTTTTGGAATACTTTGAGTCAATCATTTGGATTTCTTAGATTTAATTACAttttttttGAAGAAAATATAAATATTACATTGGAGATAAACGAATGTCCCCATTTTCTAAAAAGCATTTTCCTTGGAATTTAATGCCAAACGTTTCATCTTCAGGATGTCAATAAGTATTTCTGCTGCAGCGAAAAGTGTAGATACTAACGCAGTTGATGCCTACGACAGTGGTGATGACTGGGAAATCGGTGTGGGAAATTTGATTATAGATTTGGATGCTGATTTGGAGAAGGACAGACAGAAATTTGAGATGAGTAATTCAACAAGTAGCAGCTGCACTTCCAAGGACAGTGGCCATGGTTTGGCATCAAGTGGAGCAGTTAACTCTACCTCTTCTTCTTTAGCTGACAGCATCAAATTTGCTTCTGTTCAACAGCAATCATCTGGCCCTCAAGGGAACGGCCACAAAGACACTAGCAGATCAAAAGTGAAAAGGAGTAAAACTTCCAAGGATGTTAATAAGGCTTTGGCTTCTGCATCTTTATATGGAATTCCTGAGATTGCTGGTGGAGCTGCCAAACGACAGCAAGAGGCTGGACGCCT
  5   1   2       bld Tbd7      out                        XL057m17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGGAAATTTGATTATAGATTTGGATGCTGATTTGGAGAAGGACAGACAGAAATTTGAGATGAGTAATTCAACAAGTAGCAGCTGCACTTCCAAGGACAGTGGCCATGGCTTGGCATCAAGTGGAGCAGTTAACTCTACCTCCTCTTCATTAGCTGACAGCCTCAAATTTGCTTCTGTTCAACAGCAATCATCTGGCCCTCAAGGGAACAGCCACAAAGACACTAGCAAATCAAAAGTGAAAAGGAGTAAAACTTCAAGGGATGTTAATAAGTCTTTGGCTTCTGCATCTTTTTATGGAATTCCTGAGATTGGTGTTGGGGCTGCCAAACGACAGCAAGAGGCTGGACGCCTTGGAGAAGTGGCATCCACAGTTGGCATGAGNGCAACACTGGGCCACAATAGTGGTGGAGCTGGCCTTAATGGAAA
  5   1   2      seed DMZ       out                        xl311h01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGCCTCAAATTTGCTTCTGTTCAACAGCAATCATCTGGCCCTCAAGGGAACAGCCACAAAGACACTAGCAAATCAAAAGTGAAAAGGAGTAAAACTTCAAGGGATGTTAATAAGTCTTTGGCTTCTGCATCTTTTTATGGAATTCCTGAGATTGGTGTTGGGGCTGCCAAACGACAGCAAGAGGCTGGACGCCTTGGAGAAGTGGCATCCACAGTTGGCATGAGTGCAACACTGGGCCACAATAGTGGTGGAGCTGGCCTTAATGGAAACACTTCATGTAATAAAACTTTGAAAGATGAAAAAACAGGAGGAGGGAAAAGTCAGAGCACTAGGGGCTCAAAAAGGGATAAGGATTCTGGAAAATCAAGAAAGGACAACAGTAATAAGTTGTATGACCTTGCGCATGCAAACACTGGAGTGAATAGCCAAGCTGTTGTGCATTTGTATGGATTTGGAAGTGGAAAGGCCTCTGGGAATGGCAGTCCTTTTCACTGTGGCAATAGTTTGGCTGGAGAGATGGCAAAGAGTACAGTTGATTCAGGGATTATGGGGAACACAGCACTGGTTaaaaaagaagatgatgatgatgatgaAGAAGAAAGCCATAGGCGAAATAAGAAATTAAAAACTGAAAAAGTCGATCCCCTATTTACAGTGCCTGCCCCACCACCACCACCAGTCCATAGCAGCATTTC
  5   1   2      skin Ga12      out                        XL174i20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTACAGTTGATTCAGGGNATTATGGGGAACACAGCACTGGTTaaaaaagaagatgatgatgatgatgaagaagaaagCCATAGGCGAAATAAGAAATTAAAAACTGAAAAAGTCGATCCCCTATTTACAGTGCCTGCCCCACCACCACCACCAGTCCATAGCAGCATTTCCCCTCAGATTCAGCCTTCCTACTTTTCTTCATCTTCAACAACTATTGCGGCCCCATTGGAACAGCTGTTGGTGCGAACTCGTTCAGTGGGTGTTAATACCTGTGATGCTGGAGTTGTAACAGAACCTGAATGCCTTGGACCTTGTGAACCTGGAACCAGTGTTAATTTAGAAGGAATTGTCTGGCACGAAACGGAAGAAGGTGTTCTAGTTGTGAATGTTACATGGCGAAATAAGACATATGTGGGGACTTTGTTGGACTGTACAAAGCATGACTGGGCTCCTCCAAGATTTTGTGATTCGCCAACAAGTGACTTTGAAATGCGTGGAGGTCGTGGCCGAGGGAAGCGAGCAAGATCAGCAGCAAATACCACAGCAGCTGCAGCACCAGGCAGTGATGCAAATTTTACAGAAACAAGA
  5   1   1       add Neu1      out                    Neu1-23C11-2.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATGAAGAAGAGGAAGAAAGCCATAGGCGAAATAAGAGATTAAAAACTGAAAAAGTTGATCCGCTGTTTACTGTGCCTGCCCCACCACCACCACCAGTTCACAGCAGCATTTCCCCTCAGATTCAGCCTTCCTACTGTTCTCCATCCTCAATAACTATTGCAGCCCCAGTGGAACAGCTATTGGTGCGAACGCGTTCAGTGGGTGTAAATACCTGTGATGTTGGAATTGTAACAGAACCTGAATGCCTTGGACCTTGTGAACCTGGAACCAGTGTTAATTTAGAAGGAATTGTCTGGCACGAAACCGGAAGAAGTGTCCTAGTTGTGAATGTTACATGGCGAAATAAGACATATG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)