Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012800084 Xl3.1-IMAGE:8074105.5 - 3 ESTs
                                                                       .........-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8074105.5                                                                                                                                                                                                                                                                                                                                                                                                                                              TTAATTCCTCCTCCTTTCGAGCAAACCATCCCCAGCCTGAATCCTGGCTCCGACACCCTTACCCGGCCCAAAAGCCAAAAAGCAGCAGAGAATGGCCTGCTCCAGCAAGCCCCGCTCCAACCTGCAGAATTCCCCTGGATGAAAGAGAAGAAATCGGCCAAGAAGAGCAGCCAAGGGTCGCCCCAGGCCCTGATTCCACCGACTGAGTCAGCAGGGGGGTCGCCGGCAGAACCCCCTGGGCTGCACGATAGCACCGGCGGCGGCTGCAGAAGGCTGAGGACCGCTTACACCAACACTCAGCTGCTCGAGCTGGAGAAAGAATTCCACTTTAATAAGTATCTGTGCCGACCCAGGAGGGTGGAGATAGCGGCTCTGTTGGATCTCACAGAGAGACAGGTCAAGGTTTGGTTCCAGAACCGAAGGATGAAGCACAAGAGACAAACCCAGCACAAAGATGGGGAGCACACTTACTCGAACCCCGAAGATGGGGAACCTCTGGAGGATGGAGACGACAGTCCAATTTATCACCAGGGATTGGACAGCAATGACTCTTTAAGGGAACAAGATCAGTACCCCTGTTCTGAGATCCCCAAAAATCCCAACCCAGGCTTGAGCCAGCAGCTGCCTTCAAGCAAGGAGTTAACCCCCAGCAGCCCCTTGTACCCAACGCCTACTCCTGATGCTGAGGGCAGAATAGAGGTGGGTAGCATGGACAATGTACTCTCACAATCCCACGACAACTCCTTATTGTCAGACCTTACTTTATTCTCAACAGACTCCTGCCTACACATTTCAGATGCGATCACAAGCTTGCACGGCACTCTCAATAGCCCTGTCCACTTCTCCGAGGAAGATATNGACTTTCTTACCAGCACACTTTGTAGCAAAGATCTGCACAACTTAGATTTTTAACGAATATGAATATCTTTTGGGTCTAATCTAATGCGTGAAAGTGTCCTCTATATTTATTTTCAAATATCCGACACGCATCGCAAGTCATATATCAGTATTTATGTATTTGAACCGCGTAAAAATTAGCTATTTTCATTTGCTTGCTAATTAGAAGGCATCTCTGGATTAGACACATGGATCAATTGTTATTTATTTAAGTGAAGTCTCAGGAATTCCAAGGTACGTTTGGATTTGNTACACAGGAAGATTTCGTTTCTTGTTATTTATGTAAAGCCTTTATTAGCCATTTGATANTTATTT------------TTTCCTAGTTTCTATAAATGTCNTTATAATAAAGTG
                                                  Xl3.1-CHK-1012710622                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCTCCTCCTTTCGAGCAAACCATCCCCAGCCTGAATCCTGGCTCCGACACCCTTACCCGGCCCAAAAGCCAAAAAGCAGCAGAGAATGGCCTGCTCCAGCAAGCCCCGCTCCAACCTGCAGAATTCCCCTGGATGAAAGAGAAGAAATCGGCCAAGAAGAGCAGCCAAGGGTCGCCCCAGGCCCTGATTCCACCGACTGAGTCAGCAGGGGGGTCGCCGGCAGAACCCCCTGGGCTGCACGATAGCACCGGCGGCGGCTGCAGAAGGCTGAGGACCGCTTACACCAACACTCAGCTGCTCGAGCTGGAGAAAGAATTCCACTTTAATAAGTATCTGTGCCGACCCAGGAGGGTGGAGATAGCGGCTCTGTTGGATCTCACAGAGAGACAGGTCAAGGTTTGGTTCCAGAACCGAAGGATGAAGCACAAGAGACAAACCCAGCACAAAGATGGGGAGCACACTTACTCGAACCCCGAAGATGGGGAACCTCTGGAGGATGGAGACGACAGTCCAATTTATCACCAGGGATTGGACAGCAATGACTCTTTAAGGGAACAAGATCAGTACCCCTGTTCTGAGATCCCCAAAAATCCCAACCCAGGCTTGAGCCAGCAGCTGCCTTCAAGCAAGGAGTTAACCCCCAGCAGCCCCTTGTACCCAACGCCTACTCCTGATGCTGAGGGCAGAATAGAGGTGGGTAGCATGGACAATGTACTCTCACAATCCCACGACAACTCCTTATTGTCAGACCTTACTTTATTCTCAACAGACTCCTGCCTACACATTTCAGATGCGATCACAAGCTTGCACGGCACTCTCAATAGCCCTGTCCACTTCTCCGAGGAAGATATNGACTTTCTTACCAGCACACTTTGTAGCAAAGATCTGCACAACTTAGATTTTTAACGAATATGAATATCTTTTGGGTCTAATCTAATGCGTGAAAGTGTCCTCTATATTTATTTTCAAATATCCGACACGCATCGCAAGTCATATATCAGTATTTATGTATTTGAACCGCGTAAAAATTAGCTATTTTCATTTGCTTGCTAATTAGAAGGCATCTCTGGATTAGACACATGGATCAATTGTTATTTATTTAAGTGAAGTCTCAGGAATTCCAAGGTACGTTTGGATTTGNTACACAGGAAGATTTCGTTTCTTGTTATTTATGTAAAGCCTTTATTAGCCATTTGATAN------------CGTTATTTTCCTAGTTTCTATAAATGTCNTTATAATAAAGTGTATGNT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                   1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     0     1     1     1     1     1     1     1
                                                                                                                                                                                                                                                                                      PROTEIN --- Ce ---- 1e-020     NP_001021164.1 abnormal cell LINeage family member (lin-39) [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================
                                                                       PROTEIN --- Sp ---- 3e-021     NP_999815.2 homeobox protein Splox [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Ci ==== 6e-029     BAE06499.1 transcription factor protein [Ciona intestinalis] ===================================================================================================================================================================
                                                                                                                                                                                                                                                                                            PROTEIN --- Xt ---- 1e-029     AAI35407.1 Homeo box B3 [Xenopus tropicalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                             PROTEIN --- Ag ---- 4e-035     XP_001688961.1 AGAP004648-PA [Anopheles gambiae str. PEST] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                         PROTEIN --- Dm ---- 1e-038     NP_996162.1 CG31481-PC, isoform C [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Gg ---- 1e-063     NP_990481.1 Hoxa2 protein [Gallus gallus] -----------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Dr ---- 5e-067     NP_571191.1 homeo box B2a; homeobox gene B-2 [Danio rerio] ------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Mm ---- 6e-068     NP_598793.2 homeo box B2 [Mus musculus] ----------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Hs ---- 4e-072     NP_002136.1 homeo box B2; homeo box 2H; homeobox protein Hox-B2; K8 home protein [Homosapiens] ---------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Bt ---- 1e-072     XP_887295.1 PREDICTED: hypothetical protein isoform 5 [Bos taurus] -------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Cf ---- 1e-073     XP_851108.1 PREDICTED: similar to Homeobox protein Hox-B2 (Hox-2H) (Hox-2.8) (K8) [Canis familiaris] ---========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - ?? ---- 5e-074     XP_001789503.1 PREDICTED: similar to Homeobox protein Hox-B2 (Hox-2H) (Hox-2.8) (K8) [Bos taurus] ------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xl ==== 6e-094     AAZ52558.1 transcription factor Hoxb2 [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:8074105.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------TGA---------------------ATG------------------------------------------------------------------------------------------TAG------------------TAA---------------------------------------------------TGA---------------------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ...
  5   1   1       add Emb9                            IMAGE:7977178.5p                                                                                                                                                                                                                                                                                                                                                                                                                                              TTAATTCCTCCTCCTTTCGAGCAAACCATCCCCAGCCTGAATCCTGGCTCCGACACCCTTACCCGGCCCAAAAGCCAAAAAGCAGCAGAGAATGGCCTGCTCCAGCAAGCCCCGCTCCAACCTGCAGAATTCCCCTGGATGAAAGAGAAGAAATCGGCCAAGAAGAGCAGCCAAGGGTCGCCCCAGGCCCTGATTCCACCGACTGAGTCAGCAGGGGGGTCGCCGGCAGAACCCCCTGGGCTGCACGATAGCACCGGCGGCGGCTGCAGAAGGCTGAGGACCGCTTACACCAACACTCAGCTGCTCGAGCTGGAGAAAGAATTCCACTTTAATAAGTATCTGTGCCGACCCAGGAGGGTGGAGATAGCGGCTCTGTTGGATCTCACAGAGAGACAGGTCAAGGTTTGGTTCCAGAACCGAAGGATGAAGCACAAGAGACAAACCCAGCACAGGATGGGGAGCACACTTACTCGAACCCCTAAGATGGGGAACCTCTGGAGGATGGAGACGACAGTCCAATTTATCACCAGGGGATTGGACAGCAATGATTCTTTTAAGGGAACAAGATCAGTACCTCTGTTCTGAGATCCCCAAAAATTCCCAACCCAGGCTTGAGCCAGCAGCTGCCTTCAAACAAAAGAATAAAACCCCCAGCAGCCCCTTTGTACCCAACGCCTACTCCTGATGTTGTTTGTCTTATTATATGTTGGGTAGCATGGACAATG
  5   1   2      seed FaB                             IMAGE:8074105.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGCCCAAAGCCAAAAGCAGCAGAGAATGGCCTGCTCCAGCAAGCCCCGCTCCAACCTGCAGAATTCCCCTGGATGAAAGAGAAGAAATCGGCCAAGAAGAGCAGCCAAGGGTCGCCCCAGGCCCTGATTCCACCGACTGAGTCAGCAGGGGGGTCGCCGGCAGAACCCCCTGGGCTGCACGATAGCACCGGCGGCGGCTGCAGAAGGCTGAGGACCGCTTACACCAACACTCAGCTGCTCGAGCTGGAGAAAGAATTCCACTTTAATAAGTATCTGTGCCGACCCAGGAGGGTGGAGATAGCGGCTCTGTTGGATCTCACAGAGAGACAGGTCAAGGTTTGGTTCCAGAACCGAAGGATGAAGCACAAGAGACAAACCCAGCACAAAGATGGGGAGCACACTTACTCGAACCCCGAAGATGGGGAACCTCTGGAGGATGGAGACGACAGTCCAATTTATCACCAGGGATTGGACAGCAATGACTCTTTAAGGGAACAAGATCAGTACCCCTGTTCTGAGATCCCCAAAAATCCCAACCCAGGCTTGAGCCAGCAGCTGCCTTCAAGCAAGGAGTTAACCCCCAGCAGCCCCTTGTACCCAACGCCTACTCCTGATGCTGAGGGCAGAATAGAGGTGGGTAGCATGGACAATGTACTCTCACAATCCCACGACAACTCCTTATTGTCAGACCTTACTTTATTCTCAACAGACTCCTGCCTACACATTTCAGATGCGNATCACAGC
  3   1   2       bld Ga15                               XL411c15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTGGACAGCAATGACTCTTTAAGGGAACAAGATCAGTNCCCCTGTTCTGAGATCCCCAAAAATCCCAACCCAGGCTTGAGCCAGCAGCTGCCTTCAAGCAAGGAGTTAACCCCCAGCAGCCCCTTGTACCCAACGCCTACTCCTGATGCTGAGGGCAGAATAGAGGTGGGTAGCATGGACAATGTACTCTCACAATCCCACGACAACTCCTTATTGTCAGACCTTACTTTATTCTCAACAGACTCCTGCCTACACATTTCAGATGCGATCACAAGCTTGCACGGCACTCTCAATAGCCCTGTCCACTTCTCCGAGGAAGATATNGACTTTCTTACCAGCACACTTTGTAGCAAAGATCTGCACAACTTAGATTTTTAACGAATATGAATATCTTTTGGGTCTAATCTAATGCGTGAAAGTGTCCTCTATATTTATTTTCAAATATCCGACACGCATCGCAAGTCATATATCAGTATTTATGTATTTGAACCGCGTAAAAATTAGCTATTTTCATTTGCTTGCTAATTAGAAGGCATCTCTGGATTAGACACATGGATCAATTGTTATTTATTTAAGTGAAGTCTCAGGAATTCCAAGGTACGTTTGGATTTGNTACACAGGAAGATTTCGTTTCTTGTTATTTATGTAAAGCCTTTATTAGCCATTTGATANTTATTTATNGTNCGTTATTTTCCTAGTTTCTATAAATGTCNTTATAATAAAGTGTATGNTGAGAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)