Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 92%

 1012802062 Xl3.1-IMAGE:3438466-IMAGp.5 - 2 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:3438466-IMAGp.5 GATTCCCGGGCAGGAGGATTGACTGCTCCGCGGATCGTCTCTAAATGAGCACAGCAAAGTTAAAAGCAAGATCTAGAGGACCTTAGACCAGCCATCATGAAGTTGTATGTTTTCCTGGTGAACACTGGAACAACCCTGACTTTTGACACAGAGCTTGCAGTGCAGACCGTGACAGATCTTAAGCATGCGATCCAAACAAAGTACAAAATTGCAGTTCATCTTCAGATACTTGTTGTTAATGGAGGGGAGTGTATGGCACCTGATAGAAGGGTCTGTAGCTACAGCGCTGGTACAGACACAAATCCAATTTTTCTGTTCAATAAGGAAATGATACTCTGCGAACGCCCACCAGCGATTCCCAGGACAACATTTTCAGCAGAGAATGAAATGGCGTTAAAAGTTGAAGAATCACTTATGATGCCTGCAGTCTTTCACACAGTCGCCTCTAGAACACAACTTGCAGTGGAAATGTATGAAGTCGCCAAAAAGCTCTGCTCTTTTTGTGAAGGTCTGGTCCATGATGAACATCTACAGCATCAAGGATGGGCAGCCATTATGGCAAACTTAGAAGACTGTACACATTCGTACCAAAAGCTGCTTTTTAAATTTGAGAATGCATATACGAAGTATCTTCAGTCTATAGACGACATTAAACTAAAATTAACAAATTTAGGAACAGCTGTTTCTGTCATGGCCAAGATCCCGCTACTTGAGTGCCTAACAAGACATAGCTATAGGATGTGCTTAGATAGACTAATATCATCTGCTGACATTGATACTGAAGAAATGGAGAATGCAAAAGTAGAAGAAATGGTGCAATATGATGAAAAAAATTTGGCGTTCCTAGCCTCGATTTCCAAGTCTGTGGAACAGCAGCTACAGGACGTAGCAGGAAAGGACATTGGGCAAGAGAACAATGAGTCTTCTACACAAAACAAGGAACTCTCAGAAGCAAATTATTCTGGAAATCTCCCTTCCTTTAACGTTTCATTATTAGACTGGATAAATGTCCAAGATCGGCCAAATGATGTT
                                                  Xl3.1-CHK-1012715505       CGGGCAGGAGGATTGACTGCTCCGCGGATCGTCTCTAAATGAGCACAGCAAAGTTAAAAGCAAGATCTAGAGGACCTTAGACCAGCCATCATGAAGTTGTATGTTTTCCTGGTGAACACTGGAACAACCCTGACTTTTGACACAGAGCTTGCAGTGCAGACCGTGACAGATCTTAAGCATGCGATCCAAACAAAGTACAAAATTGCAGTTCATCTTCAGATACTTGTTGTTAATGGAGGGGAGTGTATGGCACCTGATAGAAGGGTCTGTAGCTACAGCGCTGGTACAGACACAAATCCAATTTTTCTGTTCAATAAGGAAATGATACTCTGCGAACGCCCACCAGCGATTCCCAGGACAACATTTTCAGCAGAGAATGAAATGGCGTTAAAAGTTGAAGAATCACTTATGATGCCTGCAGTCTTTCACACAGTCGCCTCTAGAACACAACTTGCAGTGGAAATGTATGAAGTCGCCAAAAAGCTCTGCTCTTTTTGTGAAGGTCTGGTCCATGATGAACATCTACAGCATCAAGGATGGGCAGCCATTATGGCAAACTTAGAAGACTGTACACATTCGTACCAAAAGCTGCTTTTTAAATTTGAGAATGCATATACGAAGTATCTTCAGTCTATAGACGACATTAAACTAAAATTAACAAATTTAGGAACAGCTGTTTCTGTCATGGCCAAGATCCCGCTACTTGAGTGCCTAACAAGACATAGCTATAGGATGTGCTTAGATAGACTAATATCATCTGCTGACATTGATACTGAAGAAATGGAGAATGCAAAAGTAGAAGAAATGGTGCAATATGATGAAAAAAATTTGGCGTTCCTAGCCTCGATTTCCAAGTCTGTGGAACAGCAGCTACAGGACGTAGCAGGAAAGGACATTGGGCAAGAGAACAATGAGTCTTCTACACAAAACAAGGAACTCTCAGAAGCAAATTATTCTGGAAATCTCCCTTCCTTTAACGTTTCATTATTAGACTGGATAAATGTCCAAGATCGGCCAAAT
                                                      consensus depths      1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG      96     250 
                                               BLH MIN      96     121 
                                               BLH MPR      96     121 
                                               BLH OVR      96     200 
                                               CDS MIN      96     121 
                                               ORF LNG      96      13 
                                                                                                                                                                          PROTEIN === Ag ==== 4e-032     XP_319618.4 AGAP008873-PA [Anopheles gambiae str. PEST] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                       PROTEIN === Dm ==== 5e-035     NP_996156.1 CG1347-PB, isoform B [Drosophila melanogaster] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                       PROTEIN === Bt ==== 1e-122     NP_001107627.1 RB1-inducible coiled-coil 1 [Bos taurus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                       PREDICTED = ?? ==== 1e-122     XP_001788379.1 PREDICTED: RB1-inducible coiled-coil 1 [Bos taurus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                       PROTEIN === Mm ==== 1e-124     NP_033956.1 RB1-inducible coiled-coil 1 [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                       PROTEIN === Hs ==== 9e-128     NP_001077086.1 Rb1-inducible coiled coil protein 1 isoform 2 [Homo sapiens] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                       PREDICTED = Cf ==== 8e-128     XP_856808.1 PREDICTED: similar to Rb1-inducible coiled coil protein 1 isoform 4 [Canis familiaris] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                       PREDICTED = Gg ==== 3e-134     XP_001232350.1 PREDICTED: Rb1-inducible coiled coil protein 1 [Gallus gallus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                       PROTEIN === Xt ==== 1e-159     AAI54070.1 Unknown (protein for IMAGE:7654585) [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                       PROTEIN === Xl ==== 5e-178     AAH90242.1 Unknown (protein for IMAGE:6871480) [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                           Xl3.1-IMAGE:3438466-IMAGp.5                                              TGA------------TAA---------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG---------------------------------------------------------ATG------------------------ATGATG------------------------------------------------ATG------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG---------------------------------------------ATG---------------------ATG
                                                                   ORF                                                                                                 ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ...
  5   1   2      seed Egg3 5g                         IMAGE:6871480.5p GATTCCCGGGCAGGAGGATTGACTGCTCCGCGGATCGTCTCTAAATGAGCACAGCAAAGTTAAAAGCAAGATCTAGAGGACCTTAGACCAGCCATCATGAAGTTGTATGTTTTCCTGGTGAACACTGGAACAACCCTGACTTTTGACACAGAGCTTGCAGTGCAGACCGTGACAGATCTTAAGCATGCGATCCAAACAAAGTACAAAATTGCAGTTCATCTTCAGATACTTGTTGTTAATGGAGGGGAGTGTATGGCACCTGATAGAAGGGTCTGTAGCTACAGCGCTGGTACAGACACAAATCCAATTTTTCTGTTCAATAAGGAAATGATACTCTGCGAACGCCCACCAGCGATTCCCAGGACAACATTTTCAGCAGAGAATGAAATGGCGTTAAAAGTTGAAGAATCACTTATGATGCCTGCAGTCTTTCACACAGTCGCCTCTAGAACACAACTTGCAGTGGAAATGTATGAAGTCGCCAAAAAGCTCTGCTCTTTTTGTGAAGGTCTGGTCCATGATGAACATCTACAGCATCAAGGATGGGCAGCCATTATGGCAAACTTAGAAGACTGTACACATTCGTACCAAAAGCTGCTTTTTAAATTTGAGAATGCATATACGAAGTATCTTCAGTCTATAGACGACATTAAACTAAAATTAACAAATTTAGGAACAGCTGTTTCTGTCATGGCCAAGATCCCGCTACTTGAGTGCCTAACAAGACATAGCTATAGGATGTGCTTAGATAGACTAATATCATCTGCTGACATTGATACTGAAGAAATGGAGAATGCAAAAGTAGAAGAAATGGTGCAATATGATGAAAAAAATTTGGCGTTCCTAGCCTCGATTTCCAAGTCTGTGGAACAGCAGCTACAGGGACGTAAT
  5   1   2       bld Gas6                   IMAGE:3438466-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAATTCCCCCGGGGAAGACTGTACACATTCGTACCAAAAGGCTGCTTTTTAAATTTGAGAATGCATATACGAAGTATCTTCAGTCTATAGACGACATTAAACTAAAATTAACAAATTTAGGAACAGCTGTTTCTGTCATGGCCAAGATCCCGCTACTTGAGTGCCTAACAAGACATAGCTATAGGATGTGCTTAGATAGACTAATATCATCTGCTGACATTGATACTGAAGAAATGGAGAATGCAAAAGTAGAAGAAATGGTGCAATATGATGAAAAAAATTTGGCGTTCCTAGCCTCGATTTCCAAGTCTGTGGAACAGCAGCTACAGGACGTAGCAGGAAAGGACATTGGGCAAGAGAACAATGAGTCTTCTACACAAAACAAGGAACTCTCAGAAGCAAATTATTCTGGAAATCTCCCTTCCTTTAACGTTTCATTATTAGACTGGATAAATGTCCAAGATCGGCCAAATGATGTTGAGTC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)