Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 87%

 1012837257 Xl3.1-XL511a08ex.5.5 - 98 ESTs
                                                                       ..-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xl3.1-XL511a08ex.5.5                                                                                                                                                                                                                                                                                                                                                                                                                   GATGAAGCAGGGCCATGGCATGCATCACAGACGAGCTTTTCATTCGTACACTCTGGTCGCTGCCGTTTAACAGCCATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTAGGTGCAGATGCTGTAGGTATGAGCACAGTACATGAGGTGGTTGTTGCAAGACACTGCGGCCTGCGCATCCTGGGAATATCACTAATTACCAACAAAGCTGTTATGGACTATGACAGTAATTTCACTGCCAACCACGAGGAAGTGCTTCAAGCTGGCAAAGATAGTGCCAAATATATGGAGAAGCTTGTAAGCACTTTCCTGCAGCGCTTGGACCTAAATAAAGTGTGATAGCACAGGGAACAAGTTTAGGGCAAAAAGATAAATCTACTGTTATTTTAATTATTCTATTCTTCTTATATGTCAAACCTGCCAGCCTTTAGCTGTTTTTATACTGTATTTTTTTTTTGGGTTATGCTCAGAAATGTGTTTGTAGAACAGCTGCGGGTTGGCAGGATCTAACAATAACAGGCCAATGCTTCTCTACTGTAGCAACATTTCTATCTATACCTCTTTTTTAATACAGCTACCTATCAGAATGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCTGAAATGTAATAGAACAATAGAACCCAGCAGCATGGGTGAAAAGCTAATGAAAAGAATGGGCTGAAGGAACATGACCTCTTATTTTATTTTACTTTATTAAACATTTATTAC
                                                  Xl3.1-CHK-1012722162                                                                                                                                                                                                                                                                                                                                                                                                                         GCAGGGCCATGGCATxxxTCACAGACGAGCTTTTCATTCGTACACTCTGGTCGCTGCCGTTTAACAGCCATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTAGGTGCAGATGCTGTAGGTATGAGCACAGTACATGAGGTGGTTGTTGCCAGACACTGCGGCCTGCGCATCCTGGGAATATCACTAATTACCAACAAAGCTGTTATGGACTATGACAGTAATTTCACTGCCAACCACGAGGAAGTGCTTCAAGCTGGCAAAGATAGTGCCAAATATATGGAGAAGCTTGTAAGCACTTTCCTGCAGCGCTTGGACCTAAATAAAGTGTGATAGCACAGGGAACAAGTTTAGGGCAAAAAGATAAATCTACTGTTATTTTAATTATTCTATTCTTCTTATATGTCAAACCTGCCAGCCTTTAGCTGTTTTTATACTGTATTTTTTTTTTGGGTTATGCTCAGAAATGTGTTTGTAGAACAGCTGCGGGTTGGCAGGATCTAACAATAACAGGCCAATGCTTCTCTACTGTAGCAACATTTCTATCTATACCTCTTTTTTAATACAGCTACCTATCAGAATGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCTGAAATGTAATAGAACAATAGAACCCAGCAGCATGGGTGAAAAGCTAATGAAAAGAATGGGCTGAAGGAACATxxxCTCTTATTTTATTTTACTTTATTAAACATTTATTACTTGACA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                        3     8     3     9     4    11    12    19    20    26    26    36    34    43    40    47    45    50    47    50    47    50    48    52    48    52    48    52    48    53    48    53    47    53    46    53    47    53    47    53    49    54    48    54    51    54    49    54    51    54    51    54    51    54    50    54    51    54    50    54    51    55    51    56    51    57    54    58    53    58    55    58    52    58    53    57    52    57    50    58    52    58    48    58    47    57    46    56    46    56    48    56    49    56    48    56    47    56    46    56    49    56    49    56    49    56    44    52    39    53    39    54    37    54    34    56    33    54    26    51    25    49    24    45    20    41    13    40    19    38    19    36    17    34    18    32    20    30    19    33    15    30    14    29    23    32    22    33    20    33    22    30    24    31    23    31    20    33    21    32    23    32    19    32    20    32    23    32    22    34    24    35    21    35    20    35    29    35    32    37    31    37    34    37    34    37    33    37    33    38    32    38    30    37    32    37    32    37    34    37    34    37    37    39    37    39    37    39    36    38    37    38    36    38    37    38    37    38    36    38    37    38    37    38    36    38    37    37    37    37    37    37    37    37    37    37    36    36    36    36    34    36    34    36    34    36    35    36    31    34    26    34    25    34    13    22     4     8     4     6     4     5
  5   1   2       e50                                 Xl3.1-xl301e19.5 GAAAAAATACACTTGCTGGTCCGGAATTCAATTTTATATTGTAGAGTGAATTATTTGCAGTGTAAACAGTGTAATTTAGAAATAAAAACTATACCATAAAAATCATGACAGAATCCCTTTAATATTGCATATGTGTTTTTTCCTTTGTTTCCTTTTGTAATTGTATTTGTTTGACATAAGTAGCAAGGCAGAAAGTAGCAGTTGCTATGGCAAGTAGCAGTTATATTTACTGTATAGGAGCTTTGTGCATATACACTTAGCTATGTACTGCAGCTAGCATCATTATTTTTGTATAGTAACTTAAAAATAAGCAAACATGTCTAAACCCAATGTGCCAATCATATGGTAGTTAAATATATAAACCATCATTAACCTACTCCTGTTTTGTGCCAACTGTTGCACGATGAAGCAGGGCCATGGCATGCATTAAGTACAATACTTTGCATCTTGTGCCAGATTCAACTTGTAGTGCAAAGTGAGGGCTGCACAAATCCATAAAGCACAATTGCTCAGTTGATGAATTCAAAGGGGCACAATGTTATGCACTTTAGAGGTCTTTCACTTGCTCCTGTGGGATTAATACATTTAAAATTAAAAATTACAGAAATCTTGCTTCTGGAAGATGCTTAACTCATTGCATTTTAAACACAGTTTTATCCAATCAGTGATATTGTGCTTTTGTTACCTGTGCAAAACGTTTGCCAAAACAGATGGAGGTAGGAACTGCAATTGGTAGACTATTAAAACATTTAAAGTGCAATAACTTGTAATAAAACATGTCCCAGAAACTGAGAATCATCTTTATATTTTTCTATGGTTTAAAAAAAGAAGTTTTTAAATTTGTAATTCAAAAATAAGAATTCTAGTGTAATAGAGAAATATGTGTACATAACATTACAGAGATCAAGTTATTGTACATGTTACTATCTCAATTTTTTCAATAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGA
  5   1   2       e50                               Xl3.1-XL511a08ex.5                                                                                                                                                                                                                                                                                                                                                                                                                     GCATCAAAACGCAGTGCATTTGTCACAGACGAGCTTTTCATTCGTACACTCTGGTCGCTGCCGTTTAACAGCCATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTAGGTGCAGATGCTGTAGGTATGAGCACAGTACATGAGGTGGTTGTTGCAAGACACTGCGGCCTGCGCATCCTGGGAATATCACTAATTACCAACAAAGCTGTTATGGACTATGACAGTAATTTCACTGCCAACCACGAGGAAGTGCTTCAAGCTGGCAAAGATAGTGCCAAATATATGGAGAAGCTTGTAAGCACTTTCCTGCAGCGCTTGGACCTAAATAAAGTGTGATAGCACAGGGAACAAGTTTAGGGCAAAAAGATAAATCTACTGTTATTTTAATTATTCTATTCTTCTTATATGTCAAACCTGCCAGCCTTTAGCTGTTTTTATACTGTATTTTTTTTTTGGGTTATGCTCAGAAATGTGTTTGTAGAACAGCTGCGGGTTGGCAGGATCTAACAATAACAGGCCAATGCTTCTCTACTGTAGCAACATTTCTATCTATACCTCTTTTTTAATACAGCTACCTATCAGAATGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCTGAAATGTAATAGAACAATAGAACCCAGCAGCATGGGTGAAAAGCTAATGAAAAGAATGGGCTGAAGGAACATGACTCCTTATTTTATTTTACTTTATTAAACATTTATTACTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                           TTAAGTACAATACTTTGCATCTTGTGCCAGATTCAACTTGTAGTGCAAAGTGAGGGCTGCACAAATCCATAAAGCACAATTGCTCAGTTGATGAATTCAAAGGGGCACAATGTTATGCACTTTAGAGGTCTTTCACTTGCTCCTGTGGGATTAATACATTTAAAATTAAAAATTACAGAAATCTTGCTTCTGGAAGATGCTTAACTCATTGCATTTTAAACACAGTTTTATCCAATCAGT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---------GA-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---------T-A
                                               BLH ATG      75     197                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               BLH MIN      63     127                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               BLH OVR      75      71                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               EST CLI      40      38                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               ORF LNG      75       5                                                                                                                                                                                                                                                                                                                                                                                                                   
  5   1   2       e50                                 Xl3.1-xl301e19.5 GAAAAAATACACTTGCTGGTCCGGAATTCAATTTTATATTGTAGAGTGAATTATTTGCAGTGTAAACAGTGTAATTTAGAAATAAAAACTATACCATAAAAATCATGACAGAATCCCTTTAATATTGCATATGTGTTTTTTCCTTTGTTTCCTTTTGTAATTGTATTTGTTTGACATAAGTAGCAAGGCAGAAAGTAGCAGTTGCTATGGCAAGTAGCAGTTATATTTACTGTATAGGAGCTTTGTGCATATACACTTAGCTATGTACTGCAGCTAGCATCATTATTTTTGTATAGTAACTTAAAAATAAGCAAACATGTCTAAACCCAATGTGCCAATCATATGGTAGTTAAATATATAAACCATCATTAACCTACTCCTGTTTTGTGCCAACTGTTGCACGATGAAGCAGGGCCATGGCATGCATTAAGTACAATACTTTGCATCTTGTGCCAGATTCAACTTGTAGTGCAAAGTGAGGGCTGCACAAATCCATAAAGCACAATTGCTCAGTTGATGAATTCAAAGGGGCACAATGTTATGCACTTTAGAGGTCTTTCACTTGCTCCTGTGGGATTAATACATTTAAAATTAAAAATTACAGAAATCTTGCTTCTGGAAGATGCTTAACTCATTGCATTTTAAACACAGTTTTATCCAATCAGTGATATTGTGCTTTTGTTACCTGTGCAAAACGTTTGCCAAAACAGATGGAGGTAGGAACTGCAATTGGTAGACTATTAAAACATTTAAAGTGCAATAACTTGTAATAAAACATGTCCCAGAAACTGAGAATCATCTTTATATTTTTCTATGGTTTAAAAAAAGAAGTTTTTAAATTTGTAATTCAAAAATAAGAATTCTAGTGTAATAGAGAAATATGTGTACATAACATTACAGAGATCAAGTTATTGTACATGTTACTATCTCAATTTTTTCAATAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGA
                                                  Xl3.1-CHK-1012711723       ATACACTTGCTGGTCCGGAATTCAATTTTATATTGTAGAGTGAATTATTTGCAGTGTAAACAGTGTAATTTAGAAATAAAAACTATACCATAAAAATCATGACAGAATCCCTTTAATATTGCATATGTGTTTTTTCCTTTGTTTCCTTTTGTAATTGTATTTGTTTGACATAAGTAGCAAGGCAGAAAGTAGCAGTTGCTATGGCAAGTAGCAGTTATATTTACTGTATAGGAGCTTTGTGCATATACACTTAGCTATGTACTGCAGCTAGCATCATTATTTTTGTATAGTAACTTAAAAATAAGCAAACATGTCTAAACCCAATGTGCCAATCATATGGTAGTTAAATATATAAACCATCATTAACCTACTCCTGTTTTGTGCCAACTGTTGCACGATGAAGCAGGGCCATGGCATGCATTAAGTACAATACTTTGCATCTTGTGCCAGATTCAACTTGTAGTGCAAAGTGAGGGCTGCACAAATCCATAAAGCACAATTGCTCAGTTGATGAATTCAAAGGGGCACAATGTTATGCACTTTAGAGGTCTTTCACTTGCTCCTGTGGGATTAATACATTTAAAATTAAAAATTACAGAAATCTTGCTTCTGGAAGATGCTTAACTCATTGCATTTTAAACACAGTTTTATCCAATCAGTGATATTGTGCTTTTGTTACCTGTGCAAAACGTTTGCCAAAACAGATGGAGGTAGGAACTGCAATTGGTAGACTATTAAAACATTTAAAGTGCAATAACTTGTAATAAAACATGTCCCAGAAACTGAGAATCATCTTTATATTTTTCTATGGTTTAAAAAAAGAAGTTTTTAAATTTGTAATTCAAAAATAAGAATTCTAGTGTAATAGAGAAATATGTGTACATAACATTACAGAGATCAAGTTATTGTACATGTTACTATCTCAATTTTTTCAATAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAAT
  5   1   2       bld Neu7      in                         XL020o07.5p GAAAAAATACACTTGCTGGTCCGGAATTCAATTTTATATTGTAGAGTGAATTATTTGCAGTGTAAACAGTGTAATTTAGAAATAAAAACTATACCATAAAAATCATGACAGAATCCCTTTAATATTGCATAtgtgttttttcctttgtttccttttgtaattgtatttgtttgACATAAGTAGCAAGGCAGAAAGTAGCAGTTGCTATGGCAAGTAGCAGTTATATTTACTGTATAGGAGCTTTGTGCATATACACTTAGCTATGTACTGCAGCTAGCATCATTATTTTTGTATAGTAACTTAAAAATAAGCAAACATGTCTAAACCCAATGTGCCAATCATATGGTAGTTAAATATATAAACCATCATTAACCTACTCCTGTTTTGTGCCAACTGTTGCACGATGAAGCAGGGCCATGGCATGCATTAAGTACAATACTTTGCATCTTGTGCCAGATTCAACTTGTAGTGCAAAGTGAGGGCTGCACAAATCCATAAAGCACAATTGCTCAGTTGATGAATTCAAAGGGGCACAATGTTATGCACTTTAGAGGTCTTTCACTTGCTCCTGTGGGATTAATACATTTAAAATTAAAAATTACAGAAATCTTGCTTCTGGAAGATGCTTAACTCATTGCATTTTAAACACAGTTTTATCCAATCAGTGATATTG
  5   1   2      seed DMZ       in                         xl301e19.5p                                                                                                                                                                                                                                                                                                                                                                                                               GCACGATGAAGCAGGGCCATGGCATGCATTAAGTACAATACTTTGCATCTTGTGCCAGATTCAACTTGTAGTGCAAAGTGAGGGCTGCACAAATCCATAAAGCACAATTGCTCAGTTGATGAATTCAAAGGGGCACAATGTTATGCACTTTAGAGGTCTTTCACTTGCTCCTGTGGGATTAATACATTTAAAATTAAAAATTACAGAAATCTTGCTTCTGGAAGATGCTTAACTCATTGCATTTTAAACACAGTTTTATCCAATCAGTGATATTGTGCTTTTGTTACCTGTGCAAAACGTTTGCCAAAACAGATGGAGGTAGGAACTGCAATTGGTAGACTATTAAAACATTTAAAGTGCAATAACTTGTAATAAAACATGTCCCAGAAACTGAGAATCATCTTTATATTTTTCTATGGTTTAAAAAAAGAAGTTTTTAAATTTGTAATTCAAAAATAAGAATTCTAGTGTAATAGAGAAATATGTGTACATAACATTACAGAGATCAAGTTATTGTACATGTTACTATCTCAATTTTTTCAATAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGA
  5   1   2       bld DMZ       in                         xl257m02.5p                                                                                                                                                                                                                                                                                                                                                                                                               GCACGATGAAGCAGGGCCATGGCATGCATTAAGTACAATACTTTGCATCTTGTGCCAGATTCAACTTGTAGTGCAAAGTGAGGGCTGCACAAATCCATAAAGCACAATTGCTCAGTTGATGAATTCAAAGGGGCACAATGTTATGCACTTTAGAGGTCTTTCACTTGCTCCTGTGGGATTAATACATTTAAAATTAAAAATTACAGAAATCTTGCTTCTGGAAGATGCTTAACTCATTGCATTTTAAACACAGTTTTATCCAATCAGTGATATTGTGCTTTTGTTACCTGTGCAAAACGTTTGCCAAAACAGATGGAGGTAGGAACTGCAATTGGTAGACTATTAAAACATTTAAAGTGCAATAACTTGTAATAAAACATGTCCCAGAAACTGAGAATCATCTTTATATTTTTCTATGGTTTAAAAAAAGAAGTTTTTAAATTTGTAATTCAAAAATAAGAATTCTAGTGTAATAGAGAAATATGTGTACATAACATTACAGAGATCAAGTTATTGTACATGTTACTATCTCAATTTTTTCAATAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGG
  5   1   2       e50                               Xl3.1-XL511a08ex.5                                                                                                                                                                                                                                                                                                                                                                                                                     GCATCAAAACGCAGTGCATTTGTCACAGACGAGCTTTTCATTCGTACACTCTGGTCGCTGCCGTTTAACAGCCATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTAGGTGCAGATGCTGTAGGTATGAGCACAGTACATGAGGTGGTTGTTGCAAGACACTGCGGCCTGCGCATCCTGGGAATATCACTAATTACCAACAAAGCTGTTATGGACTATGACAGTAATTTCACTGCCAACCACGAGGAAGTGCTTCAAGCTGGCAAAGATAGTGCCAAATATATGGAGAAGCTTGTAAGCACTTTCCTGCAGCGCTTGGACCTAAATAAAGTGTGATAGCACAGGGAACAAGTTTAGGGCAAAAAGATAAATCTACTGTTATTTTAATTATTCTATTCTTCTTATATGTCAAACCTGCCAGCCTTTAGCTGTTTTTATACTGTATTTTTTTTTTGGGTTATGCTCAGAAATGTGTTTGTAGAACAGCTGCGGGTTGGCAGGATCTAACAATAACAGGCCAATGCTTCTCTACTGTAGCAACATTTCTATCTATACCTCTTTTTTAATACAGCTACCTATCAGAATGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCTGAAATGTAATAGAACAATAGAACCCAGCAGCATGGGTGAAAAGCTAATGAAAAGAATGGGCTGAAGGAACATGACTCCTTATTTTATTTTACTTTATTAAACATTTATTACTT
                                                  Xl3.1-CHK-1012685660                                                                                                                                                                                                                                                                                                                                                                                                                           AAACGCAGTGCATTTGTCACAGACGAGCTTTTCATTCGTACACTCTGGTCGCTGCCGTTTAACAGCCATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTAGGTGCAGATGCTGTAGGTATGAGCACAGTACATGAGGTGGTTGTTGCAAGACACTGCGGCCTGCGCATCCTGGGAATATCACTAATTACCAACAAAGCTGTTATGGACTATGACAGTAATTTCACTGCCAACCACGAGGAAGTGCTTCAAGCTGGCAAAGATAGTGCCAAATATATGGAGAAGCTTGTAAGCACTTTCCTGCAGCGCTTGGACCTAAATAAAGTGTGATAGCACAGGGAACAAGTTTAGGGCAAAAAGATAAATCTACTGTTATTTTAATTATTCTATTCTTCTTATATGTCAAACCTGCCAGCCTTTAGCTGTTTTTATACTGTATTTTTTTTTTGGGTTATGCTCAGAAATGTGTTTGTAGAACAGCTGCGGGTTGGCAGGATCTAACAATAACAGGCCAATGCTTCTCTACTGTAGCAACATTTCTATCTATACCTCTTTTTTAATACAGCTACCTATCAGAATGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCTGAAATGTAATAGAACAATAGAACCCAGCAGCATGGGTGAAAAGCTAATGAAAAGAATGGGCTGAAGGAACATxxxxxCTTATTTTATTTTACTTTATTAAACATTTATTACTTGACATG
  5   1   2       chi DMZ       in                         xl314c23.5p                                                                                                                                                                                                                                                                                                                                           ACGAGCTTTTCATTCGTACACTCTGGTCGCTGCCGTTTAACAGCCATGTCTGAGAAGGAAAGTGTCCGCGGGTCTCCGTCGCGTGGCCCTGCCCCTTTTGACATCATACCCGCCCCTTTTGATGTCACGCCCCGCCCATTTGAGGGCCCACCCCCCAGCAGCCGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGA
  5   1   2       chi Te1                             IMAGE:6927929.5p                                                                                                                                                                                                                                                                                                                                                                     GGGGTGTCGCCATCTGCCAGCGGCCGCATCGATAGTGTAAAGGAGGAAGCATCAAAACGCAGTGCATTTGTCACAGACGAGCTTTTCATTCGTACACTCTGGTCGCTGCCGTTTAACAGCCATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTTAGGATTTGCAGGAAAAAAATCATTTGTTTTGGCCAATAAGAAGAACAGGTTTGGGCCCTCCGTTTCCCCCCTATGGTCGTATGCTTATTAACAGGGAAACATGGAGGAAGTCCTGTTTGCCTAACCTGGCCTGGCAAAGGAAACCGGGGGTTTATAAATTAATAAATGGAAAAAAAAAggggggggggttaattggggggggttccttgggggggggggacaccctaaaccctttttgaaaaaaaaCCA
  5   1   2       bld Kid  5g                         IMAGE:4030585.5p                                                                                                                                                                                                                                                                                                                                                                                CCACGCGTCCGCCCACGCGTCCGGTGGAAAGGAGGAAGCATCAAAACGCAGTGCATTTGTCACAGACGAGCTTTTCATTCGTACACTCTGGTCGCTGCCGTTTAACAGCCATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTAGGTGCAGATGCTGTAGGTATGAGCACAGTACATGAGGGGGTTGTTGGCAAGACACTGCGGGCCGGCGCATCCTGGGAATATCACTAATTAACCAACAAAGCTGTTATGGACTATGACGGTAATTTCACTGCCAACCAACG
  5   1   2       chi Int2                            IMAGE:8527712.5p                                                                                                                                                                                                                                                                                                                                                                                  AAAAANCTACAGCCTCAGNGAAAGAAATaaaaaaaaaNCNNCCCAGATTTTAGTCGTATACCTGGTCGCTACTGCTTTACAGCCATGTCTCCTCCTGCCCCAGCCTCACAGAAGCAGAAGGAAAGTTGCACATATGAGGATTATAAAGATACAGCAGACTGGCTTCTATCCAAAACAAAACAGCGTCCCATTGTGGCCATTGTGTGTGGCTCTGGTCTCGGTGGACTAGGAGAACTTCTTACAGATCAAGAGGCTTTCAATTACTGTGACATACCCAACTTCCCACAGAGCACAGTTCCTGGACATGCGGGGCGACTGGTATTTGGAAACCTGAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTATCCATTGTGGAAGGTGACGTTTCCAGTCCGAGTGTTCCGCCTAATGGGAGTTGAGGTCATCATTGTAACTAATGCTGCTGGAGGTCTGAACCAAGAGTTCAATGTAGGAGACATCATGGTGATAAAAGATCACATTAATATGCTAGGATTTGCAGGACAAAATCCATTGTTTGGTCACAATGAGGACAGGTTTGGCCCTCGTTTCACACCTATGTCCGATGCATATGACAAGGACATGACGAGTCTGTTGCTGGCCGCTGGCAAGGAGCTGGGTTATAATAACATTCAAGAAGAGTGTATTGTGGTATGGGGGACTAAGCTTGAACATTGGAAAATGTCATTCTCACAACTAGTCAAATGCGTAGTAGATTCATAATGAGTGTTTTGCCACACGGGCTGCTACTGAATTCCTGATACAAGCTGTTGGAATGAGAATTCGCCCCAGAGGCTCGTGAAATAGCAAAG
  5   1   2       bld Em10 5g                         IMAGE:8318534.5p                                                                                                                                                                                                                                                                                                                                                                                                                TGAAACAAGTTTTCGGTCCGGAATCCCGGGATGACGAGCTTTTCATTCGTACACTCTGGTCGCTGCCGTTTAACAGCCATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAAGGGTGTATTGTGGTCTTGTGGGACCTAATCTTTT
  5   1   2       bld Int2 5g3  in                    IMAGE:8823080.5p                                                                                                                                                                                                                                                                                                                                                                                                                    GTGGTAGGTTTTAgggggggggTTGTTTATTTTGATTCGTCCCCGTACACTCTGGTCGCTGCCGTTTAACAGCCATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTAGTGCAGATGCTGTAGTATGAGCACAGTACATGAGTGGTTGTTGCCAGACACTGCGGCCTGCGCATCCTGGAATATCACTAATTACCAACAAGCTGTATGGACTATGACAGTATTTCCACTGCACCACGAGAGTGCTCAGCTGCAAAGATAGTGCAAATATAATGAGAGCTTGTAGCCACTTCTGCATCGCTTGACCTTAATTAATGTGATAGCACAGCACAGTTAAGGCCAAGG
  5   1   2       bld Tad1 5g3  in                    IMAGE:6881082.5p                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGGCATTTGTCACAGACGAGCTTTTCATTCGTACACTCTGGTCGCTGCCGTTTAACAGCCATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAANCAGAACATGANGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGGTCTTGGGGGACCTAACTTTTGAACAATTGCTGAATGCCGATTTCTCAACAAGTTAGGTGCAAATGCTGTAAGTATGAGCACAGTACATGGAGGTGGGTTGTTGCCAAGAAACTGGCGGCCCTGCCCCATCCTGGGGAATATCACCTAATTT
  5   1   2       bld Tad1 5g                         IMAGE:6938193.5p                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGGCATTTGTCACAGACGAGCTTTTCATTCGTACACTCTGGTCGCTGCCGTTTAACAGCCATGTCTGAGAAGGAAAGTTGTACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTACGGGAACTTCTTAAAGATCAACAGGCTTTCTATTACTGCGACATACCCAACTTCCCCAAGAGCACAATTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCCCCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAGAGGATCACATCAACCTGGTAAGATTTTGCAGGACAAAATCCATTGTTTGGGCCATTATGAAAACAGGTTTGGGTCCTCGTTTTCCCCCCCTATGGTCGAATGCTTTATAACCAAAAACATGGAGGAGTCTGGTTGCTAACCTGGTGGGTCAGGGAGCCTGGGTTATTATTAATTTTGAGAAAAAggggggtattggtgggccttgggggggAACCTAAACTTTTGAAAACACTTGTCCGGGAAAGTCCCAAATTGTTCCAAAAAAGGTTTAAGAGGCCCCAAAGGCCTTGTAGGGAAATGGAACCCAAT
  5   1   2       chi Em10                            IMAGE:7983485.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCGGTCCGGATTCCCGGGATCTCTGGTCGCTGCCGTTTACAGCCATGTCTGAGAAGGAAAGTTGCACATATGAAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAAGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCAATTTAACTAATGCTGCCGGATGTCTGAACCAAGAGTTCAATGTAGGAGATTTCTTGGTGATAAAGGATCACATCACCAGGGTAAGATTTTCAGGACTAAATCTATTGTTTGGCCATAATGAAAACAAGTTTGGTCCACTATTCCCCCCTATTCCAAATGCATACTGAAACGACCATGAGGAATCTGTAGCTTGCATCCGATAAGGACCTAGGATATATTAATATAATAAAATGGTTTATTATAGGCTTATGAGTAACATCTTTGATTATCTGTTAGAAACCTATTCCCCAAAATAAGGAGTATAGCTGTAGAATGAGGAACAATCAATTTAATTAAACATAATATTCTTCCTGCTACACTAATAAAATAATA
  5   1   2       bld Ga15 5g                            XL410i08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGAGCTTTTCATTCGTACACTCTGGTCGCTGCCGTTTAACAGCCATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGNTAGGTGCAGATGCTGTA
  5   1   2       bld Ga15 5g3  in                       XL428h10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGAGCTTTTCATTCGTACACTCTGGTCGCTGCCGTTTAACAGCCATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCNACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTANGAGACATCATGGTGATAAAGGATCACATCAACATGGNAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTANGTGCANATGCTGTANGTATGAGCACANTACATGA
  5   1   2       bld FaBN 5g                         IMAGE:8077340.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGAGCTTTTCATTCGTACACTCTGGTCGCTGCCGTTTAACAGCCATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTACTTTGAAACATTGCTGAATGCCGATTTTCTCACAGTTANGTGCAGATGCTGTANGTATGAGCACAGTACATGAAGTGGTTGTTGCAGACACTGNCGCTGCGCATCCTGGAATATCACTAATA
  5   1   2       bld Em10 5g                         IMAGE:8322273.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGAGCTTTTCATTCGTACACTCTGGTCGCTGCCGTTTAACAGCCATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTAGGTGCAGATGCTGTAGGTATG
  5   1   2       bld Ga15 5g                            XL444a05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTTTCATTCGTACACTCTGGTCGCTGCCGTTTAACAGCCATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTAGGTGCAGATGCTGTAGGTATGAGCACAGTACATGAGGTGGTTGTTGCCANACACTGCGGCCTGCNCATCCTGGGAAATATCACTAATTACCAACAAAGCTGTTAT
  5   1   2       bld DMZ  5g3  in                         xl229a14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTTTCATTCGTACACTCTGGTCGCTGCCGTTTAACAGCCATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTANGTG
  5   1   2       bld Ga18 5g3  in                      xlk164c13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTTCATTCGTACACTCTGGTCGCTGCCGTTTAACAGCCATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGNNGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGNCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGNCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGNTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGNNAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGANCTAACTTTGAAACAATTGCTGAATGNCGATTTCTCAACAAGNTAGGTNNAGATNCTGTAGGTATGAGCACAGTACATGAGGNGGTTGTTNNCAGACACTGCGGCCTNNNCATCCTGGGAATAT
  5   1   2       bld Ga15 5g3  in                       XL451k22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                           CATTCGTACACTCTGGTCGCTGCCGTTTAACAGCCATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTANGTGCANATGCTGTANGTATGANCACAGTACATGAGGTGGTTGTTGCCA
  5   1   2       bld Ga15 5g3  in                       XL482l08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTCGTACACTCTGGTCGCTGCCGTTTAACAGCCATGTCTGAGAAGGAAAGTTGTACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTAGGTGCAGATGCTGTANGTATGAGCACAGTACATGANGTGGTTGTTGCAAGACACTGCGGCCTGCGCATCCTGGGAATATCACTAATTACCAACA
  5   1   2       chi Thy                             IMAGE:8546848.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTCGTACACTCTGGTCGCTGCCGTTTAACAGCCATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGTTCTTGGGGGACCTAACTTTGAAACATTGCATATTGCTTATTTTAACAGTTATGTAATATGTTTAATGTTTTTCCTTTTTATATTGGTGTCTCTAACTAAcatatatattctattatattatataactataaccttttgatatatattataCTTACCCTTAAGTATGTCTAATTTTAAATTTATATCGATATACTATACTATTACTTAGCATAttttttaattttacttttttttCGTTTATT
  5   1   2       bld Kid  5g                         IMAGE:4033410.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTCGTACACTCTGGTCGCTGCCGTTTAACAGCCATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTAGGTGCAGATGCTGTAGGTATGAGCACAGTACATGAGGGTGGTTGTTGCCAGACACTGCGGGCCTGCGCATCCCTGGGGAATATCACTAAATTACCAACCAAAGGCTGGTTATGGGACTATGGACAGGTAAATTTTCACTTGGCCAAACCCACCGAGGGAAAATGGCCTTCCCAAGGCTTGGGCCAAAA
  5   1   2       bld Em10 5g                         IMAGE:8321873.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGTACACTCTGGTCGCTGCCGTTTAACAGCCATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTAGGTGCAGATGCTGTANGTATGAGCACAGTACATGAGGTGGTTGTTGCCGACACTGC
  5   1   2       bld DMZ  5g3  in                         xl267k01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGTACACTCTGGTCGCTGCCGTTTAACAGCCATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGA
  5   1   2       bld Int2 5g                         IMAGE:8530346.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TACCTCTGGTCGCTGCCGTTTACAGCCATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTAGGTGCAGATGCTGTANGTATGAGCA
  5   1   2       bld Emb4 5g3  in                    IMAGE:4957426.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GACGCGTGGGCTGCCGTTTAACAGCCATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATG
  5   1   2       chi Em10                            IMAGE:7980819.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CACTCTGGTCGCTGCCGTTTACAGCCATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTAGGTGCAGATGCTGTAGGTATGAGCACAGTACATGAGGTGGTTGTTGCCAACACTGCGGCCTGCGCATCCTGAGAAATCACTAATTACCAACAAGCTGTTAGGACTATGACAGTATTTCACTGCCACCACGAGGAGTG
  5   1   2       bld Em10 5g                         IMAGE:7979779.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCTGGTCGCTGCCGTTTAACAGCCATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACATTGCTGAATGCCGATTCTCACAAGTANGTGCAATGCTGTAGTATGAGCACAGTACATGAGGTGGTGTTGCAGACACTGCGCTGCGCATCTGGGATATCATAATACACAAGCTGTATGATATGACGTATTCCTGCACCACAGAATCTCAGCTGAAGAATGCAATATGAGACTGAGCTTCTGACCTGACT
  5   1   2       bld Tbd7 5g                              XL070p15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAATTCGGACGAGGGTTAACNGCCTGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTNCAGNNCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGNCTGAACCAAAAG
  5   1   2       bld Ga15 5g3  in                       XL444j10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGGTCGCTGCCGTTTAACAGCCATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTANGTGCAGATGCTGTANGTATGAGCACAGTACATGAGGTGGTTGTTGCCANACACTGCGGCCTGCGCATCCTGGGGAATATCACTAATTACCAACAAAGCTGTTATGGACTATGACAGTAATTTCACT
  5   1   2      seed Ga15 5g3  in                       XL511a08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGGTCGCTGCCGTTTAACAGCCATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTANGTGCAGATGCTGTANGTATGAGCACAGTACATGAGGTGGTTGTTGCCAGACACTGCGGCCTGCGCATCCTGGGAATATCACTAATTACCAACAAAGCTGTTATGGACTATGACAGTAATTTCACTGCCAACCAC
  5   1   2       bld DMZ  5g3  in                         xl257i17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGGTCGCTGCCGTTTAACAGCCATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTAGGTGCAGATGCTGTAGG
  5   1   2       bld Neu7 5g3  in                         XL013l05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGGTCGCTGCCGTTTAACAGCCTGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACA
  5   1   2       bld Ga15 5g                            XL516p05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGCCGTTTAACAGCCATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTANGTGCAGATGCTGTAGGTATGAGCACAGTACATGAGGTGGTTGTTGCCANACACTGCG
  5   1   2       bld DMZ  5g                              xl327o08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCGATTTAACAGCCATGTCTGANAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTANGAGACATCATGGTGATNAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCANATGCATATNACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTAAGTGCAGATGCTGTAGGTATGAGCACA
  5   1   2       bld Em10 5g                         IMAGE:8319485.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCGTTTACAGCCATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAACAATTGCTGAATGCCGATTCTCACAAGTTANGTGCGATGCTGTAGTATGACACAGTACATGAGGTGGTGTTGCAGACACTGCGCTGCCATCCTGGATATCATA
  5   1   2       bld DMZ  5g3  in                         xl336l03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTTAACAGCCATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTT
  5   1   2       bld DMZ  5g3  in                         xl336l05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTTAACAGCCATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTAGGTGCAGATGCTGTAGGTATGAGCACAGTACATGAAG
  5   1   2       bld Ga15 5g3  in                       XL506a11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTAACAGCCATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTAGGTGCAGATGCTGTAGGTATGAGCACAGTACATGAGGTGGTTGTTGCCANACACTGCGGCCTGCGCATCCTGGGAATATCACTAATTACCAACAAAGCTGTTATGGACTATGACAGTAATTTCNCTGCCAACCA
  5   1   2       bld Int2                            IMAGE:8528865.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGNTGCATCGATTGAATTCGTCCCTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTAAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTCCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAAACCATTGTTTGGCCATAATGAAAACAGGAATGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTAGGTGCAGATGCTGTAGGTATGAGCACAGTACATGAGGTGGTTGTTTGCAGACACTGCGGCCTGCGCATCCTGGGATATCACTAATTACAACAAAGCTGTTATGACTATGACGTNATTCACTGCCNNACACGAGAGTGCTTCAGCTGGCAAGATGTGCAAATATATGAGAGCTGTAGCACTTCTGCACC
  5   1   2       bld Em10 5g                         IMAGE:7983230.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCCATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTAGGTGCAGATGCTGTAGGTATGAGCACAGTACATGAGGTGGGTTGTGCCAAACACTGCGGCCTGCGCATCCTGGGAATACACTAATTACCA
  5   1   2       bld Ga18      in                      xlk114d24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCCATGTCTGAGAAGGAAAGTTGNACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGNGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGNCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGNNNCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGNCTGTTGCTAGCTGCTGGCAANGAGNTGGGTTATAATAATATGAGAGAAGGGGNNTATTNTGGNCTNNGGGGACTAACTTTGAAANNANTGCTGAATNCCGATTTCTCNA
  5   1   2       bld Tbd7                                 XL069p15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGG
  5   1   2       bld DMZ                                  xl286o08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTAGGTGCAGATGCTGTA
  5   1   2       bld Tbd7      in                         XL101o21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCA
  5   1   2       bld Te2N      in                    IMAGE:7202995.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTGAGAAGGAAAGTTGTACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTAGGTGCAGATGCTGTAGGTATGAGCACAGTACATGAGGTGGTTGTTGCAAGACACTGCGGCCTGCGCATCCTGGGAATATCACTAATTACCAACAAAGCTGTTATGGACTATGACAGTAATTTCACTGCCAACCACGAGGAAAGTGCTTCAAGCTGGGCAAAGATAGTGCCCAAATATATGGAAGAAGCTTTGTAAC
  5   1   2       bld DMZ       in                         xl337l05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAAAGTTGCACACTATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAANCAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGT
  5   1   2       bld Tbd7      in                         XL065e21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTATTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTAGGTGCAGATGCTGTAGGTATGAGCACAGTACATGA
  5   1   2       bld Ga15                               XL470l18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTAGGTGCAGATGCTGTANGTATGAGCACAGTACATGAGGTGGTTGTTGCCAGACACTGCGGCCTGCGCATCCTGGGAATATCACTAATTACCAACAAAGCTGTTATGGACTATGACAGTAATTTCACTGCCAACCAC
  5   1   2       bld Ga15                               XL442p02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTANGTGCAGATGCTGTANGTATGAGCACAGTACATGAGGTGGTTGTTGCCANACACTGCGGNCTGCGCATCCTGGGAATATCACTAATTACCAACAAANCTGTTATGGACTATGACANTAATTTCACT
  5   1   2       bld Ga18      in                        xlk6n14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGNGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGNCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGNGNCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGNCTGTTGCTAGCTGCTGGNAAGGAGCTGGGTTATAATAATATGAGAGAAGNGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGNTAGGTGCAGATNNTGTAGGNATGAGCACAGTACATGAGGNGGTTGTTNNCAGACACTGCGGCCTGCNCATCCTGGGAATATCACTAATTACCAACAAAGCTGTTATGGACTATGACAGNNNTTCACTGCCAACCA
  3   1   2       bld Te2N      in                    IMAGE:7202995.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCATTGTGCCATGTGTGCGCTCTNGGCTGGTGACTAGGGAAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCCAAGAAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTAGGTGCAGATGCTGTAGGTATGAGCACAGTACATGAGGTGGTTGTTGCAAGACACTGCGGCCTGCGCATCCTGGGAATATCACTAATTACCAACAAAGCTGTTATGGACTATGACAGTAATTTCACTGCCAACCACGAGGAAGTGCTTCAAGCTGGCAAAGATAGTGCCAAATATATGGAGAAGCTTGTAAGCACTTTCCTGCAGCGCTGGACCTAAATAAAGGTGTGCACGGACATGG
  5   1   2       bld Spl                             IMAGE:8460891.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTAGGTGCAGATGCTGTAGGTATGAGCACAGTACATGAGGTGGTTGTTGCAAGACACTGCGGCCTGCGCATCCTGNGAATATCACTAATTACCAAACAAGCTGTTATGGACTATGACAGTAATTTCACTGCCAACCACGAGGAAGTGCTTTCAGCTGGCAAAGATAGTGCCAAAATATATGAGAAGCTTTGTAGCATTTCCCTGCAGCGCTGGACTAAATAAGTGTGATACACAGGAACAGTTTAGGCAAAAGANAATCTACTGTATTTNAATATCTATCTCTAATGTCAACTGCAGCCTTACTGTGTTACT
  5   1   2       bld Ga15      in                       XL514b18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTAGGTGCAGATGCTGTAGGTATGAGCACAGTACATGAGGTGGTTGTTGCAAGACACTGCGGCCTGCGCATCCTGGGAATATCACTAATTACCAACAAAGCTGTTATGGACTATGACAGTAATTTCACTGCCAACCACGAGGAAGTGCTTCAAGCTGGCAAAGATAGTGCCAAATATATGGAGAAGCTTGTAAGCACTTTCCTGCAGCGCTTGGACCTAAATAAAGTGTGATAGCACAGGGA
  5   1   2       bld Brn1      in                    IMAGE:6951217.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTCCGGATTTCCGGGATATTTCCAGTTCGAGTGTTCCCCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTAGGTGCAGATGCTGTAGGTATGAGCACAGTACATGAGGTGGTTGTTGCAAGACACTGCGGCCTGCGCATCCTGGGAATATCACTAATTACCAACAAAGCTGTTATGGACTATGACAGTAATTTCACTGCCAACCACGAGGAAGTGCCTCAAGCTGGCAAAAATAGTGCCCAATATATGGAAAAGCTTGGTAAGCACTTTTCTGCAGCGCTTTGAACCTAAATAAAGTGGTGATACCCCCGGGGGAACAATTTTAGGGGCaaaaaaaaaaaaaTCACCGGGTAATTTTTAAATTAATCCCAATTCCTCCCTAAAAAGGGCAAAAACCTGGCCAGCCTTTTTTACTGGTGGGTAAAACCGGAAAtttttttttttttgggggtttaggcccccaaaaaatggtttttttttaaaaaaaaacctctcccggtttttgcccgggttttttACACAAATAAAAAGGGGCCCAAAGGGCTTTTTCCCCACCGGGGGAAGACCCACATTTTTTCTTAATTTAAAAAACCCCCCCTTTTN
  5   1   2       bld Tad1      in                    IMAGE:6877706.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTAGGTGCAGATGCTGTAGGTATGAGCACAGTACATGAGGTGGTTGTTGCAAGACACTGCGGCCTGCGCATCCTGNGAATATCACTAATTACCAACAAAGCTGTTATGGACTATGACAGTAATTTCACTGCCAACCACGAGGAAGTGCTTCAAGCTGGCAAAGATAGTGCCAAATATATGGAGAAGCTTGTAAGCACTTTCCTGCAGCGCTTGGACCCTAATAAAGTGTGATAGCACAGGGAAACAAGTTTAGGGGCAAAAAGATAAAATCTACTGGNTATTTTAATTTATTCAATTCCTTCTTATAAGGCCAAAACCTGGCCAGCCCNTTTAGCTGNNTGNNTATAACTGGAttttttttttttttGGGGTTATGCCTCCAGAAAATGTTGTTTTGGTAAAAACCACCTTGCCGGGGTTGGGCAAGGGATTCTTTAACAATAAACCAGGA
  5   1   2       bld Ga15      in                       XL430j11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCACGTCGTCCGCCCACGCGGTCCGCCCACGCGATCCGTTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTANGTGCAGATGCTGTAGGTATGAGCACAGTACATGAGGTGGTTGTTGCCAGACACTGCGGCCTGCGCATCCTGGGAATATCACTAATTACCAACAAAGCTGTTATGGACTATGACAGTAATTTCACTGCCAACCACGAGGAAGTGCTTCAAGCTGGCAAAGATAGTGCCAAATATATGGAGAAGCTTGTAAGCACTTTCCTGCAGCGCTTGGACCTAAATAAAGTGTGATAGCACAGGGAACAAGTTTAGGGCAAAAAGATAAATCTACTGTTATTTTAATTATTCTATTCTTCTTATATGTCAAACCTGCCAGCCTTTAGCTGTTTTTATACTGTAttttttttttGGGTTATGCTCAAAAATGTGTTTGTAAAAC
  5   1   2       bld Ga15      in                       XL411j20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTAGGTGCAGATGCTGTAGGTATGAGCACAGTACATGAGGTGGTTGTTGCCAGACACTGCGGCCTGCGCATCCTGGGAATATCACTAATTACCAACAAAGCTGTTATGGACTATGACAGTAATTTCACTGCCAACCACGAGGAAGTGCTTCAAGCTGGCAAAGATAGTGCCAAATATATGGAGAAGCTTGTAAGCACTTTCCTGCAGCGCTTGGACCTAAATAAAGTGTGATAGCACAGGGAACAAGTTTAGGGCAAAAAGATAAATCTACTGTTATTTTAATTATTCTATTCTTCTTATATGTCAAACCTGCCAGCCTTTAGCTGTTTTTATACTGTAttttttttttGGGTTATGCTCAAAAATGTGTTTGTAAAACANCTGCGGGTTGGCAGGATCTAACAATAACAGGCCAATGCTTCTCTACTGTANCAACATTTCTATCTATACCCCTTTTTTAA
  5   1   2       bld Eye1                            IMAGE:7020278.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAATTATAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTAGGTGCAGATGCTGTAGGTATGAGCACAGTACATGAGGTGGTTGTTGCAAGACACTGCGGCCTGCGCATCCTGGGAATATCACTAATTACCAACAAAGCTGTTATGGACTATGACAGTAATTTCACTGCCAACCACGAGGAAGTGCTTCAAGCTGGCAAAGATAGTGCCAAATATATGGAGAAGCTTGTAAGCACTTTCCTGCAGCGCTTGGACCTAAATAAAGTGTGATAGCACAGGGAACAAGTTTAGGGCAAAAAGATAAATCTACTGTTATTTTAATTATTCTATTCTTCTTATATGTCAAACCTGCCAGCCTTTAGCTGTTGTTATACTGTAttttttttttttGGGTTATGCTCAGAAAATGTGTTTGTAGAACAGCTGCGGGTTGGCAGGATCTAACAATAACAGGCCAATGCTTCTCTACTGTAGCAACATTTCTATCTATACCTCTCTTTTAATACAGCTACCTATCAAAATGGTGCACAGGGACCAGTATCTTGATCCCACTTACTGGGATAATGGAGCATCCATGGTGTCAATTCCTCCACTAACACAAATATTCACATTTCCCTCTATTCTCCACATTTCAGTTTTAACCTAAAGTTTTGTTTGGAAAAAGAAAACCAAATTTACCCCTTGCCCCAGAC
  5   1   2       bld Ga15      in                       XL414l17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAGAACATGAAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGTATTGTGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTAGGTGCAGATGCTGTAGGTATGAGCACAGTACATGAGGTGGTTGTTGCCAGACACTGCGGCCTGCGCATCCTGGGAATATCACTAATTACCAACAAAGCTGTTATGGACTATGACAGTAATTTCACTGCCAACCACGAGGAAGTGCTTCAAGCTGGCAAAGATAGTGCCAAATATATGGAGAAGCTTGTAAGCACTTTCCTGCAGCGCTTGGACCTAAATAAAGTGTGATAGCACAGGGAACAAGTTTAGGGCAAAAAGATAAATCTACTGTTATTTTAATTATTCTATTCTTCTTATATGTCAAACCTGCCAGCCTTTAGCTGTTTTTATACTGTAttttttttttGGGTTATGCTCAAAAATGTGTTTGTAAAACANCTGCGGGTTGGCAGGATCTAACAATAACAGGCCAATGCTTCTCTACTGTACCAACATTTCTATCTATACCTCTTTTTTAATACANCTACCTATCAAAATGGTGCAAAGGACCANTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCNCT
  3   1   2       bld Brn1      in                    IMAGE:6951217.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTATTGTGGTCCTTGGGGGACCTAACTTTGAAACAAATTGCTAAATGCCGGTTTTTTCAACAAGTTAGGGGCCAGATGCGGTAGGTATGGAGCCCAGTACATGAGGTGGTTGGTGCAAGACACTGCGGCCTGCGCATCCCGGGAATATCACTAATTACCAACAAAGCTGTTATGGACTATGACAGTAATTTCACTGCCAACCACGAGGAAGTGCTTCAAGCTGGCAAAGATAGTGCCAAATATATGGAGAAGCTTGTAAGCACTTTCCTGCAGCGCTTGGACCTAAATAAAGTGTGATAGCACAGGGAACAAGTTTAGGGCAAAAAGATAAATCTACTGTTATTTTAATTATTCTATTCTTCTTATATGTCAAACCTGCCAGCCTTTAGCTGTTGTTATACTGTATTTTTTTTTTTGGGTTATGCTCAGAAATGTGTTTGTAGAACAGCTGCGGGTTGGCAGGATCTAACAATAACAGGCCAATGCTTCTCTACTGTAGCAACATTTCTATCTATACCTCTCTTTTAATACAGCTACCTATCAGAATGGTGCACAGGACCAGTATCTTGATCCACTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCTGAAATGTAATAGAACAATAGAACCCAGCAGCATGGGGAAAAGCTAATGAAAAGAATGGGCTGAAGGAACATGACGTA
  3   1   2       chi Tad1                            IMAGE:6877471.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGTCGGTGGCTTAGCTGCGGGCAAGGAGCTGGGGTTATAATAATACGAGAGAGGGGGGGTAATGTGGTCCTGGGGGACTAAACTTTGAACCAAATGGGTGAATGCCGATTTCTCAACAAGTTAGTGCCAGATGCTGTAGGTATGAGCACAGTACATGAGGTGGTTGTTGCAAGACACTGCGGCCTGCGCATCCTGGGAATATCACTAATTACCAACAAAGCTGTTATGGACTATGACAGTAATTTCACTTTCATGCAGCGCTTGGACCTAAATAAAGTGTGATAGCACAGGGAACAAGTTTAGGGCAAAAAGATAAATCTACTGTTATTTTAATTATTCTATTCTTCTGATATGTCAAACCTGCCAGCCTTTAGCTGTTGTTATACCGTATTTTTTTTATGGGTTATGCTCAGAAATGTGTTTGTAGAACAGCTGCGGGTTGGCAGGATCTAACAATAACAGGCCAATGCTTCTTTACTGTAGCAACATTTCTATCTATACCTCTTTTTTAATACAGCTACCTATCAGAATGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCATAGTGCGAAAATTTGCTGAAATGTAATAGAACAATAGAACCCAGCAGCATGGGGAAAAGCGAATGAAAAGAATGGGCTGAAGGAACATTGAGTAT
  3   1   2       bld Tad1      in                    IMAGE:6877706.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTAACTTTGAAACAAATTGCTGAATGCCGATTTCTTCAACAGTTTAGGTGCAGATGCTGTAGGTATGAGCCACAGTACATGAGGGGGGTTGTTGCAAGACANTGCGGCCTGCGCATCCTGGGAATATCACTAATTACCAACAAAGCTGTTATGGACTATGACAGTAATTTCACTGCCAACCACGAGGAAGTGCTTCAAGCTGGCAAAGATAGTGCCAAATATATGGAGAAGCTTGTAAGCACTTTCCTGCAGCGCTTGGACCTAAATAAAGTGTGATAGCACAGGGAACAAGTTTAGGGCAAAAAGATAAATCTACTGTTATTTTAATTATTCTATTCTTCTTATATGTCAAACCTGCCAGCCTTTAGCTGTTGTTATACTGTATTTTTTTTTTTGGGTTATGCTCAGAAATGTGTTTGTAGAACAGCTGCGGGTTGGCAGGATCTAACAATAACAGGCCAATGCTTCTCTACTGTAGCAACATTTCTATCTATACCTCTTTTTTAATACAGCTACCTATCAGAATGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCTGAAATGTAATAGAACAATAGAACCCAGCAGCATGGGGAAAAGCTAAGAAAAGAATGGGCTGAAGGAACATTGACGTT
  3   1   2       chi Int2 5g3  in                    IMAGE:8823080.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTTGAAAACAATTGTGAATGGCCGATTTTCTCAACAAGTAGTGCAGATGCTGTAGGTATGAGCACAGTACATGAGTGTGTGCCAGACATTGCGGCTGGCGCATCCTGGGAATATCACTAATTACCAACAAAGCTGTTATGGACTATGACAGTAATTTCACTGCCAACCACGAGGAAGTGCTTCAAGCTGGCAAAGATAGTGCCAAATATATGGAGAAGCTTGTAAGCACTTTCCTGCAGCGCTTGGACCTAAATAAAGTGTGATAGCACAGGGAACAAGTTTAGGGCAAAAAGATAAATCTACTGTTATTTTAATTATTCTATTCTTCTTATATGTCAAACCTGCCAGCCTTTAGCTGTTTTTATACTGTATTTTTTTTTTGGGTTATGCTCAGAAATGTGTTTGTAGAACAGCTGCGGGTTGGCAGGATCTAACAATAACAGGCCAATGCTTCTCTACTGTAGCAACATTTCTATCTATACCTCTTTTTTAATACAGCTACCTATCAGAATGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGCGGGAAAATTTGCTGAAATGTAATAGAACAATAGAACCCAGCAGCATGGGTGCAAATAGATAATGCAAATGGCCTGTTATTGTTAGATCCTGCCAACCCGCAGCTGTTCTACAAACACAATTCGTAGCAAG
  3   1   2       bld Tad1 5g3  in                    IMAGE:6881082.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAATTGCTGGAATGCCGATTTCTCAAAAAGTTAGGTGCAGAATGCTGTAGGTATGAGCACAGTACATGAGGTGGTTGTGCCCAGACACTGCGGCCTGCGCATCCTGGGAATATCACTAATTACCAACAAAGCTTATGGACTATGACAGTAATTTCACTGCCAACCACGAGGAAGTGCTTCAAGCTGGCAAAGATAGTGCCAAATATATGGAGAAGCTTGTAAGCACTTTCCTGCAGCGCTTGGACCTAAATAAAGTGTGATAGCACAGGGAACAAGTTTAGGGCAAAAAGATAAATCTACTGTTATTTTAATTATTCTATTCTTCTTATATGTCAAACCTGCCAGCCTTTAGCTGTTTTTATACTGTATTTTTTTTTTGGGTTATGCTCAGAAATGTGTTTGTAGAACAGCTGCGGGTTGGCAGGATCTAACAATAACAGGCCAATGCTTCTCTACTGTAGCAACATTTCTATCTATACCTCTTTTTTAATACAGCTACCTATCAGAATGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCTGAAATGTAATAGAACAATAGAACCCAGCAGCATGGGTGAAAAGCTAATGAAAAGAATGGGCTGAAGGAACATGA
  3   1   2       bld Ga15 5g3  in                       XL428h10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GNGCATCCTGGGAATATCNCTAATTNCCAACAAAGCTGTTATGGACTATGACAGTAATTTCNCTGCCAACCCCGAGGAAGTGCTTCAAGCTGGCAAAGATAGTGCCAAATATATGGNGAAGCTTGTAAGCNCTTTCCTGCAGCGCTTGGACCTAAATAAAGTGTGATAGCNCAGGGAACAAGTTTAGGGCAAAAAGATAAATCTACTGNTATTTTAATTATTCTATTCTTCTTATANGTCAAACCTGCCAGCCTNTAGCTGGTTTTATACNGTATTTTTTTTTTGGGTTATGCTCAGAAATGTGTTTGTAGAACAGCTGCGGGTTGGCAGGATCTAACAATANCAGGCCAATGCTTCTCTACTGTAGCAACATTTCTATCTATNCCTCNTNTTTAATACAGCTACCTATCNGAATGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCNCATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTNCCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCTGAAATGTAATAGANACAATAGAACCCAGCAGCATGGGTGAAAAGCTAATGAAAAGAATGGGCTGAAGGAACAT
  3   1   2       bld DMZ  5g3  in                         xl229a14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTAATTACCAACAAAGCTGTTATGGACTATGACAGTAATTTCACTGCCAACCNCGNGGAAGTGCTTCAAGCTGGCAAAGATAGTGCCAAATATATGGAGAAGCTTGTAAGCACTTTCCTGCAGCGCTTGGACCTAAATAAAGTGTGATAGCACAGGGAACAAGTTTAGGGCAAAAAGATAAATCTACNGTTATTTTAATTATTCTATTCTTCTTATATGTCAAACCTGCCAGCCNTTAGCTGNTTTTATACNGNATTTTTTTTTTGGGTTATGCTCAGAAATGTGTTTGTAGAACAGCTGCGGGTTGGCAGGATCTAACAATAACAGGCCAATGCTTCTCTACTGTAGCAACATTTCTATCTATACCTCTTTTTTAATACAGCTACCTATCAGAATGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCTGAAATGTAATAGAACAATAGAACCCAGCAGCATGGGTGAAAAGCTAATGAAAAGAATGGGCTGAAGGAACATGACTCTA
  3   1   2       bld Ga15 5g3  in                       XL506a11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAACAAAGCTGTTATGGACTATGNCNGTAATTTCACTGCCAACCNCGNGGNAGNGCTTCAAGCTGGCAAAGATAGTGCCAAATATATGGNGAAGNTTGTAAGCNCTTTCCTGCAGCGCTTGGNCCTAAATAAAGGGNGATAGCNCNGGGAACAAGTTTAGGGCAAAAAGATAAATCTACTGNTATTTTAATTATTCTATTCTTCTTATANGTCAAACCTGCCAGCCTTTAGCTGNTTTTATACTGTATTTTTTTTTTGGGTTATGCTCAGAAATGTGTTTGTAGAACAGCTGCGGGTTGGCAGGATCTAACAATAACAGGCCAATGCTTCTCTACTGTAGCAACATTTCTATCTATACCTCTTTTTTAATACAGCTACCTATCAGAATGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCTGAAATGTAATAGAACAATAGAACCCAGCAGCATGGGTGAAAAGCTAATGAAAAGAATGGGCTGAAGGAACCATTGACTCTTATTTATT
  3   1   2       chi Emb9                            IMAGE:7975686.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCAGGGGATATCGTCAGACGGGAGAGTATCCATAGCTCAAAGGAACAGAGGTAAGTGCTAATGACAGAATCTCGCAAGGAGGGAGGGGGTGTAAGGTTTCCCTGANGGCTGGACGAAGGCAAGTTTGTACCNCGGAGNCCTNNTTTNCCCACAAACGGAATNCTCNNTTGAGATAATTATTATGTTCTTCTTAGATCTCAACGCTGCCAGCCTTTAGCTGTTTTTATACTGTATTTTTTTTTTGGGTTATGCTCAGAAATGTGTTTGTAGAACAGCTGCGGGTTGGCAGGATCTAACAATAACAGGCCAATGCTTCTCTCCTGTAGCAACATTTCTATCTATACCTCTTTTTTAATACAGCTGCCTATCAGAATGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCTTAGTGGGAAAATTTGCTGAAATGTAATAGAACAATAGAACCCAGCAGCATGGGTGAAAAGCTAATGAAAAGAATGGGCGAAGGAACATGACTCTATTCTCACCCTCACCTCCNNCCCGGGG
  3   1   2       bld Ga15      in                       XL411j20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGNCAGTAATTTCACTGCCAACCNCGAGGAAGTGCTTCAAGCTGGCAAAGATAGTGCCAAATATATGGAGAAGCTTGTAAGCNCTTTCCTGCAGCGCTTGGACCTAAATAAAGNGTGATAGCNCAGGGAACAAGTTTAGGGCAAAAAGATAAATCTACTGNTATTTTAATTATTCTATTCTTCTTATATGTCAAACCTGCCAGCCTTTAGCTGTTTTTATACTGTATTTTTTTTTTGGGTTATGCTCAGAAATGTGTTTGTAGAACAGCTGCGGGTTGGCAGGATCTAACAATAACAGGCCAATGCTTCTCTACTGTAGCAACATTTCTATCTATACCTCTTTTTTAATACAGCTACCTATCAGAATGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCTGAAATGTAATAGAACAATAGAACCCAGCAGCATGGGTGAAAAGCTAATGAAAAGAATGGGCTGAAGGAACATTGACTCT
  3   1   2       bld Ga15                               XL430l07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGACAGTAATTTCNCTGCCAACCACGAGGAAGNGCTTCAAGCTGGCAAAGATAGNGCCAAATATATGGAGAAGNTTGTAAGCNCTTTCCTGCAGCGCTTGGACCTAAATAAAGTGTGATAGCACNGGGAACAAGNTTAGGGCAAAAAGATAAATCTANGGTTATTTTNANTANTCTATTNTTGNTATAAGTCAAACCTGCCAGCCTTTAGCTGTTTTTATACTGNATTTTTTTTNTGGGTTATGCTCAGAAATGTGTTTGTAGAACAGCTGCGGGTTGGCAGGATNTAACAATAACAGGCCAATGCTTCTCTACTGTAGCAACATTTCTATCTATACCTCTTTTTTAATACAGCTACCTATCAGAATGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTNTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCNGAAATGTAATAGAACAATAGAACCCAGCAGCACTGGGTGAAAAGCTAATGAAAAGAATGGGNTGAAGGAACATGACT
  5  -1   2       bld Te2N                            IMAGE:7767217.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTCACTGCCANCCACGAGGAAGTGCTTCAAGCTGGCAAAGATAGTGCCAAATATATGGAGAAGCTTGTAAGCACTTTCCTGCAGCGCTTGGACCTAAATAAAGTGTGATAGCACAGGGAACAAGTTTAGGGCAAAAAGATAAATCTACGGTTATTTTAATTATTCTATTCTTCTTATATGTCAAACCTGCCAGCCTTTAGCTGTTTTTATACTGTAttttttttttGGGTTATGCTCAGAAATGTGTTTGTAGAACAGCTGCGGGTTGGCAGGATCTAACAATAACAGGCCAATGCTTCTCTACTGTAGCAACATTTCTATCTATACCTCTTTTTTAATACAGCTACCTATCAGAATGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCTGAAATGTAATAGAACAATAGAACCCAGCAGCATGGGTGAAAAGCTAATGAAAAGAATGGGCTGAAGGAACATTGACTCTTATTTTATTTTACTTTATTAAACATTTATTACTG
  3   1   2       bld DMZ       in                         xl301e19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCNCTGCCAACCNCGAGGAAGTGCTTCNAGCTGGCAAAGATAGTGCCAAATATATGGAGAAGCTTGTAAGCACTTTCCTGCAGCGCTTGGACCTAAATAAAGTGTGATAGCACAGGGAACAAGTTTAGGGCAAAAAGATAAATCTACTGTTATTTTAATTATTCTATTCTTCTTATANGTCAAACCTGCCAGCCNTTAGCTGNTTTTATACTGTATTTTTTTTTTGGGTTATGCTCAGAAATGTGTTTGTAGAACAGCTGCGGGTTGGCAGGATCTAACAATAACAGGCCAATGCTTCTCTACTGTAGCAACATTTCTATCTATACCTCTTTTTTAATACAGCTACCTATCAGAATGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCTGAAATGTAATAGAACAATAGAACCCAGCAGCATGGGTGAAAAGCTAATGAAAAGAATGGGCTGAAGGAACCATGACTCT
  3   1   2       bld Ga15      in                       XL430j11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGCCAACCCCGNGGAAGNGNTTCAAGCTGGCAAAGATAGNGCCAAATATATGGAGAAGCTTGTAAGCACTTTCCTGCAGNGCTTGGNCCTAAATAAAGNGTGATAGCNCAGGGAACAAGNTTAGGGCAAAAAGNTAAATNTACTGGTATTTTAATTATTCTATTCTTCTTATANGTCAAACCTGCCAGCCTTTAGCTGNTTTTATACTGTATTTTTTTTTTGGGTTATGCTCAGAAATGTGTTTGTAGAACAGCTGCGGGTTGGCAGGATCTAACAATAACAGGCCAATGCTTCTCTACTGTAGCAACATTTCTATCTATACCTCTTTTTTAATACAGCTACCTATCAGAATGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCTGAAATGTAATAGAACAATAGAACCCAGCAGCATGGGTGAAAAGCTAATGAAAAGAATGGGCTGAAGGAACATTGACTCTTATTTAT
  3   1   2       bld DMZ  5g3  in                         xl257i17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTCAAGCTGGCAAAGATAGTGCCAAATATATGGAGAAGCTTGTAAGCACTTTCCTGCAGCGCTTGGACCTAAATAAAGTGTGATAGCACAGGGAACAAGTTTAGGGCAAAAAGATAAATCTACTGTTATTTTAATTATTCTATTCTTCTTATATGTCAAACCTGCCAGCCNTTAGCTGNTTTTATACNGTATTTTTTTTTTGGGTTATGCTCAGAAATGTGTTTGTAGAACAGCTGCGGGTTGGCAGGATCTAACAATAACAGGCCAATGCTTCTCTACTGTAGCAACATTTCTATCTATACCTCTTTTTTAATACAGCTACCTATCAGAATGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCTGAAATGTAATAGAACAATAGAACCCAGCAGCATGGGTGAAAAGCTAATGAAAAGAATGGGCTGAAGGAACATGACTCT
  3   1   2       bld DMZ  5g3  in                         xl336l03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAGCTGGCAAAGATAGTGCCAAATATATGGAGAAGCTTGTNAGCACTTTCCTGCAGCGCTTGGACCTAAATAAAGTGTGATAGCACAGGGAACAAGTTTAGGGCAAAAAGATAAATCTACTGTTATTTTAATTATTCTATTCTTCTTATATGTCAAACCTGCCAGCCTTTAGCTGNTTTTATACTGTATTTTTTTTTTGGGTTATGCTCAGAAATGTGTTTGTAGAACAGCTGCGGGTTGGCAGGATCTAACAATAACAGGCCAATGCTTCTCTACTGTAGCAACATTTCTATCTATACCTCTTTTTTAATACAGCTACCTATCAGAATGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCTGAAATGTAATAGAACAATAGAACCCAGCAGCATGGGTGAAAAGCTAATGAAAAGAATGGGCTGAAGGAACATGACTCT
  3   1   2       bld DMZ       in                         xl257m02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGCTGGCAAAGATAGTGCCAAATATATGGAGAAGCTTGTAAGCACTTTCCTGCAGCGCTTGGACCTAAATAAAGTGTGATAGCACAGGGAACAAGTTTAGGGCAAAAAGATAAATCTACTGTTATTTTAATTATTCTATTCTTCTTATANGTCAAACCTGCCAGCCNTTAGCTGNTTTTATACNGNATTTTTTTTTTGGGTTATGCTCAGAAATGTGTTTGTAGAACAGCTGCGGGTTGGCAGGATCTAACAATAACAGGCCAATGCTTCTCTACTGTAGCAACATTTCTATCTATACCTCTTTTTTAATACAGCTACCTATCAGAATGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCTGAAATGTAATAGAACAATAGAACCCAGCAGCATGGGTGAAAAGCTAATGAAAAGAATGGGCTGAAGGAACATGACTCT
  3   1   2       bld DMZ  5g3  in                         xl336l05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCTGGCAAAGATAGTGCCAAATATATGGAGAAGCTTGTAAGCACTTTCCTGCAGCGCTTGGACCTAAATAAAGTGTGATAGCACAGGGAACAAGTTTAGGGCAAAAAGATAAATCTACTGTTATTTTAATTATTCTATTCTTCTTATATGTCAAACCTGCCAGCCTTTAGCTGNTTTTATACNGTATTTTTTTTTTGGGTTATGCTCAGAAATGTGTTTGTAGAACAGCTGCGGGTTGGCAGGATCTAACAATAACAGGCCAATGCTTCTCTACTGTAGCAACATTTCTATCTATACCTCTTTTTTAATACAGCTACCTATCAGAATGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCTGAAATGTAATAGAACAATAGAACCCAGCAGCATGGGTGAAAAGCTAATGAAAAGAATGGGCTGAAGGAACATGACTCT
  3   1   2       bld DMZ       in                         xl314c23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCAAAGATAGTGCCAAATATATGGAGAAGCTTGTAAGCACTTTCCTGCAGCGCTTGGACCTAAATAAAGTGTGATAGCACAGGGAACAAGTTTAGGGCAAAAAGATAAATCTACTGNTATTTTAATTATTCTATTCTTCTTATATGTCAAACCTGCCAGCCTTTAGCTGNTTTTATACNGTATTTTTTTTTTGGGTTATGCTCAGAAATGTGTTTGTAGAACAGCTGCGGGTTGGCAGGATCTAACAATAACAGGCCAATGCTTCTCTACTGTAGCAACATTTCTATCTATACCTCTTTTTTAATACAGCTACCTATCAGAATGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCTGAAATGTAATAGAACAATAGAACCCAGCAGCATGGGTGAAAAGCTAATGAAAAGAATGGGCTGAAGGAACATGACTCTTATTT
  3   1   2       bld Ga15 5g3  in                       XL444j10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTAAGCACTTTCCTGCAGCGCTTGGACCTAAATAAAGNGNGNTAGCCCAGGGAACAAGTTTAGGGCAAAAAGATAAATNTACNGTTATTTTAANTATTCTATTCTTCTTATANGTCAAACCTGCCAGCCTTTAGCTGTTTTTATACTGTATTTTTTTTTTGGGTTATGCTCAGAAATGTGTTTGTAGAACAGCTGCGGGTTGGCAGGATCTAACAATAACAGGCCAATGCTTCTCTACTGTAGCAACATTTCTATCTATACCTCTTTTTTAATACAGCTACCTATCAGAATGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCTGAAATGTAATAGAACAATAGAACCCAGCAGCATGGGTGAAAAGCTAATGAAAAGAATGGGCTGAAGGAACAT
  3   1   2       bld DMZ  5g3  in                         xl267k01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGCACTTTCCTGCAGCGCTTGGACCTAAATAAAGTGTGATAGCACAGGGAACAAGTTTAGGGCAAAAAGATAAATCTACNGTTATTTTAATTATTCTATTCTTCTTATATGTCAAACCTGCCAGCCNTTAGNTGNTTTTATACTGNATTTTTTTTTTGGGTTATGCTCAGAAATGTGTTTGTAGAACAGCTGCGGGTTGGCAGGATCTAACAATAACAGGCCAATGCTTCTCTACTGTAGCAACATTTCTATCTATACCTCTTTTTTAATACAGCTACCTATCAGAATGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCTGAAATGTAATAGAACAATAGAACCCAGCAGCATGGGTGAAAAGCTAATGAAAAGAATGGGCTGAAGGAACATGACTCTATTATTACT
  3   1   2       bld Tbd7      in                         XL065e21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AATAAAGTGTGATAGCACAGGGAACAAGTTTAGGGCAAAAANATAAATCTACTGTTATTTTAATTATTCTATTCTTCTTATANGTCAAACCTGCCAGCCTTTAGCTGTTGTTANACTGNATTTTTTTTTTTGGGTTATGCTCAGAAATGTGTTTGTAGAACAGCTGCGGGTTGGCAGGATCTAACAATAACAGGCCAATGCTTCTCTACTGTAGCAACATTTCTATCTATACCTCTCTTTTAATACAGCTACCTATCAGAATGGTGCACAGGACCAGTATCTTGATCCACTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCTGAAATGTAATAGAACAATAGAACCCAGCAGCATGGGGAAAAGCTAATAAAAGAATGGGCGAAGGAACATNA
  3   1   2       bld Tbd7      in                         XL101o21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AATAAAGTGTGATAGCACAGGGAACAAGTTTAGGGCAAAAAGATAAATCTACTGTTATTTTAATTATTCTATTCTTCTTATATGTCAAACCTGCCAGCCTTTAGCTGTTTTTANACTGNATTTTTTTTTTTGGGTTATGCTCAGAAATGTGTTTGTAGAACAGCTGCGGGTTGGCAGGATCTAACAATAACAGGCCAATGCTTCTCTACTGTAGCAACATTTCTATCTATACCTCTTTTTTAATACAGCTACCTATCAGAATGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCTAAATGTACATAGAACAATAGAACCCAGCAG
  3   1   2       bld Neu7 5g3  in                         XL013l05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATAGCACAGGGAACAAGTTTAGGGCAAAAAGATAAATCTACTGTTATTTTAATTATTCTATTCTTCTTATATGTCAAACCTGCCAGCCTTTAGCTGTTTTTANACTGTATTTTTTTTTTGGGTTATGCTCAGAAATGTGTTTATAGAACAGCTGCGGGTTGGCAGGATCTAACAATAACAGGCCAATGCTTCTCTACTGTAGCAACATTTCTATCTATACCTATTTTTTAATACAGCTACCTATCAGAATGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCTGAAATGTAATAGAACAATAGAACCCAGCAGCATGGGTGAAAAGCTAATAAAAGAATGGGCGAAGGAACAT
  3   1   2       bld Ga15      in                       XL514b18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCCNGGGNACNAGTTTAGGGCAAAAAGATAAATNTACNGTTANTTTAANTATTCTANTNTTNTTANAGGNCNAACCNGCCAGCCNTTAGNTGNTGNTATACNGNATTTTTTTTTTTGGGTTATGCTCAGAAATGTGTTTGTAGAACAGCTGCGGGTTGGCAGGATCTAACAATAACAGGCCAATGCTTCTCTACTGTAGCAACATTTCTATCTATACCTCTTTTTTAATACAGCTACCTATCAGAATGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCTGAAATGTAATAGAACAATAGAACCCAGCAGCATGGGTGAAAAGCTAATGAAAAGAATGGGCTGAAGGAAC
  3   1   2       chi Ga18      in                      xlk114d24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCNNNNNTGTCAANNNNNNCANCCTTTAGCNGNTTTTANACNGNANNNNTTTTTNTNGNTNNNNNTCAGAAATGTGTTTGTAGAACAGCTGCGGGTTGGCAGGATCTAACAATAACAGGCCAATGCTTCTCTACTGTAGCAACATTTCTATCTATACCTCTTTTTTAATACAGCTACCTATCAGAATGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCTGAAATGTAATAGAACAATAGAACCCAGCAGCATGGGTGAAAAGCTAATGAAAAGAATGGGCTGAAGGAACATTGNCTCTTATTTT
  3   1   2       bld Ga15 5g3  in                       XL451k22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TATANGTCAAACCTGCCAGCCTTNAGCTGTTTTTATACNGTATTTTTTTTNTGGGTTATGCTCAGAAATGTGTTTGTAGAACAGCTGCGGGTTGGCAGGATCTAACAATAACAGGCCAATGCTTCTCTACTGTAGCAACATTTCTATCTATACCTCTTTTTTAATACAGCTACCTATCAGAATGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATNNGCTGAAATGTAATAGAACAATAGAACCCAGCA
  3   1   2       bld Ga15 5g3  in                       XL482l08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GNCAAACCTGCCNGCCNTTAGCGGGTTGTTATACCGTATTTTTTTTTGTGGGTTATGCTCAGAAATGTGTTTGTAGAACAGCTGCGGGTTGGCAGGATCTAACAATAACAGGCCAATGCTTCTNTACTGTAGCAACNTTTCTATGTATACCTCTTTNTTAATNCAGCTACCTATCAGAATGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCTGAAATGTAATAGAACAATAGAACCCAGCAGCATGGGTGAAAAGCTAATGAAAAGAATGGGCTGAAGGAACATT
  3   1   2       bld DMZ       in                         xl337l05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAAACCTGCCAGCCTTTAGCTGNTTTTATACGGNAATTTTTTTTTGGGTTATGCTCAGAAATGTGTTTGTAGAACAGCTGCGGGTTGGCAGGATCTAACAATAACAGGCCAATGCTTCTCTACTGTAGCAACATTTCTATCTATACCTCTTTTTTAANACAGCTNCCTATCAGAANGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATNTCACATTCCTNTATNTCACATTCAGTTAACATAGTNTGGTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATANGTNTATTCATACNGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAA
  3   1   2       bld Ga15      in                       XL414l17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGGTTATGCTCAGAAANGTGTTNGTAGAACAGCTGCGGGTNGGCAGGATCTAACAATAACAGGCCAATGCTTCTCTACTGTAGCAACATTTCTATNTATACCTCTTTTTTAATACAGCTACCTATCAGAATGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCTGAAATGTAATAGAACAATAGAACCCAGCAGCATGGGTGAAAAGCTAATGAAAAGAATGGGCTGAAGGAACAT
  3   1   2       bld Ga15 5g3  in                       XL511a08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TATGCTCAGAAATGTGTTTGTAGAACAGCTGCGGGTTGGCAGGATCTAACAATAACAGGCCAATGCTTCTCTACTGTAGCANCATTTNTATCTATACCTCTTTTTTAATACAGCTACCTATCAGAATGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCANTAACAAAATATCACATTCCTCTATCTCACATTCAGNTAACATAGTTTGTTGAGAAGAAACAATTGCCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCTGAAATGTAATAGAACAATAGAACCCAGCAGCATGGGTGAAAAGCTAATGAAAAGAATGGGCTGAAGGAACATT
  3   1   2       bld Ga18      in                        xlk6n14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TNAGAAANGTGTNNGNAGNACAGCTGCGGGTTGGCAGGATCTAACAATAACAGNCCAATGCTTCTCTACTGTAGCAACATTTCTATCTATACCTCTTTTTTAATACAGCTACCTATCAGAATGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCTGAAATGNAATAGAACAATAGAACCCAGCAGCATGGGTGAAAAGCTAANGAAAAGAATGGGCTGAAGGAA
  3   1   2       bld Ga18 5g3  in                      xlk164c13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ANNCCAATGCTTCTCTACTGTAGCAACATTTCTATCTATNNCTCTTTTTTAATACAGCTACCTATCAGAATGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCTGAAATGTAATAGAACAATAGAACCCAGCAGCATGGGTGAAAAGCTAANGAAAAGAATGGGCNGAAGGA
  3   1   2       bld Emb4 5g3  in                    IMAGE:4957426.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCTCTTTTTTAATACAGCTACCTATCAGAATGGTGCAAAGGACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCTGAAATGTAATAGAACAATAGAACCCAGCAGCATGGGTGAAAAGCTAATGAAAAGAATGGGCTGAAGGAACATTGACTCTTATTTTATTTTACTTTATTAAACATTTATTACTTG
  5   1   2       bld Ga15      in                       XL452h10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCTGAAATGTAATAGAACAATAGAACCCAGCAGCATGGGTGAAAAGCTAATGAAAAGAATGGGCTGAAGGAACATTGACTCTTATTTTATTTTACTTTATTAAACATTTATTACTTGACATGaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL452h10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACCAGTATCATGATCCTCTTACTGGATATGGAGCATCCATGTGTCATTCCTCACTAACAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCTGAAATGTAATAGAACAATAGAACCCAGCAGCATGGGTGAAAAGCTAATGAAAAGAATGGGCTGAAGGAACAT
  3   1   2       bld Neu7      in                         XL020o07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGGAGCATCCCATGTGTCATTCCTCACTAACAAAAATATCACATTCCTCTATCTCACATTCAGTTAACATAGTTTGTTGAGAAGAAACAATTACCATGCCAGATATTTAAAGCCTTTATTCATATGTCTATTCATACTGTAAATCAGCCAATCTCTGACATAGTAATATCATTTATTTTTTAATAATCAATTACTTAAAATGCACTGTTACATCTCCTAGTGGGAAAATTTGCTGAAATGTAATAGAACAATAGAACCCAGCAGCATGGGTGAAAAGCTAATGAAAAGAATGGGCTGAAGGAACATTGACTCTTATTTTATTTTACTTTATTAAACATTTATTACTTGACATGACACAGTTTAAGTATTTATGTTATCATTATAATTACTGGTTAAGGAAACCTATTAAACATATGCTGATAATAGGGCTCATTAACAACGATGGGACAAGGCTCTAATTGCAGAGGCTCATGGGCACAATTGGCAAGTACATGCTACTTGCTTGGCACTTGCAGATGCAACTGTTTTATTTCTATACTTTTTTCCAGGAGTGTCAGAAAGCACAAAGTGCAAGGAAACCATATTAAGGCTTAGAGTGCAGTGTACATTAGCAATTGACAGCTTCGCAATGCTTTCCATGCCACAGCCCTTAAGAGATACTGATAATCGATAATAACCTTTTTTCTATCTTTCATAACATTGTATTNAATGTCATTTATATTTNCCATAAAAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)