Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 93%

 1012837456 Xl3.1-IMAGE:6317239.5.5 - 48 ESTs
                                                                       .....-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:6317239.5.5                                                                  AAGGCAAAGATGGCGGCGCTCAGACATTTCCTACGTTCTACTCAGAAACCTCTGTGGCCTCACATCAGTCACACATGGCGCCCCGTATGCTCCTCCCCCGCGGTACAGCAGGTTGAAGTGGGCAAATTAGATGGGGCTTTTCATGTCACTATGATCCCGGGGGATGGAGTGGGACCGGAGCTCATGCACTCGGTGAAAGAGGTGTTCAAGGCAGCGGATGTGCCGGTGGAGTTTGAGGAGCATCATCTGAGTGAGGTGCAGAACATGGCGTCCAAGGAGAAGCTGGAGCAGGTCCTGGGCTCCATGCAGGCAAATAAGGTGGCAATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAGATGAGACTCAGGCGCAAGCTTGACCTGTTTGCTAACGTGGTGCATGTGAAGAGCCTCCCCGGATACAAGACCCGACACAACAATCTGGACCTGGTGATCATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCATGAGAGCGTCAGCGGAGTGATCGCGTGCCTGAAGATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCCTTTGATTATGCCACCAAGAAGGGCCGAGCCAAGGTCACGGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGACGGGCTGTTCCTGCAGTGCTGTAAGGAGGTGGCAGAGTTGTACCCCAAGATCCAGTTTGATACAATGATTATTGACAACTGCTGCATGCAGTTGGTGCAGAATCCGTACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATTGATAACCTGGCAGCTGGGCTGGTGGGGGGCGCAGGAGTGGTGCCAGGAGAGAGTTACAGTTCAGAATACGCCGTGTTTGAGACGGGCGCGCGCCACCCATTCGCACAAGCCGTGGGCAGGAATATTGCGAACCCAACTGCAATGTTACTTACTGCCACCAACATGCTGCGACATCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACAACTGACATGGGAGGTTATGCTACTTCTCTGGATTACACACAGGCCGTCATATCCAACCTCAACTGATGGCATCTGTGCCCACAACGGCTTCCTGAGGGTGTGCCAGTGTGTGCCGTGTGTTCTCCTGTGTGTCCCAGCACAATCCCTGCTCTGCCCGTAGCCCGTGCGTCTGCTTGCACTTCTTATTTATTATCTGAAGAATAATGACTGGATCCCAGCGTGTGATTGGCCAACGAGCTCCATCAGAATCTACAGGAGCCGTCTCCCCCTTCTAGCACTTTCCCACCTCCCCTCTGCATGCAATAAATACACAAATGGGGGAGAGAGAGTCCAACTCTGTTTAGTAGCCGCCATTATTCCCTGCCTGTTACTGAGCTCTTGGCACTAAAGTGGGCACATAGTTGGTCCATACTGGGTACAAGTGGTTTGAGCTCTAGTCTAGGCACAGTATTACAGCAGGCTGAAGCCCAATGTTAGAGCACTCACACATACTCACACTGCCCAACTCAGTGTCACACAAAT
                                                  Xl3.1-CHK-1012721301                                                                        AAGATGGCGGCGCTCAGACATTTCCTACGTTCTACTCAGAAACCTCTGTGGCCTCACATCAGTCACACATGGCGCCCCGTATGCTCCTCCCCCGCGGTACAGCAGGTTGAAGTGGGCAAATTAGATGGGGCTTTTCATGTCACTATGATCCCGGGGGATGGAGTGGGACCGGAGCTCATGCACTCGGTGAAAGAGGTGTTCAAGGCAGCGGATGTGCCGGTGGAGTTTGAGGAGCATCATCTGAGTGAGGTGCAGAACATGGCGTCCAAGGAGAAGCTGGAGCAGGTCCTGGGCTCCATGCAGGCAAATAAGGTGGCAATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAGATGAGACTCAGGCGCAAGCTTGACCTGTTTGCTAACGTGGTGCATGTGAAGAGCCTCCCCGGATACAAGACCCGACACAACAATCTGGACCTGGTGATCATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCATGAGAGCGTCAGCGGAGTGATCGCGTGCCTGAAGATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCCTTTGATTATGCCACCAAGAAGGGCCGAGCCAAGGTCACGGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGACGGGCTGTTCCTGCAGTGCTGTAAGGAGGTGGCAGAGTTGTACCCCAAGATCCAGTTTGATACAATGATTATTGACAACTGCTGCATGCAGTTGGTGCAGAATCCGTACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATTGATAACCTGGCAGCTGGGCTGGTGGGGGGCGCAGGAGTGGTGCCAGGAGAGAGTTACAGTTCAGAATACGCCGTGTTTGAGACGGGCGCGCGCCACCCATTCGCACAAGCCGTGGGCAGGAATATTGCGAACCCAACTGCAATGTTACTTACTGCCACCAACATGCTGCGACATCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACAACTGACATGGGAGGTTATGCTACTTCTCTGGATTACACACAGGCCGTCATATCCAACCTCAACTGATGGCATCTGTGCCCACAACGGCTTCCTGAGGGTGTGCCAGTGTGTGCCGTGTGTTCTCCTGTGTGTCCCAGCACAATCCCTGCTCTGCCCGTAGCCCGTGCGTCTGCTTGCACTTCTTATTTATTATCTGAAGAATAATGACTGGATCCCAGCGTGTGATTGGCCAACGAGCTCCATCAGAATCTACAGGAGCCGTCTCCCCCTTCTAGCACTTTCCCACCTCCCCTCTGCATGCAATAAAxxxxxAAATGGGGGAGAGAGAGTCCAACTCTGTTTAGTAGCCGCCATTATTCCCTGCCTGTTACTGAGCTCTTGGCACTAAAGTGGGCACATAGTTGGTCCATACTGGGTACAAGTGGTTTGAGCTCTAGTCTAGGCACAGTATTACAGCAGGCTGAAGCCCAATGTTAGAGCACTCACACATACTCACACTGCCCAACTCAGTGTCACACAAATAAAGAC
                                                      consensus depths                                                                       6     9    12    15    22    23    23    24    23    24    23    24    24    25    24    25    24    26    26    26    26    26    26    26    26    26    26    26    25    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    25    26    25    26    25    26    25    25    25    25    25    25    25    25    24    25    23    24    23    24    23    24    23    24    23    25    23    26    23    26    24    27    24    27    24    27    25    28    28    30    27    30    25    30    26    30    28    32    27    33    30    35    30    35    27    35    25    34    26    32    24    31    21    30    22    29    21    29    20    29    20    29    19    27    18    28    17    26    17    25    16    23    17    19    17    19    17    18    18    18    18    19    19    19    19    19    19    19    19    20    19    20    19    20    18    20    18    20    19    20    19    20    19    20    19    20    19    20    18    20    20    21    17    21    18    21    18    21    18    21    17    21    17    21    17    21    17    21    17    21    16    21    17    22    17    22    16    22    16    22    16    22    16    22    16    22    16    22    14    20    14    20    14    20    10    19     6    19     5    16     4     8     4     6     4     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     2     3
  5   1   2       e50                            Xl3.1-IMAGE:6317239.5                                                                    GGCAAAGATGGCGGCGCTCAGACATTTCCTACGTTCTACTCAGAAACCTCTGTGGCCTCACATCAGTCACACATGGCGCCCCGTATGCTCCTCCCCCGCGGTACAGCAGGTTGAAGTGGGCAAATTAGATGGGGCTTTTCATGTCACTATGATCCCGGGGGATGGAGTGGGACCGGAGCTCATGCACTCGGTGAAAGAGGTGTTCAAGGCAGCGGATGTGCCGGTGGAGTTTGAGGAGCATCATCTGAGTGAGGTGCAGAACATGGCGTCCAAGGAGAAGCTGGAGCAGGTCCTGGGCTCCATGCAGGCAAATAAGGTGGCAATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAGATGAGACTCAGGCGCAAGCTTGACCTGTTTGCTAACGTGGTGCATGTGAAGAGCCTCCCCGGATACAAGACCCGACACAACAATCTGGACCTGGTGATCATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCATGAGAGCGTCAGCGGAGTGATCGCGTGCCTGAAGATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCCTTTGATTATGCCACCAAGAAGGGCCGAGCCAAGGTCACGGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGACGGGCTGTTCCTGCAGTGCTGTAAGGAGGTGGCAGAGTTGTACCCCAAGATCCAGTTTGATACAATGATTATTGACAACTGCTGCATGCAGTTGGTGCAGAATCCGTACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATTGATAACCTGGCAGCTGGGCTGGTGGGGGGCGCAGGAGTGGTGCCAGGAGAGAGTTACAGTTCAGAATACGCCGTGTTTGAGACGGGCGCGCGCCACCCATTCGCACAAGCCGTGGGCAGGAATATTGCGAACCCAACTGCAATGTTACTTACTGCCACCAACATGCTGCGACATCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACAACTGACATGGGAGGTTATGCTACTTCTCTGGATTACACACAGGCCGTCATATCCAACCTCAACTGATGGCATCTGTGCCCACAACGGCTTCCTGAGGGTGTGCCAGTGTGTGCCGTGTGTTCTCCTGTGTGTCCCAGCACAATCCCTGCTCTGCCCGTAGCCCGTGCGTCTGCTTGCACTTCTTATTTATTATCTGAAGAATAATGACTGGATCCCAGCGTGTGATTGGCCAACGAGCTCCATCAGAATCTACAGGAGCCGTCTCCCCCTTCTAGCACTTTCCCACCTCCCCTCTGCATGCAATAAACTTGTATGTGAAG
  5   1   2       e50                            Xl3.1-IMAGE:4970064.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTGCGAACCCAACTGCAATGTTACTTACTGCCACCAACATGCTGCGACATCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGGACCCGAGATATGGGAGGTTATTCCACGACAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTCTCGCTATCCCTACTAGCACCCTTTGTGACTGTTGTGCACTATGCTTTGTGTCCCTTGTGGGGTCTTTCTCTGGCACAGTCCCTGTCTCATGTTCCATCTGACAGTTGCTTAGCAATATCTGCCAGACATTATAAGGGTTAGTGGTTACTGGCCGTCCTTGTGCCACTCCTGCTCTCAGTCTGTGTCCAGTGTAACCCATAAACTGTGTATGTGCCAGGGCTTGAGTGAGTTCTACTCTCTTATACACAAATGGGGGAGAGAGAGTCCAACTCTGTTTAGTAGCCGCCATTATTCCCTGCCTGTTACTGAGCTCTTGGCACTAAAGTGGGCACATAGTTGGTCCATACTGGGTACAAGTGGTTTGAGCTCTAGTCTAGGCACAGTATTACAGCAGGCTGAAGCCCAATGTTAGAGCACTCACACATACTCACACTGCCCAACTCAGTGTCACACAAATAAAGACTTATTTTTTTTCAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTATGACACTGCTGCATGCAGTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCATGTTCCATCTGACAGTTGCTTAGCAATATCTGCCAGACATTATAAGGGTTAGTGGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTGTCCAGTGTAACCCATAAACTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTCTACTCTCTT
                                                                   SNP                                                                                                                  T-----------
                                                                   SNP                                                                                                                                                                                                      ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----------C-
                                               BLH ATG       7     650                                                                  
                                               BLH OVR       7      53                                                                  
                                               EST CLI       0      26                                                                  
                                               ORF LNG       7       4                                                                  
  5   1   2       e50                            Xl3.1-IMAGE:6317239.5                                                                    GGCAAAGATGGCGGCGCTCAGACATTTCCTACGTTCTACTCAGAAACCTCTGTGGCCTCACATCAGTCACACATGGCGCCCCGTATGCTCCTCCCCCGCGGTACAGCAGGTTGAAGTGGGCAAATTAGATGGGGCTTTTCATGTCACTATGATCCCGGGGGATGGAGTGGGACCGGAGCTCATGCACTCGGTGAAAGAGGTGTTCAAGGCAGCGGATGTGCCGGTGGAGTTTGAGGAGCATCATCTGAGTGAGGTGCAGAACATGGCGTCCAAGGAGAAGCTGGAGCAGGTCCTGGGCTCCATGCAGGCAAATAAGGTGGCAATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAGATGAGACTCAGGCGCAAGCTTGACCTGTTTGCTAACGTGGTGCATGTGAAGAGCCTCCCCGGATACAAGACCCGACACAACAATCTGGACCTGGTGATCATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCATGAGAGCGTCAGCGGAGTGATCGCGTGCCTGAAGATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCCTTTGATTATGCCACCAAGAAGGGCCGAGCCAAGGTCACGGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGACGGGCTGTTCCTGCAGTGCTGTAAGGAGGTGGCAGAGTTGTACCCCAAGATCCAGTTTGATACAATGATTATTGACAACTGCTGCATGCAGTTGGTGCAGAATCCGTACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATTGATAACCTGGCAGCTGGGCTGGTGGGGGGCGCAGGAGTGGTGCCAGGAGAGAGTTACAGTTCAGAATACGCCGTGTTTGAGACGGGCGCGCGCCACCCATTCGCACAAGCCGTGGGCAGGAATATTGCGAACCCAACTGCAATGTTACTTACTGCCACCAACATGCTGCGACATCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACAACTGACATGGGAGGTTATGCTACTTCTCTGGATTACACACAGGCCGTCATATCCAACCTCAACTGATGGCATCTGTGCCCACAACGGCTTCCTGAGGGTGTGCCAGTGTGTGCCGTGTGTTCTCCTGTGTGTCCCAGCACAATCCCTGCTCTGCCCGTAGCCCGTGCGTCTGCTTGCACTTCTTATTTATTATCTGAAGAATAATGACTGGATCCCAGCGTGTGATTGGCCAACGAGCTCCATCAGAATCTACAGGAGCCGTCTCCCCCTTCTAGCACTTTCCCACCTCCCCTCTGCATGCAATAAACTTGTATGTGAAG
                                                  Xl3.1-CHK-1012686968                                                                          GATGGCGGCGCTCAGACATTTCCTACGTTCTACTCAGAAACCTCTGTGGCCTCACATCAGTCACACATGGCGCCCCGTATGCTCCTCCCCCGCGGTACAGCAGGTTGAAGTGGGCAAATTAGATGGGGCTTTTCATGTCACTATGATCCCGGGGGATGGAGTGGGACCGGAGCTCATGCACTCGGTGAAAGAGGTGTTCAAGGCAGCGGATGTGCCGGTGGAGTTTGAGGAGCATCATCTGAGTGAGGTGCAGAACATGGCGTCCAAGGAGAAGCTGGAGCAGGTCCTGGGCTCCATGCAGGCAAATAAGGTGGCAATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAGATGAGACTCAGGCGCAAGCTTGACCTGTTTGCTAACGTGGTGCATGTGAAGAGCCTCCCCGGATACAAGACCCGACACAACAATCTGGACCTGGTGATCATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCATGAGAGCGTCAGCGGAGTGATCGCGTGCCTGAAGATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCCTTTGATTATGCCACCAAGAAGGGCCGAGCCAAGGTCACGGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGACGGGCTGTTCCTGCAGTGCTGTAAGGAGGTGGCAGAGTTGTACCCCAAGATCCAGTTTGATACAATGATTATTGACAACTGCTGCATGCAGTTGGTGCAGAATCCGTACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATTGATAACCTGGCAGCTGGGCTGGTGGGGGGCGCAGGAGTGGTGCCAGGAGAGAGTTACAGTTCAGAATACGCCGTGTTTGAGACGGGCGCGCGCCACCCATTCGCACAAGCCGTGGGCAGGAATATTGCGAACCCAACTGCAATGTTACTTACTGCCACCAACATGCTGCGACATCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACAACTGACATGGGAGGTTATGCTACTTCTCTGGATTACACACAGGCCGTCATATCCAACCTCAACTGATGGCATCTGTGCCCACAACGGCTTCCTGAGGGTGTGCCAGTGTGTGCCGTGTGTTCTCCTGTGTGTCCCAGCACAATCCCTGCTCTGCCCGTAGCCCGTGCGTCTGCTTGCACTTCTTATTTATTATCTGAAGAATAATGACTGGATCCCAGCGTGTGATTGGCCAACGAGCTCCATCAGAATCTACAGGAGCCGTCTCCCCCTTCTAGCACTTTCCCACCTCCCCTCTGCATGCAATAAACTTGTATGxxAAxAAAAAA
  5   1   2       bld Eye1      in                    IMAGE:6948024.5p ggggtggggggggggggtagggggggTGGGCGGCGTGGGGCCGTATCAGCTGGTCCAGGTCCGGGATTCTCCGGATGGCGGCGCTCAGACATTTCCTACGTTCTACTCAGAAACCTCTGTGGCCTCACATCAGTCACACATGGCGCCCCGTATGCTCCTCCCCCGCGGTACAGCAGGTTGAAGTGGGCAAATTAGATGGGGCTTTTCATGTCACTATGATCCCGGGGGATGGAGTGGGACCTGAGCTCATGCACTCGGTGAAAGAGGTGTTCAAGGCAGCGGATGTGCCGGTGGAGTTTGAGGAGCATCATCTGAGTGAGGTGCAGAACATGGCGTCCAAGGAGAAGCTGGAGCAGGTCCTGGGCTCCATGCAGGCAAATAAGGTGGCAATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAGATGAGACTCAGGCGCAAGCTGGACCTGTTTGCTAACGTGGTGCATGTGAAGAGCCTCCCCGGATACAAGACCCGACACAACAATCTGGACCTGGTGATCATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCATGAGAGCGTCAGCGGAGTGATCGCGTGCCTGAAGATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCCTTTGATTATGCCACCAAGAAAGGCCGAGCCAAGGTCACGGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGACGGGCTGTTCCTGCAGTGCTGTAAGGAGGTGTCAGAATTGTACCCCAAGATCCAGTTTGATACCATGATTATTGACAACTGCTGCATGCAGTTGGGGCANAATCCGTACCACTTTTGATGTGGCTGGTCATGCCCCAACCTGGTATGGGCAAAAATCCATTTGATAACCCTGGACCAGCCTGGGGCCTTTGGTTgggggggggCCGCAAGAGAATTGGCTC
  5   1   2       chi Emb4      in                    IMAGE:4970064.5p                              cccacgcgtccgcggacgcgtgggtggacgcgtgggTGGGCGTTATGATGGGGGTTCTGGAAGGTGTCCTGCCTGCTATTCATAAACCTCTGTGGCCTCAATGAGTCTACATGGCGCCCCGTATGCTCCTCCCCCGCGGTACAGCAGGTTGAAGTGGGCAAATTAGATGGGGCTTTTCATGTCACTATGATCCCGGGGGATGGAGTGGGACCGGAGCTCATGCACTCGGTGAAAGAGGTGTTCAAGGCAGCGGATGTGCCGGTGGAGTTTGAGGAGCATCATCTGAGTGAGGTGCAGAACATGGCGTCCAAGGAGAAGCTGGAGCAGGTCCTGGGCTCCATGCAGGCAAATAAGGTGGCAATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAGATGAGACTCAGGCGCAAGCTTGACCTGTTTGCTAACGTGGTGCATGTGAAGAGCCTCCCCGGATACAAGACCCGACACAACAATCTGGACCTGGTGATCATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCATGAGAGCGTCAGCGGAGTGATCGCGTGCCTGAAGATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCCTTTGATTATGCCACCCACAAGGGCCGAGCCAAGGTCACGGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGACGGGCTGTTCCTGCACTGCTGTAAGGAAGTGGCAAAATTGTACCCCT
  5   1   2       bld Te1  5g                         IMAGE:6929504.5p                                    GGGTTCAACGTCACTTCCTGTCTCCTTCCAAAAGCAAAGATGGCGGCGCTCAGACATTTCCTACGTTCTACTCAGAAACCTCTGTGGCCTCACATCAGTCACACATGGCGCCCCGTATGCTCCTCCCCCGCGGTACAGCAGGTTGAAGTGGGCAAATTAGATGGGGCTTTTCCTGTCACTATGATCCCGGGGGATGGAGTGGGACCGGAGCTCATGCACTCGGTGAAAGAGGTGTTCAAGGCAGCGGATGTGCCGGTGGAGTTTGAGGAGCATCATCTGAGTGAGGTGCAGAACATGGCGTCCAAGGAGAAGCTGGAGCAGGTCCTGGGCTCCATGCAGGCAAATAAGGTGGCAATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGCCGTATGAGATGAGACTCAGGCGCAAGCTTGACCTGTTTGCTAACGTGGTGCATGTGAAGAGCCTCCCCGGATACAAGACCCGACACAACAATCTGGACCTGGTGATCATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCATGAGAGCGTCAGCGGAGTGATCGCGTGCCTGAAGATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCCTTTGAATATGCCACCAAGAAGGGGCGAGCCAAAGGTCACGGGCTGTGCACAAAGCCAATAATCATGAAGCTTGGGAGACGGGGCTTGTTCCCTGCAGTGC
  5   1   2       bld Tail 5g                         IMAGE:8543789.5p                                                      GAGTACCGATAAGAATTCGTCCCGGCGGCGCTCAGACATTTCCTACGTTCTACTCAGAAACCTCTGTGGCCTCACATCAGTCACACATGGCGCCCCGTATGCTCCTCCCCCGCGGTACAGCAGGTTGAAGTGGGCAAATTAGATGGGGCTTTTCATGTCACTATGATCCCGGGGGATGGAGTGGGACCTGAGCTCATGCACTCGGTGAAAGAGGTGTTCAAGGCAGCGGATGTGCCGGTGGAGTTTGAGGAGCATCATCTGAGTGAGGTGCAGAACATGGCGTCCAAGGAGAAGCTGGAGCAGGTCCTGGGCTCCATGCAGGCAAATAAGGTGGCAATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAGATGAGACTCAGGCGCAAGCTGGACCTGTTTGCTAACGTGGTGCATGTGAAGAGCCTCCCCGGATACAAGACCCGACACAACAATCTGGACCTGGTGATCATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCATGAGAGCGTCAGCGGAGTGATCGCGTGCCTGAAGATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCCTTTGATTATGCCACCAAGAAGGGCCGAGCCAAGGTCACGGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGACGGGCTGTTCCTGCAGTGCTGTAANGGAGTGTCAGAGTTGTACCCCAGATCCCAGTTGATACATGATTATTGACACTGCTGCTGCAGTGGTGCAGATCCGTACAGTTTGAGTGCTGTCATCCCNACTGTATGCATATCATGATACCCTGCACTGGCT
  5   1   2       bld Eye1 5g                         IMAGE:6945146.5p                                                          TCCTTCCAAAGGCAAAGATGGCGGCGCTCAGACATTTCCTACGTTCTACTCAGAAACCTCTGTGGCCTCACATCAGTCACACATGGCGCCCCGTATGCTCCTCCCCCGCGGTACAGCAGGTTGAAGTGGGCAAATTAGATGGGGCTTTTCCTGTCACTATGATCCCGGGGGATGGAGTGGGACCGGAGCTCATGCACTCGGTGAAAGAGGTGTTCAAGGCAGCGGATGTGCCGGTGGAGTTTGAGGAGCATCATCTGAGTGAGGTGCAGAACATGGCGTCCAAGGAGAAGCTGGAGCAGGTCCTGGGCTCCATGCAGGCAAATAAGGTGGCAATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAGATGAGACTCAGGCGCAAGCTTGACCTGTTTGCTAACGTGGTGCATGTGAAGAGCCTCCCCGGATACAAGACCCGACACAACAATCTGGACCTGGTGATCATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCATGAGAGCGTCAGCGGAGTGATCGCGTGCCTGAAGATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCCTTTGATTATGCCACCAAGAAGGGCCGAGCCAAAGTCACGGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGACGGGCTGTTCCTGCAGTGCTGTAAGGAGGTGGCAGAGTTGTACCCCAAGATCCAGTTTGATACCAATTGATTATTGACAAACTGCTGGCATGCAGTTTGGTGGCAAAAAATCCGGTACCCAGTTTTTGAATGTTGGCTGGGTTCAATGCCCCCAAACCTGTTATTGGGGCACAATATCCAATTTTGGAAAT
  5   1   2       chi Te2N      in                    IMAGE:7202440.5p                                                             TTCCAAAGGCAAAGATGGCGGCGCTCAGACATTTCCTACGTTCTACTCAGAAATCTCTGTGGCCTCACATCAGTCACACATGGCGCCCCGTATGCTCCTCCCCCGCGGTACAGCAGGTTGAAGTGGGCAAATTAGATGGGGCTTTTCATGTCACTATGATCCCGGGGGATGGAGTGGGACCGGAGCTCATGCACTCGGTGAAAGAGGTGTTCAAGGCAGCGGATGTGCCGGTGGAGTTTGAGGAGCATCATCTGAGTGAGGTGCAGAACATGGCGTCCAAGGAGAAGCTGGAGCAGGTCCTGGGCTCCATGCAGGCAAATAAGGTGGCAATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAGATGAGACTCAGGCGCAAGCTTGACCTGTTTGCTAACGTGGTGCATGTGAAGAGCCTCCCCGGATACAAGACCCGACACAACAATCTGGACCTGGTGATCATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCATGAGAGCGTCAGCGGAGTGATCGCGTGCCTGAAGATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCCTTTGATTATGCCACCAAGAAGGGCCGAGCCAAGGTCACGGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGACGGGCTGTTCCTGCAGTGCTGTAAGGAGGTGGCAGAGTTGTACCCCAAGATCCAGTTTGATACAATGATTATTGACAACTGCTGCATGCAGTTGGTGCAGAATCCGTTACATTTTGATGTGCTGGTCTTGCCCAACCTGTATGGCAAAAATTATTGATAACCTGGGCGCTTggggcgggtggggggggggCAAGGAAGGGGTCCCCGGAAAAAAAT
  5   1   2       bld Spl  5g                         IMAGE:8460418.5p                                                             CTTCCAAGGCAAAGATGGCGGCGCTCAGACATTTCCTACGTTCTACTCAGAAACCTCTGTGGCCTCACATCAGTCACACATGGCGCCCCGTATGCTCCTCCCCCGCGGTACAGCAGGTTGAAGTGGGCAAATTAGATGGGGCTTTTCATGTCACTATGATCCCGGGGGATGGAGTGGGACCGGAGCTCATGCACTCGGTGAAAGAGGTGTTCAAGGCAGCGGATGTGCCGGTGGAGTTTGAGGAGCATCATCTGAGTGAGGTGCAGAACATGGCGTCCAAGGAGAAGCTGGAGCAGGTCCTGGGCTCCATGCAGGCAAATAAGGTGGCAATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAGATGAGACTCAGGCGCAAGCTTGACCTGTTTGCTAACGTGGTGCATGTGAAGAGCCTCCCCGGATACAAGACCCGACACAACAATCTGGACCTGGTGATCATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCATGAGAGCGTCAGCGGAGTGATCGCGTGCCTGAAGATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCCTTTGATTATGCCACCAAGAAGGGCCGAGCCAAGGTCACGGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGACGGGCTGTTCCTGCAGTGCTGTAGGAGGTGGCAGAGTGTACCCNAGATCAGTTGATACATGATTATGACACTGCTGCATGCAGTGGTGCAGATCGTACAGTTGATTGCTGTCATGCCACTGATGCATACATGATACTGCACTGGTGTGGGGCCAGATGTGCAGAAAGTAGTCAATACCTGTT
  5   1   2       bld He1  5g3  in                    IMAGE:4408522.5p                                                                 AAAGGCAAAGATGGCGGCGCTCAGACATTTCCTACGTTCTACTCAGAAACCTCTGTGGCCTCACATCAGTCACACATGGCGCCCCGTATGCTCCTCCCCCGCGGTACAGCAGGTTGAAGTGGGCAAATTAGATGGGGCTTTTCATGTCACTATGATCCCGGGGGATGGAGTGGGACCGGAGCTCATGCACTCGGTGAAAGAGGTGTTCAAGGCAGCGGATGTGCCGGTGGAGTTTGAGGAGCATCATCTGAGTGAGGTGCAGAACATGGCGTCCAAGGAGAAGCTGGAGCAGGTCCTGGGCTCCATGCAGGCAAATAAGGTGGCAATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAGATGAGACTCAGGCGCAAGCTTGACCTGTTTGCTAACGTGGTGCATGTGAAGAGCCTCCCCGGATACAAGACCCGACACAACAATCTGGACCTGGTGATCATTCGGGAGCAGACGGAGGGA
  5   1   2      seed Ov1  5g                         IMAGE:6317239.5p                                                                 AAAGGCAAAGATGGCGGCGCTCAGACATTTCCTACGTTCTACTCAGAAATCTCTGTGGCCTCACATCAGTCACACATGGCGCCCCGTATGCTCCTCCCCCGCGGTACAGCAGGTTGAAGTGGGCAAATTAGATGGGGCTTTTCATGTCACTATGATCCCGGGGGATGGAGTGGGACCGGAGCTCATGCACTCGGTGAAAGAGGTGTTCAAGGCAGCGGATGTGCCGGTGGAGTTTGAGGAGCATCATCTGAGTGAGGTGCAGAACATGGCGTCCAAGGAGAAGCTGGAGCAGGTCCTGGGCTCCATGCAGGCAAATAAGGTGGCAATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAGATGAGACTCAGGCGCAAGCTTGACCTGTTTGCTAACGTGGTGCATGTGAAGAGCCTCCCCGGATACAAGACCCGACACAACAATCTGGACCTGGTGATCATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCATGAGAGCGTCAGCGGAGTGATCGCGTGCCTGAAGATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCCTTTGATTATGCCACCAAGAAGGGCCGAGCCAAGGTCACGGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGACGGGCTGTTCCTGCAGTGCTGTAAGGAGGTGGCAGAGTTGTACCCCAAGATCCAGTTTGATACAATGATTATTGACAACTGCTGCATGCAGTTGGTGCAGAATCCGTACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATTGATAACCTGGCAGCTGGG
  5   1   2       bld Tbd7      in                         XL062g03.5p                                                                    GCAAAGATGGCGGCGCTCAGNACATTTCCTACGTTCTACTCAGAAATCTCTGTGGCCTCACATCAGTCACACATGGCGCCCCGTATGCTCCTCCCCCGCGGTACAGCAGGTTGAAGTGGGCAAATTAGATGGGGCTTTTCATGTCACTATGATCCCGGGGGATGGAGTGGGACCGGAGCTCATGCACTCGGTGAAAGAGGTGTTCAAGGCAGCGGATGTGCCGGTGGAGTATGAGGAGCATCATCTGAGTGAGGTGCAGAACATGGCGTCCAAGGAGAAGCTGGAGCAGGTCCTGGGCTCCATGCAGGCAAATAAGGTGGCAATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACCTGGCGTCGTATGAGATGAGACTCAGGCGCAAGCTTGACC
  5   1   2       bld Te2  5g3  in                    IMAGE:7389909.5p                                                                     GCAAAGATGGCGGCGCTCAGACATTTCCTACGTTCTACTCAGAAACCTCTGTGGCCTCACATCAGTCACACATGGCGCCCCGTATGCTCCTCCCCCGCGGTACAGCAGGTTGAAGTGGGCAAATTAGATGGGGCTTTTCCTGTCACTATGATCCCGGGGGATGGAGTGGGACCGGAGCTCATGCACTCGGTGAAAGAGGTGTTCAAGGCAGCGGATGTGCCGGTGGAGTTTGAGGAGCATCATCTGAGTGAGGTGCAGAACATGGCGTCCAAGGAGAAGCTGGAGCAGGTCCTGGGCTCCATGCAGGCAAATAAGGTGGCAATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAGATGAGACTCAGGCGCAAGCTTGACCTGTTTGCTAACGTGGTGCATGTGAAGAGCCTCCCCGGATACAAGACCCGACACAACAATCTGGACCTGGTGATCATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCATGAGAGCGTCAGCGGAGTGATCGCGTGCCTGAAGATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCCTTTGATTATGCCACCAAGAAGGGCCGAGCCAAGGTCACGGCTGTGCACAAAGCCAATATCATGAAGCTGGG
  5   1   2       bld Tail 5g3  in                    IMAGE:8543189.5p                                                                      CAAAGATGGCAGCGCTCAGACATTTCCTACGTTCTACTCAGAAACCTCTGTGGCCTCACATCAGTCACACATGGCGCCCCGTATGCTCCTCCCCCGCGGTACAGCAGGTTGAAGTGGGCAAATTAGATGGGGCTTTTCATGTCACTATGATCCCGGGGGATGGAGTAGGACCGGAGCTCATGCACTCGGTGAAAGAGGTGTTCAAGGCAGCGGATGTGCCGGTGGAGTTTGAGGAGCATCATCTGAGTGAGGTGCAGAACATGGCGTCCAAGGAGAAGCTGGAGCAGGTCCTGGGCTCCATGCAGGCAAATAAGGTGGCAATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAGATGAGACTCAGGCGCAAGCTGGACCTGTTTGCTAACGTGGTGCATGTGAAGAGCCTCCCCGGATACAAGACCCGACACAACAATCTGGACCTGGTGATCATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCATGAGAGCGTCAGCGGAGTGATCGCGTGCCTGAAGATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCCTTTGATTATGCCACCAAGAAGGGCCGAGCCAAGGTCACGGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGACGGGCTGTTCCTGCAGTGCTGTAAGGAGTGTCAGAGTGTACCCCAGATCCAGTGATACATGATTATGACACTGCTGCATGCAGTGGTGCAGATCGTACAGTTGATTGCTGTCATGCCACTGTATGCATTCATGATACTGCACTGGCTGTGG
  5   1   2       bld Tbd3                   IMAGE:3549745-IMAGp.IMAGp                                                                        TGGGAATTCCCCCGGGGGAATTTCCTACGTTCTACTCAGAAACCTCTGTGGCCTCACATCAGTCACACATGGCGCCCCGTATACTCCTCCCCCGCGGTACAGCAGGTTGAAGTGGGCAAATTAGATGGGGCTTTTCATGTCACTATGATCCCGGGGGATGGAGTGGGACCGGAGCTCATGCACTCGGTGAAAGAGGTGTTCAAGGCAGCGGATGTGCCGGTGGAGTTTGAGGAGCATCATCTGAGTGAGGTGCAGAACATGGCGTCCAAGGAGAAGCTGGAGCAGGTCCTGGGCTCCATGCAGGCAAATAAGGTGGCAATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAGATGAGACTCAGGCGCAAGCTGGACCTGTTTGCTAACGTGGTGCATGTGAAGAGCCTCCCCGGATACAAGACCCGACACAACAATCTGGACCTGGTGATCATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCATGAGAGCGTCAGCGGAGTGATCGCGTGCCTGAAGATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCCTTTGATTATGCCACCAAGAAGGGCCGAGCCAAGGTCACGGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGACGGGCTGTTCCTGCAGTGCTGTAAGGAGGTGTCAGAGTTGTACCCCAAGATCCAGTTTGATACAATGATTATTGACAACTGCTGCATGCAGTTGGTGCAGAATCCGTACCAGTTTGATGTGCTGGTCATGCCCCAAACCTGTATGGCAATATCATTGATAACCTGGCACCTGGGCTGGTGGGGGGCGCAG
  5   1   2       bld Em10                            IMAGE:8318417.5p                                                                            TGGCGGCGCTCAGACATTTCCTACGTTCTACTCAGAAACCTCTGTGGCCTCACATCAGTCACACATGGCGCCCCGTATGCTCCTCCCCCGCGGTACAGCAGGTTGAAGTGGGCAAATTAGATGGGGCTTTTCATGTCACTATGATCCCGGGGGATGGAGTGGGACCGGAGCTCATGCACTCGGTGAAAGAGGTGTTCAAGGCAGCGGATGTGCCGGTGGAGTTTGAGGAGCATCATCTGAGTGAGGTGCAGAACATGGCGTCCAAGGAGAAGCTGGAGCAGGTCCTGGGCTCCATGCAGGCAAATAAGGTGGCAATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAGATGAGACTCAGGCGCAAGCTTGACCTGTTTGCTAACGTGGTGCATGTGAAGAGCCTCCCCGGATACAAGACCCGACACAACAATCTGGACCTGGTGATCATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCATGAGAGCGTCAGCGGAGTGATCGCGTGCCTGAAGATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCCTTTGATTATGCCACCAAGAAGGGCCGAGCCAAGGTCACGGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGACGGGCTGTTCCTGCAGTGCTGTAAGGAGGTGGCAGAGTTGTACCC
  5   1   2       bld Te2                             IMAGE:7209691.5p                                                                              GCGGCGCTCAGACATTTCCTACGTTCTACTCAGAAATCTCTGTGGCCTCACATCAGTCACACATGGCGCCCCGTATGCTCCTCCCCCGCGGTACAGCAGGTTGAAGTGGGCAAATTAGATGGGGCTTTTCATGTCACTATGATCCCGGGGGATGGAGTGGGACCGGAGCTCATGCACTCGGTGAAAGAGGTGTTCAAGGCAGCGGATGTGCCGGTGGAGTTTGAGGAGCATCATCTGAGTGAGGTGCAGAACATGGCGTCCAAGGAGAAGCTGGAGCAGGTCCTGGGCTCCATGCAGGCAAATAAGGTGGCAATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAGATGAGACTCAGGCGCAAGCTTGACCTGTTTGCTAACGTGGTGCATGTGAAGAGCCTCCCCGGATACAAGACCCGACACAACAATCTGGACCTGGTGATCATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCATGAGAGCGTCAGCGGAGTGATCGCGTGCCTGAAGATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCCTTTGATTATGCCACCAAGAAGGGCCGAGCCAAGGTCACGGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGACGGGCTGTTCCTGCAGTGCTGTAAGGAGGTGGCAGAGTTGTACCCCCAGATCCAGTT
  5   1   2       bld Int2                            IMAGE:8527386.5p                                                                               CGGCGCTCAGACATTTCCTACGTTCTACTCAGAAACCTCTGTGGCCTCACATCAGTCACACATGGCGCCCCGTATGCTCCTCCCCCGCGGTACAGCAGGTTGAAGTGGGCAAATTAGATGGGGCTTTTCCTGTCACTATGATCCCGGGGGATGGAGTGGGACCGGAGCTCATGCACTCGGTGAAAGAGGTGTTCAAGGCAGCGGATGTGCCGGTGGAGTTTGAGGAGCATCATCTGAGTGAGGTGCAGAACATGGCGTCCAAGGAGAAGCTGGAGCAGGTCCTGGGCTCCATGCAGGCAAATAAGGTGGCAATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAGATGAGACTCAGGCGCAAGCTTGACCTGTTTGCTAACGTGGTGCATGTGAAGAGCCTCCCCGGATACAAGACCCGACACAACAATCTGGACCTGGTGATCATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCATGAGAGCGTCAGCGGAGTGATCGCGTGCCTGAAGATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCCTTTGATTATGCCACCAAGAAGGGCCGAGCCAAGGTCACGGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGACGGGCTGTTCCTGCAGTGCTGTAAGGAGGTGGCAGAGTTGTACCCCAAGATCCAG
  5   1   2       bld Ooc3                            IMAGE:3473064.5p                                                                                GGCGCTCAGACATTTCCTACGTTCTACTCAGAAACCTCTGTGGCCTCACATCAGTCACACATGGCGCCCCGTATGCTCCTCCCCCGCGGTACAGCAGGTTGAAGTGGGCAAATTAGATGGGGCTTTTCCTGTCACTATGATCCCGGGGGATGGAGTGGGACCGGAGCTCATGCACTCGGTGAAAGAGGTGTTCAAGGCAGCGGATGTGCCGGTGGAGTTTGAGGAGCATCATCTGAGTGAGGTGCAGAACATGGCGTCCAAGGAGAAGCTGGAGCAGGTCCTGGGCTCCATGCANGCAAATAAAGTGGCAATTAAAGGGGAGAATCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAGATGAGACTCAGGCGCAAGCTTGACCTGTTTGCTAACGTGGTGCATGTGAAGAGCCTCCCCGGATACAGAACC
  5   1   2       bld Te2N      in                    IMAGE:7202165.5p                                                                                GGCGCTCAGACATTTCCTACGTTCTACTCAGAAACCTCTGTGGCCTCACATCAGTCACACATGGCGCCCCGTATGCTCCTCCCCCGCGGTACAGCAGGTTGAAGTGGGCAAATTAGATGGGGCTTTTCCTGTCACTATGATCCCGGGGGATGGAGTGGGACCGGAGCTCATGCACTCGGTGAAAGAGGTGTTCAAGGCAGCGGATGTGCCGGTGGAGTTTGAGGAGCATCATCTGAGTGAGGTGCAGAACATGGCGTCCAAGGAGAAGCTGGAGCAGGTCCTGGGCTCCATGCAGGCAAATAAGGTGGCAATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAGATGAGACTCAGGCGCAAGCTTGACCTGTTTGCTAACGTGGTGCATGTGAAGAGCCTCCCCGGATACAAGACCCGACACAACAATCTGGACCTGGTGATCATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCATGAGAGCGTCAGCGGAGTGATCGCGTGCCTGAAGATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCCTTTGATTATGCCACCAAGAAGGGCCGAGCCAAGGTCACAGCTGTGCACAAAGCCAATATTATGAAGCTGGGAGACGGGCTGTTCCTGCAGTGCTGTAACGAGGTGGCAGAGTTGTACCCCAAGATCCAGTTAGATACAATGATTATTGACAACTGCTGCATGCAGTTGGTGCAGAATCCGTACCAGTTTGATGTGCTGGTCAG
  5   1   2       bld Te2N                            IMAGE:7768696.5p                                                                                 GCGCTCAGACATTTCCTACGTTCTACTCAGAAATCTCTGTGGCCTCACATCAGTCACACATGGCGCCCCGTATGCTCCTCCCCCGCGGTACAGCAGGTTGAAGTGGGCAAATTAGATGGGGCTTTTCATGTCACTATGATCCCGGGGGATGGAGTGGGACCGGAGCTCATGCACTCGGTGAAAGAGGTGTTCAAGGCAGCGGATGTGCCGGTGGAGTTTGAGGAGCATCATCTGAGTGAGGTGCAGAACATGGCGTCCAAGGAGAAGCTGGAGCAGGTCCTGGGCTCCATGCAGGCAAATAAGGTGGCAATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAGATGAGACTCAGGCGCAAGCTTGACCTGTTTGCTAACGTGGTGCATGTGAAGAGCCTCCCCGGATACAAGACCCGACACAACAATCTGGACCTGGTGATCATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCATGAGAGCGTCAGCGGAGTGATCGCGTGCCTGAAGATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCCTTTGATTATGCCACCAAGAAGGGCCGAGCCAAGGTCACGGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGACGGGCTGTTCCTGCAGTGCTGTAGGAGGTGGCAGATTGTACCCCAGATCAGTTGATACATGATTATGACACTGCTGCATGCAGTGTGCAGATCGTACAGTTGAGTGCTGTCATGCCACTGATGCATATCTGATACTGCACTGGCTGTGGGGCCAGATGTGCAGAAATACGTCAATACCGTGACGCGCCGCC
  5   1   2       bld Thy       in                    IMAGE:8550336.5p                                                                                 GCGCTCAGACATTTCCTACGTTCTACTCAGAAACCTCTGTGGCCTCACATCAGTCACACATGGCGCCCCGTATGCTCCTCCCCCGCGGTACAGCAGGTTGAAGTGGGCAAATTAGATGGGGCTTTTCCTGTCACTATGATCCCGGGGGATGGAGTGGGACCGGAGCTCATGCACTCGGTGAAAGAGGTGTTCAAGGCAGCGGATGTGCCGGTGGAGTTTGAGGAGCATCATCTGAGTGAGGTGCAGAACATGGCGTCCAAGGAGAAGCTGGAGCAGGTCCTGGGCTCCATGCAGGCAAATAAGGTGGCAATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAGATGAGACTCAGGCGCAAGCTTGACCTGTTTGCTAACGTGGTGCATGTGAAGAGCCTCCCCGGATACAAGACCCGACACAACAATCTGGACCTGGTGATCATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCATGAGAGCGTCAGCGGAGTGATCGCGTGCCTGAAGATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCCTTTGATTATGCCACCAAGAAGGGCCGAGCCAAGGTCACGGCTGTGCACAAGCCAATATCATGAAGCTGGGAGACGGGCTGTTCCTGCAGTGCTGTAAAGAGGTGCAGAGTGTCCCCAAGATCAGTTGATACAATGATATGACACTGCTGCATGCATTGGTGCAAATCGTACAGTTGATTGCTGTCATGCCACTGATGCATTCATGATACTGCACTGGCTGTGGGGCCAGA
  5   1   2       bld Lmb1                            IMAGE:8533083.5p                                                                                  CGCTCAGACATTTCCTACGTTCTACTCAGAAACCTCTGTGGCCTCACATCAGTCACACATGGCGCCCCGTATGCTCCTCCCCCGCGGTACAGCAGGTTGAAGTGGGCAAATTAGATGGGGCTTTTCATGTCACTATGATCCCGGGGGATGGAGTGGGACCGGAGCTCATGCACTCGGTGAAAGAGGTGTTCAAGGCAGCGGATGTGCCGGTGGAGTTTGAGGAGCATCATCTGAGTGAGGTGCAGAACATGGCGTCCAAGGAGAAGCTGGAGCAGGTCCTGGGCTCCATGCAGGCAAATAAGGTGGCAATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAGATGAGACTCAGGCGCAAGCTTGACCTGTTTGCTAACGTGGTGCATGTGAAGAGCCTCCCCGGATACAAGACCCGACACAACAATCTGGACCTGGTGATCATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCATGAGAGCGTCAGCGGAGTGATCGCGTGCCTGAAGATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCCTTTGATTATGCCACCAAGAAGGGCCGAGCCAAGGTCACGGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGACNGGCTGTTCCTGCAGTGCTGTAAGGAGGTGGCAGAGTTGTACCCCAGATCCAGTTGATACATGATTATGACACTGCTGCATGCAGTGGTGCAGATCCGTACAGTTGATGGCTGTCATGCCACTG
  5   1   2       bld FaB       in                    IMAGE:8070213.5p                                                                                        GACATTTCCTACGTTCTACTCAGAAACCTCTGTGGCCTCACATCAGTCACACATGGCGCCCCGTATGCTCCTCCCCCGCGGTACAGCAGGTTGAAGTGGGCAAATTAGATGGGGCTTTTCCTGTCACTATGATCCCGGGGGATGGAGTGGGACCGGAGCTCATGCACTCGGTGAAAGAGGTGTTCAAGGCAGCGGATGTGCCGGTGGAGTTTGAGGAGCATCATCTGAGTGAGGTGCAGAACATGGCGTCCAAGGAGAAGCTGGAGCAGGTCCTGGGCTCCATGCAGGCAAATAAGGTGGCAATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAGATGAGACTCAGGCGCAAGCTTGACCTGTTTGCTAACGTGGTGCATGTGAAGAGCCTCCCCGGATACAAGACCCGACACAACAATCTGGACCTGGTGATCATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCATGAGAGCGTCAGCGGAGTGATCGCGTGCCTGAAGATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCCTTTGATTATGCCACCAAGAAGGGCCGAGCCAAGGTCACGGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGACGGGCTGTTCCTGCAGTGCTGTAAGGAGGTGGCAGAGTTGTACCCCAAGATCCAGTTTGATACA
  5   1   2       bld Kid                             IMAGE:7010154.5p                                                                                          CATTTCCTACGTTCTACTCAGAAACCTCTGTGGCCTCACATCAGTCACACATGGCGCCCCGTATGCTCCTCCCCCGCGGTACAGCAGGTTGAAGTGGGCAAATTAGATGGGGCTTTTCATGTCACTATGATCCCGGGGGATGGAGTGGGACCGGAGCTCATGCACTCGGTGAAAGAGGTGTTCAAGGCAGCGGATGTGCCGGTGGAGTTTGAGGAGCATCATCTGAGTGAGGTGCAGAACATGGCGTCCAAGGAGAAGCTGGAGCAGGTCCTGGGCTCCATGCAGGCAAATAAGGTGGCAATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAGATGAGACTCAGGCGCAAGCTGGACCTGTTTGCTAACGTGGTGCATGTGAAGAGCCTCCCCGGATACAAGACCCGACACAACAATCTGGACCTGGTGATCATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCATGAGAGCGTCAGCGGAGTGATCGCGTGCCTGAAGATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCCTTTGATTATGCCACCAAGAAGGGCCGAGCCAAGGTCACGGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGACGGGCTGTTCCTGCAGTGCTGTAAGGAGGTGTCAGAGTTGTACCCCAAGATCCAGTTTGATANCATGATTATT
  5   1   2       bld Ov1       in                    IMAGE:8328487.5p                                                                                           ATTTCCTACGTTCTACTCAGAAATCTCTGTGGCCTCACATCAGTCACACATGGCGCCCCGTATGCTCCTCCCCCGCGGTACAGCAGGTTGAAGTGGGCAAATTAGATGGGGCTTTTCATGTCACTATGATCCCGGGGGATGGAGTGGGACCGGAGCTCATGCACTCGGTGAAAGAGGTGTTCAAGGCAGCGGATGTGCCGGTGGAGTTTGAGGAGCATCATCTGAGTGAGGTGCAGAACATGGCGTCCAAGGAGAAGCTGGAGCAGGTCCTGGGCTCCATGCAGGCAAATAAGGTGGCAATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAGATGAGACTCAGGCGCAAGCTTGACCTGTTTGCTAACGTGGTGCATGTGAAGAGCCTCCCCGGATACAAGACCCGACACAACAATCTGGACCTGGTGATCATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCATGAGAGCGTCAGCGGAGTGATCGCGTGCCTGAAGATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCCTTTGATTATGCCACCAAGAAGGGCCGAGCCAAGGTCACGGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGACCGGCTGTTCCTGCAGTGCTGTAAAGAGGTGGCAGAATTGTACCCCAAGATCCAGTTTGATACAATGATTATTGACAACTGC
  5   1   2       bld Te2N      in                    IMAGE:7764767.5p                                                                                                                                   GTACTGTGAGCCACTGATGAGCTGCTGTCTGTTTCTTCCCCCACAGGTTGAAGTGGGCAAATTAGATGGGGCTTTTCATGTCACTATGATCCCGGGGGATGGAGTGGGACCGGAGCTCATGCACTCGGTGAAAGAGGTGTTCAAGGCAGCGGATGTGCCGGTGGAGTTTGAGGAGCATCATCTGAGTGAGGTGCAGAACATGGCGTCCAAGGAGAAGCTGGAGCAGGTCCTGGGCTCCATGCAGGCAAATAAGGTGGCAATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAGATGAGACTCAGGCGCAAGCTTGACCTGTTTGCTAACGTGGTGCATGTGAAGAGCCTCCCCGGATACAAGACCCGACACAACAATCT
  5   1   2       bld Te2                             IMAGE:7393876.5p                                                                                                                                                         CTGCTGCTGTTTCTTCCCCCACAGGTTGAAGTGGGCAAATTAGATGGGGCTTTTCATGTCACTATGATCCCGGGGGATGGAGTGGGACCGGAGCTCATGCACTCGGTGAAAGAGGTGTTCAAGGCAGCGGATGTGCCGGTGGAGTTTGAGGAGCATCATCTGAGTGAGGTGCAGAACATGGCGTCCAAGGAGAAGCTGGAGCAGGTCCTGGGCTCCATGCAGGCAAATAAGGTGGCAATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAGATGAGACTCAGGCGCAAGCTTGACCTGTTTGCTAACGTGGTGCATGTGAAGAGCCTCCCCGGATACAAGACCCGACACAACAATCTGGACCTGGTGATCATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCATGAGAGCGTCAGCGGAGTGATCGCGTGCCTGAAGATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCCTTTGATTATGCCACCAAGAAGGGCCGAGCCAAGGTCACGGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGACGGGCTGTTCCTGCAGTGCTGTAAGGAGGTGGCAGAGTTGTACCCCAAGATCCAGTTTGAACAATGATTATTGCAACTGCTGCATGCATTGGTGCAGATCCGTACAGTTTGATGTGCTGTCATGCCCAACTGTATGCATATCATGATACCTGCACTGGGCTGTGGGGGCGCAGAGTGG
  3   1   2       bld Tail 5g3  in                    IMAGE:8543189.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTGCTCCCTGATACCAAGACGGAACACAACATTCGGAACTGTGATCATCGGAGCAGACCGAGGAGAGTACAGCTCTCTGAGCATGAGAGCGTCAGCGGAGTGATCGCGTGCTGAGATCATAACCAGAGAGAAGTCCACGCATGCAAGTTTGCCTTTGATTATGCCACCAAGAAGGGCCGAGCCAAGGTCACGGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGACGGGCTGTTCCTGCAGTGCTGTAAGGAGGTGTCAGAGTTGTACCCCAAGATCCAGTTTGATACAATGATTATTGACAACTGCTGCATGCAGTTGGTGCAGAATCCGTACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATTGATAACCTGGCAGCTGGGCTGGTGGGGGGCGCAGGAGTGGTGCCAGGAGAGAGTTACAGTTCAGAATACGCCGTGTTTGAGACAGGCGCGCGCCACCCATTCGCACAAGCCGTGGGCAGGAATATTGCGAACCCAACTGCAATGTTACTTACTGCCACCAACATGCTGCGACATCTCAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACAACTGACATGGGAGGTTATGCCACTTCTCTGGATTACACACAGGCCGTCATATCCAACCTCAACTGATCTGGGCATCTGTGCCCACAACGGCTTCCTGAGGGTGTGCCAGTGTGTGCCGTGTGTTCTCCTGTGTGTCCCAGCACAATCCCTGCTCTGCCCGTAGCCCGTGCGTCTGCTTGCACTTCTTATTTATTATCTGAAGAATAATGACTGGATCCCAGCGTGTGATTGGCCAACGAGCTCCATCGGAATCTACAGGAGCCGTCTCCCCCTTCTAGCACTTCCCACCTCCCTCGCAGCAAAAAAA
  3   1   2       bld Eye1      in                    IMAGE:6948024.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCATGAGAGCGTCAGCGGAGTGATCGCGTGCCTGAAGATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCCTTTGATTATGCCACCAAGAAGGGCCGAGCCAAGGTCACGGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGACGGGCTGTTCCTGCAGTGCTGTAAGGAGGTGTCAGAGTTGTACCCCAAGATCCAGTTTGATACAATGATTATTGACAACTGCTGCATGCAGTTGGTGCAGAATCCGTACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATTGATAACCTGGCAGCTGGGCTGGTGGGGGGCGCAGGAGTGGTGCCAGGAGAGAGTTACAGTTCAGAATACGCCGTGTTTGAGACGGGCGCGCGCCACCCATTCGCACAAGCCGTGGGCAGGAATATTGCGAACCCAACTGCAATGTTACTTACTGCCACCAACATGCTGCGACATCTCAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACAACTGACATGGGAGGTTATGCTACTTCTCTGGATTACACACAGGCTGTCATATCCAACCTCAACTGATGGCATCTGTGCCCACAACGGCTTCCTGAGGGTGTGCCAGTGTGTGCCGTGTGTTCTCCTGTGTGTCCCAGCACAATCCCTGCTCTGCCCGTAGCCCGTGCGTCTGCTTGCACTTCTTATTTATTATCTGAAGAATAATGACTGGATCCCAGCGTGTGATTGGCCAACGAGCTCCATCGGAATCTACAGGAGCCGTCTCCCCCTTCAAGCA
  3   1   2       bld Te2  5g3  in                    IMAGE:7389909.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCTGTATGCTGAGCTCGATCAGCGACACATTGCTGTTCTCGGCGCGAGAGTCACTTTGACAGAAGTCGCGAGGTGCTGCTGAGTCATACAGGAGAGTCACGNCATGCCAGTTGCCTTGATAGCCACCAGAAGGGCGAGCCAGGTCACGGCTTGCACAAGCCAATATCAGAAGTGGGAGACGGGCTGTCCTGCAGTGCTGTAAGGAGGTGGCAGAGTTGTACCCCAAGATCCAGTTTGATACAATGATTATTGACAACTGCTGCATGCAGTTGGTGCAGAATCCGTACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATTGATAACCTGGCAGCTGGGCTGGTGGGGGGCGCAGGAGTGGTGCCAGGAGAGAGTTACAGTTCAGAATACGCCGTGTTTGAGACGGGCGCGCGCCACCCATTCGCACAAGCCGTGGGCAGGAATATTGCGAACCCAACTGCAATGTTACTTACTGCCACCAACATGCTGCGACATCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACAACTGACATGGGAGGTTATGCTACTTCTCTGGATTACACACAGGCTGTCATATCCAACCTCAACTGATGGCATCTGTGCCCACAACGGCTTCCTGAGGGTGTGCCAGTGTGTGCCGTGTGTTCTCCTGTGTGTCCCAGCACAATCCCTGCTCTGCCCGTAGCCCGTGCGTCTGCTTGCACTTCTTATTTATTATCTGAAGAATAATGACTGGATCCCAGCGTGTGATTGGCCAACGAGCTCCATCAGAATCTACAGGAGCCGTCTCCCCCTTCTAGCACTTCCCACCTCCCCTTGCAGCAAACGG
  3   1   2       bld Thy       in                    IMAGE:8550336.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCCACATCGACTGGTCTCGACGACGAGAGATCAGTTTGAGCAGGAGCTAGCGAGGACGGTGCTGAGATATACAGGAGAGTCACGCATGCCAAGTTGCCTTGATATGCACAGAAAAGGCGAGCCCAGGTCACGCTGTGCACAAGCCAATATCATGAGCTGGGAGACGGGCTGTTCCTGCAGTGCTGTAAGGAGGTGGCAGAGTTGTACCCCAAGATCCAGTTTGATACAATGATTATTGACAACTGCTGCATGCAGTTGGTGCAGAATCCGTACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATTGATAACCTGGCAGCTGGGCTGGTGGGGGGCGCAGGAGTGGTGCCAGGAGAGAGTTACAGTTCAGAATACGCCGTGTTTGAGACGGGCGCGCGCCACCCATTCGCACAAGCCGTGGGCAGGAATATTGCGAACCCAACTGCAATGTTACTTTCTGCCACCAACATGCTGCGACATCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACAACTGACATGGGAGGTTATGCTACTTCTCTGGATTACACACAGGCTGTCATATCCAACCTCAACTGATGGCATCTGTGCCCACAACGGCTTCCTGAGGGTGTGCCAGTGTGTGCCGTGTGTTCTCCTGTGTGTCCTAGCACAATCCCTGCTCTGCCCGTAGCCCGTGCGTCTGCTTGCACTTCTTATTTATTATCTGAAGAATAATGACTGGATCCCAGCGTGTGATTGGCCAACGAGCTCCATCGGAATCTACAGGAGCCGTCTCCCCCTTCTAGCACTTCCCACCTCCCCTNGCAGCATAACGAGGG
  3   1   2       bld Te2                             IMAGE:7207921.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGATCGCGTGCCTGAAGATCATATCCAGAGAGAAGTCCACCCGCATTGCCAAGTTTGCCTTTGATTATGCCACCAAGAAGGGCCGAGCCAAGGTCACGGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGACGGGCTGTTCCTGCAGTGCTGTAAGGAGGTGGCAGAGTTGTACCCCAAGATCCAGTTTGATACAATGATTATTGACAACTGCTGCATGCAGTTGGTGCAGAATCCGTACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATTGATAACCTGGCAGCTGGGCTGGTGGGGGGCGCAGGAGTGGTGCCAGGAGAGAGTTACAGTTCAGAATACGCCGTGTTTGAGACGGGCGCGCGCCACCCATTCGCACAAGCCGTGGGCAGGAATATTGCGAACCCAACTGCAATGTTACTTACTGCCACCAACATGCTGCGACATCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACAACTGACATGGGAGGTTATGCTACTTCTCTGGATTACACACAGGCTGTCATATCCAACCTCAACTGATGGCATCTGTGCCCACAACGGCTTCCTGAGGGTGTGCCAGTGTGTGCCGTGTGTTCTCCTGTGTGTCCCAGCACAATCCCTGCTCTGCCCGTAGCCCGTGCGTCTGCTTGCACTTCTTATTTATTATCTGAAGAATAATGACTGGATCCCAGTGTGTGATTGGCCAACGAGCTCCATCAGAATCTACAGGAGCCGTCTCCCCCTTCTAGCACTTTCCCACCTCCCCTCTGCAGCCAAATAAACC
  5   1   2       bld Skin                            IMAGE:8644704.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGAGAAGTCCAACCGCATTGCCAAGTTTGCCTTTGATTATGCCACCAAGAAGGGCCGAGCCAAGGTCACGGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGACGGGCTGTTCCTGCAGTGCTGTAAGGAGGTGGCAGAGTTGTACCCCAAGATCCAGTTTGATACAATGATTATTGACAACTGCTGCATGCAGTTGGTGCAGAATCCGTACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATTGATAACCTGGCAGCTGGGCTGGTGGGGGGCGCAGGAGTGGTGCCAGGAGAGAGTTACAGTTCAGAATACGCCGTGTTTGAGACGGGCGCGCGCCACCCATTCGCACAAGCCGTGGGCAGGAATATTGCGAACCCAACTGCAATGTTACTTTCTGCCACCAACATGCTGCGACATCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACAACTGACATGGGAGGTTATGCTACTTCTCTGGATTACACACAGGCCGTCATATCCAACCTCAACTGATGGCATCTGTGCCCACAACGGCTTCCTGAGGgtgtgccagtgtgtgccgtgtgttctcctgtgtgtNCCAGCACAATCCCTGCTCTGCCCGTAGCCCGTGTGTCTGCTTGCACTTTCTATTTATATCTGAAGAATATGACTGGATCCAGCGTGTGATGGNCNACGAGCTTCATTGGAATCTACAGAGCGTCTCCCCTCTAGCATTTNCCACTCCCTCTGATGCATAAACTGTA
  3   1   2       bld FaB       in                    IMAGE:8070213.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCGCATTGCCAAGTTTGCCTTTGATTATGCCACCAAGAAGGGCCGAGCCAAGGTCACGGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGACGGGCTGTTCCTGCAGTGCTGTAAGGAGGTGGCAGAGTTGTACCCCAAGATCCAGTTTGATACAATGATTATTGACAACTGCTGCATGCAGTTGGTGCAGAATCCGTACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATTGATAACCTGGCAGCTGGGCTGGTGGGGGGCGCAGGAGTGGTGCCAGGAGAGAGTTACAGTTCAGAATACGCCGTGTTTGAGACGGGCGCGCGCCACCCATTCGCACAAGCCGTGGGCAGGAATATTGCGAACCCAACTGCAATGTTACTTACTGCCACCAACATGCTGCGACATCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACAACTGACATGGGAGGTTATGCTACTTCTCTGGATTACACACAGGCTGTCATATCCAACCTCAACTGATGGCATCTGTGCCCACAACGGCTTCCTGAGGGTGTGCCAGTGTGTGCCGTGTGTTCTCCTGTGTGTCCCAGCACAATCCCTGCTCTGCCCGTAGCCCGTGCGTCTGCTTGCACTTCTTATTTATTATCTGAAGAATAATGACTGGATCCCAGTGTGTGATTGGCCAACGAGCTCCATCAGAATCTACAGGAGCCGTCTCCCCCTTCTAGCACTTCCCACCTCCCCTCGCAGCTAGATAACCGGAAAGG
  3   1   2       bld Te2N      in                    IMAGE:7202440.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCAGTTTGCCTTGATATGCCCCACCANGAAGGGCCGAGCCAAGGTCACGGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGACGGGCTGTTCCTGCAGTGCTGTAAGGAGGTGGCAGAGTTGTACCCCAAGATCCAGTTTGATACAATGATTATTGACAACTGCTGCATGCAGTTGGTGCAGAATCCGTACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATTGATAACCTGGCAGCTGGGCTGGTGGGGGGCGCAGGAGTGGTGCCAGGAGAGAGTTACAGTTCAGAATACGCCGTGTTTGAGACGGGCGCGCGCCACCCATTCGCACAAGCCGTGGGCAGGAATATTGCGAACCCAACTGCAATGTTACTTACTGCCACCAACATGCTGCGACATCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACAACTGACATGGGAGGTTATGCTACTTCTCTGGATTACACACAGGCCGTCATATCCAACCTCAACTGATGGCATCTGTGCCCACAACGGCTTCCTGAGGGTGTGCCAGTGTGTGCCGTGTGTTCTCCTGTGTGTCCCAGCACAATCCCTGCTCTGCCCGTAGCCCGTGCGTCTGCTTGCACTTCTTATTTATTATCTGAAGAATAATGACTGGATCCCAGCGTGTGATTGGCCAACGAGCTCCATCAGAATCTACAGGAGCCGTCTCCCCCTTCTAGCACTTCCCACCTCCCCTTGCAGATAAATGT
  3   1   2       bld Te2N      in                    IMAGE:7202165.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGTCACGGCTGTGCACAAAGCCAATATTATGAAGCTGGGAGACGGGCTGTTCCTGCAGTGCTGTAAGGAGGTGGCAGAGTTGTACCCCAAGATCCAGTTTGATACAATGATTATTGACAACTGCTGCATGCAGTTGGTGCAGAATCCGTACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATTGATAACCTGGCAGCTGGGCTGGTGGGGGGCGCAGGAGTGGTGCCAGGAGAGAGTTACAGTTCAGAATACGCCGTGTTTGAGACGGGCGCGCGCCACCCATTCGCACAAGCCGTGGGCAGGAATATTGCGAACCCAACTGCAATGTTACTTACTGCCACCAACATGCTGCGACATCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACAACTGACATGGGAGGTTATGCTACTTCTCTGGATTACACACAGGCTGTCATATCCAACCTCAACTGATGGCATCTGTGCCCACAACGGCTTCCTGAGGGTGTGCCAGTGTGTGCCGTGTGTTCTCCTGTGTGTCCCAGCACAATCCCTGCTCTGCCCGTAGCCCGTGCGTCTGCTTGCACTTCTTATTTATTATCTGAAGAATAATGACTGGATCCCAGTGTGTGATTGGCCAACGAGCTCCATCAGAATCTACAGGAGCCGTCTCCCCCTTCTAGCACTTCCCACCTCCCCTCGCTGCATACTGGAAAAA
  3   1   2       bld Te2N      in                    IMAGE:7764767.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGAGCAAGTCACGCTGGCCCAAGCAATATCATGAGCTGGAGACGGCTGTCCTGCATGCTGTAAGAGGTGGCAGAGTGTACNNCAAGATCCAGTTTGATACAATGATTATTGACAACTGCTGCATGCAGTTGGTGCAGAATCCGTACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATTGATAACCTGGCAGCTGGGCTGGTGGGGGGCGCAGGAGTGGTGCCAGGAGAGAGTTACAGTTCAGAATACGCCGTGTTTGAGACGGGCGCGCGCCACCCATTCGCACAAGCCGTGGGCAGGAATATTGCGAACCCAACTGCAATGTTACTTACTGCCACCAACATGCTGGGACATTTGAACCTCGAGTATCACTCAAATCTCATTTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACAACTGACATGGGAGGTTATGCTACTTCTTTGGATTACACACAGGCCGTCATATCCAACCTCAACTGATGGCATTTGTGCCCACAACGGCTTCCTGAGGGTGTGCCAGTGTGTGCCGTGTGTTTTCCTGTGTGTCCCAGCACAATCCCTGCTTTGCCCGTAGCCCGTGCGTTTGCTTGCACTTTTTATTTATTATTTGAAGAATAATGACTGGATCCCAGCGTGTGATTGGCCAACGAGCTCCATCAGAATTTACAGGAGCCGTTTCCCCCTTTTAGCACTTTCCCACCTCCCCTTTGCATGCAATAAACTTGTATGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  5   1   2       bld Tbd7      in                         XL109f02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCCTATATCATGAAGCTGGGAGACGGGCTGTTCCTGCAGTGCTGTAAGGAGGTGGCAGAGTTGTACCCCAAGATCCAGTTTGATACAATGATTATTGACAACTGCTGCATGCAGTTGGTGCAGAATCCGTACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATTGATAACCTGGCAGCTGGGCTGGTGGGGGGCGCAGGAGTGGTGCCAGGAGAGAGTTACAGTTCAGAATACGCCGTGTTTGAGACGGGCGCGCGCCACCCATTCGCACAAGCCGTGGGCAGGAATATTGCGAACCCAACTGCAATGTTACTTACTGCCACCAACATGCTGCGACATCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACAACTGACATGGGAGGTTATGCTACTTCTCTGGATTACACACAGGCCGTCATATCCAACCTCAACTGATGGCATCTGTGCCCACAACGGCTTCCTGAGGgtgtgccagtgtgtgccgtgtgttctcctgtgtgtCCCAGCACAATCCCTGCTCTGCCCGTAGCCCGTGCGTCTGCTTGCACTTCTTATTTATTATCTGAAGAATAATGACTGGATCCCAGCGTGTGATTGGCCAACGAGCTCCATCA
  3   1   2       bld Skin      in                    IMAGE:8641212.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGAAGTGGGAGACGGGCTGTTCCTGCAGTGCTGTAAAGAGGTGTCAGAGTTGTACCCCAAGATCCAGTTTGATACAATGATTATTGACAACTGCTGCATGCAGTTGGTGCAGAATCCGTACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATTGATAACCTGGCAGCTGGGCTGGTGGGGGGCGCAGGAGTGGTGCCAGGAGAGAGTTACAGTTCAGAATACGCCGTGTTTGAGACGGGCGCGCGCCACCCATTCGCACAAGCCGTGGGCAGGAATATTGCGAACCCAACTGCAATGTTACTTACTGCCACCAACATGTTGCGACATCTCAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACAACTGACATGGGAGGTTATGCTACTTCTCTGGATTACACACAGGCCGTCATATCCAACCTCAACTGATGGCATCTGTGCCCACAACGGCTTCCTGAGGGTGTGCCAGTGTGTGCCGTGTGTTCTCCTGTGTGTCCCAGCACAATCCCTGCTCTGCCCGTAGCCCGTGCGTCTGCTTGCACTTCTTATTTATTATCTGAAGAATAATGACTGGATCCCAGCGTGTGATTGGCCAACGAGCTCCATCGGAATCTACAGGAGCCGTCTCCCCCTCTAGCACTTCCCACTCCCTTNGCCCAAAATGGGNNNNNNNTTAAA
  5   1   2       bld Skin      in                    IMAGE:8641212.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGAAGCTGGGAGACGGGCTGTTCCTGCAGTGCTGTAAGGAGGTGTCAGAGTTGTACCCCAAGATCCAGTTTGATACAATGATTATTGACAACTGCTGCATGCAGTTGGTGCAGAATCCGTACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATTGATAACCTGGCAGCTGGGCTGGTGGGGGGCGCAGGAGTGGTGCCAGGAGAGAGTTACAGTTCAGAATACGCCGTGTTTGAGACGGGCGCGCGCCACCCATTCGCACAAGCCGTGGGCAGGAATATTGCGAACCCAACTGCAATGTTACTTACTGCCACCAACATGTTGCGACATCTCAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACAACTGACATGGGAGGTTATGCTACTTCTCTGGATTACACACAGGCCGTCATATCCAACCTCAACTGATGGCATCTGTGCCCACAACGGCTTCCTGAGGgtgtgccagtgtgtgccgtgtgttctcctgtgtgtCCCAGCACAATCCCTGCTCTGCCCGTAGCCCGTGCGTCTGCTTGCACTTCTTATTTATTATCTGAAGAATAATGACTGGATCCCAGCGTGTGATTGGCCAACGAGCTCCATCGGAATCTACAGGAGCCGTCTCCCCCTTCTAGCACTTTTCCACCTCCCTCTGCATGCAATAAACTTGTATGTNGaaaaaaaaaaanannaanaaaaaaaaaaaaaaGGCGGCG
  5   1   2       bld Tbd7      in                         XL108f02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGCTGGGAGACGGGCTGTTCCTGCAGTGCTGTAAGGAGGTGGCAGAGTTGTACCCCAAGATCCAGTTTGATACAATGATTATTGACAACTGCTGCATGCAGTTGGTGCAGAATCCGTACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATTGATAACCTGGCAGCTGGGCTGGTGGGGGGCGCAGGAGTGGTGCCAGGAGAGAGTTACAGTTCAGAATACGCCGTGTTTGAGACGGGCGCGCGCCACCCATTCGCACAAGCCGTGGGCAGGAATATTGCGAACCCAACTGCAATGTTACTTACTGCCACCAACATGCTGCGACATCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACAACTGACATGGGAGGTTATGCTACTTCTCTGGATTACACACAGGCCGTCATATCCAACCTCAACTGATGGCATCTGTGCCCACAACGGCTTCCTGAGGGtgtgccagtgtgtgccgtgtgttctcctgtgtgtCCCAGCACAATCCCTGCTCTGCCCGTAGCCCGTGCGTCTGCTTGCACTTCTTATTTATTATCTGAAGAATAATGACTGGATCCCAGCGTGTGATTGGCCAACGAGCTCC
  3   1   2       bld Tbd7      in                         XL108f02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GATCCAGTTTGATACAATGATTATTGACAACTGCTGCATGCAGTTGGTGCAGAATCCGTACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATTGATAACCTGGCAGCTGGGCTGGTGGGGGGCGCAGGAGTGGTGCCAGGAGAGAGTTACAGTTCAGAATACGCCGTGTTTGAGACGGGCGCGCGCCACCCATTCGCACAAGCCGTGGGCAGGAATATTGCGAACCCAACTGCAATGTTACTTACTGCCACCAACATGCTGCGACATCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACAACTGACATGGGAGGTTATGCTACTTCTCTGGATTACACACAGGCCGTCATATCCAACCTCAACTGATGGCATCTGTGCCCACAACGGCTTCCTGAGGGTGTGCCAGTGTGTGCCGTGTGTTCTCCTGTGTGTCCCAGCACAATCCCTGCTCTGCCCGTAGCCCGTGCGTCTGCTTGCACTTCTTATTTATTATCTGAAGAATAATGACTGGATCCCAGCGTGTGATTGGCCAACGAGCTCCATCAGAATCTACAGGAGCCGTCTCCCCCTTCTAGCACTTTCCCACCTCCCCTCTGCATGCAATAAACTTGTATG
  3   1   2       bld Tbd7      in                         XL109f02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTGACAACTGCTGCATGCAGTTGGTGCAGAATCCGTACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATTGATAACCTGGCAGCTGGGCTGGTGGGGGGCGCAGGAGTGGTGCCAGGAGAGAGTTACAGTTCAGAATACGCCGTGTTTGAGACGGGCGCGCGCCACCCATTCGCACAAGCCGTGGGCAGGAATATTGCGAACCCAACTGCAATGTTACTTACTGCCACCAACATGCTGCGACATCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACAACTGACATGGGAGGTTATGCTACTTCTCTGGATTACACACAGGCCGTCATATCCAACCTCAACTGATGGCATCTGTGCCCACAACGGCTTCCTGAGGGTGTGCCAGTGTGTGCCGTGTGTTCTCCTGTGTGTCCCAGCACAATCCCTGCTCTGCCCGTAGCCCGTGCGTCTGCTTGCACTTCTTATTTATTATCTGAAGAATAATGACTGGATCCCAGCGTGTGATTGGCCAACGAGCTCCATCAGAATCTACAGGAGCCGTCTCCCCCTTCTAGCACTTTCCCACCTCCCCTCTGCATGCAATAAACTTGTATG
  3   1   2       bld Ov1                             IMAGE:4054992.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGTTCAGAATACGCCGTGTTTGAGACGGGCGCGCGCCACCCATTCGCACAAGCCGTGGGCAGGAATATTGCGAACCCAACTGCAATGTTACTTACTGCCACCAACATGCTGCGACATCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACAACTGACATGGGAGGTTATGCTACTTCTCTGGATTACACACAGGCCGTCATATCCAACCTCAACTGATGGCATCTGTGCCCACAACGGCTTCCTGAGGGTGTGCCAGTGTGTGCCGTGTGTTCTCCTGTGTGTCCCAGCACAATCCCTGCTCTGCCCGTAGCCCGTGCGTCTGCTTGCACTTCTTATTTATTATCTGAAGAATAATGACTGGATCCCAGCGTGTGATTGGCCAACGAGCTCCATCAGAATCTACAGGAGCCGTCTCCCCCTTCTAGCACTTTCCCACCTCCCCTCTGCATGCAATAAACTTGTATGTGAAGCC
  3   1   2       bld He1  5g3  in                    IMAGE:4408522.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTGTTTGAGACGGGCGCGCGCCACCCATTCGCACAAGCCGTGGGCAGGAATATTGCGAACCCAACTGCAATGTTACTTTCTGCCACCAACATGCTGCGACATCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACAACTGACATGGGAGGTTATGCTACTTCTCTGGATTACACACAGGCTGTCATATCCAACCTCAACTGATGGCATCTGTGCCCACAACGGCTTCCTGAGGGTGTGCCAGTGTGTGCCGTGTGTTCTCCTGTGTGTCCCAGCACAATCCCTGCTCTGCCCGTAGCCCGTGCGTCTGCTTGCACTTCTTATTTATTATCTGAAGAATAATGACTGGATCCCAGCGTGTGATTGGCCAACGAGCTCCATCGGAATCTACAGGAGCCGTCTCCCCCTTCTAGCACTTTCCCACCTCCCCTCTGCATGCAATAAACTTGTATGTGAAGCCA
  5   1   2       e50                            Xl3.1-IMAGE:4970064.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTGCGAACCCAACTGCAATGTTACTTACTGCCACCAACATGCTGCGACATCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGGACCCGAGATATGGGAGGTTATTCCACGACAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTCTCGCTATCCCTACTAGCACCCTTTGTGACTGTTGTGCACTATGCTTTGTGTCCCTTGTGGGGTCTTTCTCTGGCACAGTCCCTGTCTCATGTTCCATCTGACAGTTGCTTAGCAATATCTGCCAGACATTATAAGGGTTAGTGGTTACTGGCCGTCCTTGTGCCACTCCTGCTCTCAGTCTGTGTCCAGTGTAACCCATAAACTGTGTATGTGCCAGGGCTTGAGTGAGTTCTACTCTCTTATACACAAATGGGGGAGAGAGAGTCCAACTCTGTTTAGTAGCCGCCATTATTCCCTGCCTGTTACTGAGCTCTTGGCACTAAAGTGGGCACATAGTTGGTCCATACTGGGTACAAGTGGTTTGAGCTCTAGTCTAGGCACAGTATTACAGCAGGCTGAAGCCCAATGTTAGAGCACTCACACATACTCACACTGCCCAACTCAGTGTCACACAAATAAAGACTTATTTTTTTTCAAAAAAA
                                                  Xl3.1-CHK-1012707623                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACCCAACTGCAATGTTACTTACTGCCACCAACATGCTGCGACATCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGGACCCGAGATATGGGAGGTTATTCCACGACAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTCTCGCTATCCCTACTAGCACCCTTTGTGACTGTTGTGCACTATGCTTTGTGTCCCTTGTGGGGTCTTTCTCTGGCACAGTCCCTGTCTCATGTTCCATCTGACAGTTGCTTAGCAATATCTGCCAGACATTATAAGGGTTAGTGGTTACTGGCCGTCCTTGTGCCACTCCTGCTCTCAGTCTGTGTCCAGTGTAACCCATAAACTGTGTATGTGCCAGGGCTTGAGTGAGTTCTACTCTCTTATACACAAATGGGGGAGAGAGAGTCCAACTCTGTTTAGTAGCCGCCATTATTCCCTGCCTGTTACTGAGCTCTTGGCACTAAAGTGGGCACATAGTTGGTCCATACTGGGTACAAGTGGTTTGAGCTCTAGTCTAGGCACAGTATTACAGCAGGCTGAAGCCCAATGTTAGAGCACTCACACATACTCACACTGCCCAACTCAGTGTCACACAAATAAAGACTTATTTTTTTTCAAAAAAAAAAAAA
  3   1   2       chi Emb4      in                    IMAGE:4970064.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGATTGCTGGCATGCCCACCGTATGGCAAATCATTGATACCTGGCAGTGGGCTGGTGGGGGCGCAGGAGTGGTCCCAGGAGAGAGTTACAGTTCAGAATACGCCGTGTTGAGACGGGGCGCGCGCCACCCATTCGCACAAGCCGTGGGCAGGAATATTGCGAACCCAACTGCAATGTTACTTACTGCCACCAACATGCTGCGACATCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGGACCCGAGATATGGGAGGTTATTCCACGACAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTCTCGCTATCCCTACTAGCACCCTTTGTGACTGTTGTGCACTATGCTTTGTGTCCCTTGTGGGGTCTTTCTCTGGCACAGTCCCTGTCTCATGTTCCATCTGACAGTTGCTTAGCAATATCTGCCAGACATTATAAGGGTTAGTGGTTACTGGCAGTCCTTGTGCCACTCATGCTATCAGTATGTGTCCAGTGTAACCCATAAACTGTGATGTGCCAGGGCTTGAGTGAGTTATACATATATTATACACAAATGGGGGAGAGAGAGTCCAACTATGTTTAGTAGCCGCCATTATTCCCTGCCTGTTACTGAGCTCTTGGCACTAAAGTGGGCACATAGTTGGTCCATACTGGGTACAAGTGGTTTGAGCTCTAGTCTAGGCACAGTATTACAGCAGGCAGAAGCCCAATGTTAGAGCACTCACACATACTCACACTGCCCAATTCTAGGTCTCTCTAAA
  3   1   2       add Ov1       in                    IMAGE:8328487.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGGGGCCCCCCTCACCCGGGGGGGGAGTATCCCCCCCCAATTTTTTTTCCCCCACCAGGGGGGTTTTTACCCTGGGTTCAAAATTTTTTTTGGGGGGGGAAAAAAATCTTTAAAGGGAAAGGGGGCCCCCCAATTTGTGGGTTTTTTCCAAAAAGGGGTTTTTCAGGGGGGGGGAGGGGGGGTAACATCTGGTTCCCCCAAAAGACCCCTTTGGAAATTTTTGGCCCAAAAGTTTTGGGTCCCCTGGGGGGTTTTTTTGGGGACAAATCCCTTTTAAAGTTTCCTTTGAACGGTGGTTTACAAATTTTGGCCAACCTTTTAAGGGTTTGGGGGTTACGGCCCGTCCTTGTGCCATTCCTGGTTTCAGTTTGGGTCCAGGGTAACCCATTAAACTGTGTTTGGGCCAGGGGCTTGAGTGAGTTCTACTCTCTTATACACAAATGGGGGAGAGAGAGTCCAACTCTGTTTAGTAGCCGCCATTATTCCCTGCCTGTTACTGAGCTCTTGGCACTAAAGTGGGCACATAGTTGGTCCATACTGGGTACAAGTGGTTTGAGCTCTAGTCTAGGCACAGTATTACAGCAGGCTGAAGCCCAATGTTAGAGCACTCACACATACTCACACTGCCCAACTCAGTGTCACACAAATAAAGACTTATTTTTTTTCAAAAAAAAAAAAAAAG
  3   1   2      seed Tbd7      in                         XL062g03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ANATATGGGAGGTTATTCCACGACAAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTCTCGCTATCCCTACTAGCACCCTTTGTGACTGTTGTGCACTATGCTTTGTGTCCCTTGTGGGGTCTTTCCTGGCACAGTCCCTGTCTCATGTTCCATCTGACAGTTGCTTAGCAATATCTGCCAGACATTATAAGGGTTAGTGGTTACTGGCCGTCCTTGTGCCACTCCTGCTCTCAGTCTGTGTCCAGTGTAACCCATAAACTGTGTATGTGCCAGGGCTTGAGTGAGTTCTACTCTCTTATACACAAATGGGGGAGAGAGAGTCCAACTCTGTTTAGTAGCCGCCATTATTCCCTGCCTGTTACTGAGCTCTTGGCACTAAAGTGGGCACATAGTTGGTCCATACTGGGTACAAGTGGTTTGAGCTCTAGTCTAGGCACAGTATTACAGCAGGCTGAAGCCCAATGTTAGAGCACTCACACATACTCACACTGCCCAACTCAGTGTCACACAAATAAAGACT
  3   1   2       bld Tbd3                            IMAGE:3549745.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCCCAGTCCCTGTCTCATGTTCCATCTGACAGTTGCTTAGCAATATCTGCCAGACATTATAAGGGTTAGTGGTTACTGGCCGTCCTTGTGCCACTCCTGCTCTCAGTCTGTGTCCAGTGTAACCCATAAACTGTGTATGTGCCAGGGCTTGAGTGAGTTCTACTCTCTTATACACAAATGGGGGAGAGAGAGTCCAACTCTGTTTAGTAGCCGCCATCATTCCCTGGCTGTTACTGAGCTCTTGGCACTAAAGTGGGCACATAGTTGGTCCATACTGGGTACAAGTGGTTTGAGCTCTAGTCTAGGCACAGTATTACAGCAGGCTGAAGCCCAATGTTAGAGCACTCACACATACTTACACTGCCCAACTCAGTGTC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)