Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 91%

 1012837481 Xl3.1-XL210d13.3.5 - 108 ESTs
                                                                       .-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL210d13.3.5                                                                                                                CTAGTGAAAGCGCGCGTGCTTATTGGCTCACCGTGAGGCGGGACGCTGGGTTACTGATCTGATTGGGTGACCCGTCGAGGCGCCGTGCGCATACAGTCGAGTGCGTTGAGGCCGTGTGCAAACCGCGTGTGGCGCAGCGCAGGAGAACGGAGACCGGGACGAAAACTTCTCTGAAACCATGAGCAGCAACGAGTGCTTCAAGTGCGGCCGCACTGGTCACTGGGCAAGAGAGTGCCCAACTGGAGGAGGACGTGGCCGTGGGGGGGGGAGAGGCAGAGGCCGTGGGGGGTTCAGCTCGTCTAGAGGTTTCCAATTCATTTCTTCATCTCTTCCAGACATCTGCTACCGCTGTGGGGAGTCTGGCCACCTTGCTAAGGATTGTGATCTGCAGGAGGATGCTTGCTATAACTGTGGCAGAGGTGGGCATATTGCCAAGGACTGTAAGGAGCCCAGGAAAGAGCGGGAGCAGTGCTGCTATAACTGTGGGAAGCCGGGCCACCTTGCCCGTGATTGTGACCACGCTGATGAACATAAGTGCTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGAGACTGGCCACGTGGCCATTAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGGCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAGTCCTCTTCACTGGCCAAAGGTTGGCAGATAGAGCTATTCCCAGGCCGTGAGCTTTACTTGACGTGTAAAAGGAGGAAAGGGGTGGAAACTATAAAAAAAACGACTTTCTGCATTTAACAAAAATGTTTATGTTTAGTTTGGTAGAGGTGTAATGTATAATGCTTTGTTCAAGAACCCCCTTTCCGGACCACTGGTACTAGGGATTTCAATGGGAAGAGTCAGGTCAGTAGGACCCCCCAAGGGTAGCAGGAATTTGGCAGAGCACCTGCTCCACATGGAAAAGTGGCTGGAAGTTTCTGCACAACTTCCACCAATTGATCTTTTTAGCCGGTCTCATTGGCCGACCTCGGCTCTTCATAAGTGTATGGGGGGGCAACACGTCAACATCAGCCAGTGGCCCCATCGCAGCTCACTCTGCCGAAGCAGAAATTTGGCCACTGGGTTAGTATTTGAGATTCGGGTGGAACGTGGTATTGGAGATTTTTTTTTTTTTTCTTTCGTGGGAGTGAGACGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAACATAGAAATGTAATTTTAAACTATCAATAAAGCTGGAGGAGGAAGGGAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012721308                                                                                                                      AAAGCGCGCGTGCTTATTGGCTCACCGTGAGGCGGGACGCTGGGTTACTGATCTGATTGGGTGACCCGTCGAGGCGCCGTGCGCATACAGTCGAGTGCGTTGAGGCCGTGTGCAAACCGCGTGTGGCGCAGCGCAGGAGAACGGAGACCGGGACGAAAACTTCTCTGAAACCATGAGCAGCAACGAGTGCTTCAAGTGCGGCCGCACTGGTCACTGGGCAAGAGAGTGCCCAACTGGAGGAGGACGTGGCCGTGGGGGGGGGAGAGGCAGAGGCCGTGGGGGGTTCAGCTCGTCTAGAGGTTTCCAATTCATTTCTTCATCTCTTCCAGACATCTGCTACCGCTGTGGGGAGTCTGGCCACCTTGCTAAGGATTGTGATCTGCAGGAGGATGCTTGCTATAACTGTGGCAGAGGTGGGCATATTGCCAAGGACTGTAAGGAGCCCAGGAAAGAGCGGGAGCAGTGCTGCTATAACTGTGGGAAGCCGGGCCACCTTGCCCGTGATTGTGACCACGCTGATGAACATAAGTGCTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGAGACTGGCCACGTGGCCATTAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGGCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAGTCCTCTTCACTGGCCAAAGGTTGGCAGATAGAGCTATTCCCAGGCCGTGAGCTTTACTTGACGTGTAAAAGGAGGAAAGGGGTGGAAACTATAAAAAAAACGACTTTCTGCAxxxAAxAAAAATGTTTATGTTTAGTTTGGTAGAGGTGTAATGTATAATGCTTTGTTCAAGAACCCCCTTTCCGGACCACTGGTACTAGGGATTTCAATGGGAAGAGTCAGGTCAGTAGGACCCCCCAAGGGTAGCAGGAATTTGGCAGAGCACCTGCTCCACATGGAAAAGTGGCTGGAAGTTTCTGCACAACTTCCACCAATTGATCTTTTTAGCCGGTCTCATTGGCCGACCTCGGCTCTTCATAAGTGTATGGGGGGGCAACACGTCAACATCAGCCAGTGGCCCCATCGCAGCTCACTCTGCCGAAGCAGAAATTTGGCCACTGGGTTAGTATTTGAGATTCGGGTGGAAxxxxxTxxxxGAGATTTTTTTTTTTTTTCTTTCGTGGGAGTGAGACGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAACATAGAAATGTAATTTTAAACTATCAATAAAGCTGGAGGAGGAAGGGGAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                     3     4     3     4     3     4     3     5     3     5     3     5     3     5     3     5     3     7     6    10     6    10     6    10     8    12     9    14    10    17    11    17    11    18    11    18    11    18    12    18    13    19    14    19    15    21    15    21    13    22    17    22    17    22    17    23    24    25    23    25    25    25    27    27    26    26    26    26    24    24    24    24    24    24    27    27    27    29    28    30    29    30    31    34    32    35    32    35    32    36    34    37    34    37    34    38    37    41    37    42    36    42    38    43    39    43    41    44    41    44    38    42    38    40    38    41    35    38    34    39    35    40    35    40    34    39    33    41    31    42    30    42    29    42    28    41    28    42    27    39    25    42    19    42    12    39    11    39    11    32    10    31     9    31    10    32    12    33    11    32    12    33    12    35    13    36    14    37    16    37    18    37    17    37    17    40    16    40    17    42    15    40    17    43    18    49    17    49    18    50    17    49    18    50    18    53    17    57    19    57    21    60    19    60    19    61    15    61    22    62    35    59    35    59    37    58    36    57    36    56    50    56    51    56    49    55    51    57    51    57    47    57    49    57    48    55    45    53    46    53    34    53    33    52    31    48    13    26     8    17     8    15     5    10     4     7
  5   1   2       e50                                 Xl3.1-XL210d13.3                                                                                                                CTAGTGAAAGCGCGCGTGCTTATTGGCTCACCGTGAGGCGGGACGCTGGGTTACTGATCTGATTGGGTGACCCGTCGAGGCGCCGTGCGCATACAGTCGAGTGCGTTGAGGCCGTGTGCAAACCGCGTGTGGCGCAGCGCAGGAGAACGGAGACCGGGACGAAAACTTCTCTGAAACCATGAGCAGCAACGAGTGCTTCAAGTGCGGCCGCACTGGTCACTGGGCAAGAGAGTGCCCAACTGGAGGAGGACGTGGCCGTGGGGGGGGGAGAGGCAGAGGCCGTGGGGGGTTCAGCTCGTCTAGAGGTTTCCAATTCATTTCTTCATCTCTTCCAGACATCTGCTACCGCTGTGGGGAGTCTGGCCACCTTGCTAAGGATTGTGATCTGCAGGAGGATGCTTGCTATAACTGTGGCAGAGGTGGGCATATTGCCAAGGACTGTAAGGAGCCCAGGAAAGAGCGGGAGCAGTGCTGCTATAACTGTGGGAAGCCGGGCCACCTTGCCCGTGATTGTGACCACGCTGATGAACATAAGTGCTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGAGACTGGCCACGTGGCCATTAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGGCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAGTCCTCTTCACTGGCCAAAGGTTGGCAGATAGAGCTATTCCCAGGCCGTGAGCTTTACTTGACGTGTAAAAGGAGGAAAGGGGTGGAAACTATAAAAAAAACGACTTTCTGCATTTAACAAAAATGTTTATGTTTAGTTTGGTAGAGGTGTAATGTATAATGCTTTGTTCAAGAACCCCCTTTCCGGACCACTGGTACTAGGGATTTCAATGGGAAGAGTCAGGTCAGTAGGACCCCCCAAGGGTAGCAGGAATTTGGCAGAGCACCTGCTCCACATGGAAAAGTGGCTGGAAGTTTCTGCACAACTTCCACCAATTGATCTTTTTAGCCGGTCTCATTGGCCGACCTCGGCTCTTCATAAGTGTATGGGGGGGCAACACGTCAACATCAGCCAGTGGCCCCATCGCAGCTCACTCTGCCGAAGCAGAAATTTGGCCACTGGGTTAGTATTTGAGATTCGGGTGGAAGAATCTGAACGAGATTTTTTTTTTTTTTCTTTCGTGGGAGTGAGACGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAACATAGAAATGTAATTTTAAACTATCAATAAAGCTGGAGGAGGAAGGGAAAAAAAAAAAA
  5   1   2       e50                            Xl3.1-IMAGE:8460788.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAGAGTTGAGTCGGGCCAGTAGGAGCCCACCCAGGGCAGCAGCAATTTGGCAGATAGTCTGCTCCAGGGAAAAGCGATTGGAAGTTTCCGCTGAACTTCCGCCAATTTTTTTTTTTTTTTAACGGTCTCATTGGCCGACCTCGGCTGTTAATAACGTGCAACTGTATCAGGTCTGTGTACAGCGCAGTGGCAACAACACGTCAACATCGGCCAGTGGCCCCGGTGGCATCTCAGTCTCGTGGTATTGGAGATACAGGTGAGAGGATCCGCTGTTTTTGTTTCTTCGTGGGAAATGAGAAGGCAAAGGCGTATCATGGAGCCAAACGTAGAAACTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGACTTTACTTTGCTTGTAATCAGTTTTTAAAAGTCGGGAGGTAAAAGAAATGTAAGTCCTAGAACATAGAAATGTAATTTTAAACTATCAATAAAGCTGG
                                                                   VAR                                                                                                                                                                                                                                                                                                    AGACCGGGACGAAAACTTCTCTGAAACCATGAGCAGCAACGAGTGCTTCAAGTGCGGCCGCACTGGTCATTGGGCAAGAGAGTGCCCAACTGGAGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                TGGGGGGGGGAGAGGCAGAGGTCGTGGGGGCTTCAGCTCATCTAGAGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AATGACTTTCTGCATTTAACAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAAAAAAATGTTTGTTTAGTTTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGAAAGAGTTGAGTCGGGCCAGTAGGAGCCCACCCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGTTTCCGCTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTTTTTTTTTTTTTAACGGTCTCATTGGCCGACCTCGGCTGTTAATAACGTGCAACTGTATCAGGTCTGTGTACAGCGCAGTGGCAACAACACGTCAACATCGGCCAGTGGCCCCGGTGGCATCTCAGTCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAATCTGAACGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GATACAGGTGAGAGGATCCGCTGTTTTTGTTTCTTCGTGGGAAATGAGAAGGCAAAGGCGTATCATGGAGCC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                        ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                    ---A------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -------A-A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        C-----------
                                               BLH ATG     178     344                                                                                                                
                                               BLH MIN     139     105                                                                                                                
                                               BLH OVR     178     258                                                                                                                
                                               ORF LNG     178       5                                                                                                                
  5   1   2       e50                                 Xl3.1-XL210d13.3                                                                                                                CTAGTGAAAGCGCGCGTGCTTATTGGCTCACCGTGAGGCGGGACGCTGGGTTACTGATCTGATTGGGTGACCCGTCGAGGCGCCGTGCGCATACAGTCGAGTGCGTTGAGGCCGTGTGCAAACCGCGTGTGGCGCAGCGCAGGAGAACGGAGACCGGGACGAAAACTTCTCTGAAACCATGAGCAGCAACGAGTGCTTCAAGTGCGGCCGCACTGGTCACTGGGCAAGAGAGTGCCCAACTGGAGGAGGACGTGGCCGTGGGGGGGGGAGAGGCAGAGGCCGTGGGGGGTTCAGCTCGTCTAGAGGTTTCCAATTCATTTCTTCATCTCTTCCAGACATCTGCTACCGCTGTGGGGAGTCTGGCCACCTTGCTAAGGATTGTGATCTGCAGGAGGATGCTTGCTATAACTGTGGCAGAGGTGGGCATATTGCCAAGGACTGTAAGGAGCCCAGGAAAGAGCGGGAGCAGTGCTGCTATAACTGTGGGAAGCCGGGCCACCTTGCCCGTGATTGTGACCACGCTGATGAACATAAGTGCTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGAGACTGGCCACGTGGCCATTAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGGCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAGTCCTCTTCACTGGCCAAAGGTTGGCAGATAGAGCTATTCCCAGGCCGTGAGCTTTACTTGACGTGTAAAAGGAGGAAAGGGGTGGAAACTATAAAAAAAACGACTTTCTGCATTTAACAAAAATGTTTATGTTTAGTTTGGTAGAGGTGTAATGTATAATGCTTTGTTCAAGAACCCCCTTTCCGGACCACTGGTACTAGGGATTTCAATGGGAAGAGTCAGGTCAGTAGGACCCCCCAAGGGTAGCAGGAATTTGGCAGAGCACCTGCTCCACATGGAAAAGTGGCTGGAAGTTTCTGCACAACTTCCACCAATTGATCTTTTTAGCCGGTCTCATTGGCCGACCTCGGCTCTTCATAAGTGTATGGGGGGGCAACACGTCAACATCAGCCAGTGGCCCCATCGCAGCTCACTCTGCCGAAGCAGAAATTTGGCCACTGGGTTAGTATTTGAGATTCGGGTGGAAGAATCTGAACGAGATTTTTTTTTTTTTTCTTTCGTGGGAGTGAGACGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAACATAGAAATGTAATTTTAAACTATCAATAAAGCTGGAGGAGGAAGGGAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012685703                                                                                                                      AAAGCGCGCGTGCTTATTGGCTCACCGTGAGGCGGGACGCTGGGTTACTGATCTGATTGGGTGACCCGTCGAGGCGCCGTGCGCATACAGTCGAGTGCGTTGAGGCCGTGTGCAAACCGCGTGTGGCGCAGCGCAGGAGAACGGAGACCGGGACGAAAACTTCTCTGAAACCATGAGCAGCAACGAGTGCTTCAAGTGCGGCCGCACTGGTCACTGGGCAAGAGAGTGCCCAACTGGAGGAGGACGTGGCCGTGGGGGGGGGAGAGGCAGAGGCCGTGGGGGGTTCAGCTCGTCTAGAGGTTTCCAATTCATTTCTTCATCTCTTCCAGACATCTGCTACCGCTGTGGGGAGTCTGGCCACCTTGCTAAGGATTGTGATCTGCAGGAGGATGCTTGCTATAACTGTGGCAGAGGTGGGCATATTGCCAAGGACTGTAAGGAGCCCAGGAAAGAGCGGGAGCAGTGCTGCTATAACTGTGGGAAGCCGGGCCACCTTGCCCGTGATTGTGACCACGCTGATGAACATAAGTGCTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGAGACTGGCCACGTGGCCATTAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGGCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAGTCCTCTTCACTGGCCAAAGGTTGGCAGATAGAGCTATTCCCAGGCCGTGAGCTTTACTTGACGTGTAAAAGGAGGAAAGGGGTGGAAACTATAAAAAAAACGACTTTCTGCAxxxAAxAAAAATGTTTATGTTTAGTTTGGTAGAGGTGTAATGTATAATGCTTTGTTCAAGAACCCCCTTTCCGGACCACTGGTACTAGGGATTTCAATGGGAAGAGTCAGGTCAGTAGGACCCCCCAAGGGTAGCAGGAATTTGGCAGAGCACCTGCTCCACATGGAAAAGTGGCTGGAAGTTTCTGCACAACTTCCACCAATTGATCTTTTTAGCCGGTCTCATTGGCCGACCTCGGCTCTTCATAAGTGTATGGGGGGGCAACACGTCAACATCAGCCAGTGGCCCCATCGCAGCTCACTCTGCCGAAGCAGAAATTTGGCCACTGGGTTAGTATTTGAGATTCGGGTGGAAGAATCTGAACGAGATTTTTTTTTTTTTTCTTTCGTGGGAGTGAGACGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAACATAGAAATGTAATTTTAAACTATCAATAAAGCTGGAGGAGGAAGGGGAAAAAAAAAAAAAAAAG
  5   1   2       chi Ga12      in                         XL210d13.5p AGGGTGCGGCCCTAGTTCTACTGGCGGGACTTCCCCGAGCTCCAACATTCCGCCTCGGCCTGAGAGTTGTGCGGGAGAGCGCGGGGCTCGGGGTGGGCTCCAGCTCCGGCAACGTCCGGCAATAGTCCCTGTGAGACACCGACTGGGCCCCAACTCCTAAACCGACCTGAccccccccTTCTTTACTTGGTATCGCCCTCCCAGCGGCGTCAGGACTGGAGATTCCGGGAGATGCAGCGAGTTGGGCCGCAATAACGTGTCTGCTGCTGCCTAAAACTTCTCTGAAACCATGAGCAGCAACGAGTGCTTCAAGTGCGGCCGCACTGGTCACTGGGCAAGAGAGTGCCCAACTGGAGGAGGACGTGGCCGTgggggggggAGAGGCAGAGGCCGTGGGGGGTTCAGCTCGTCTAGAGGTTTCCAATTCATTTCTTCATCTCTTCCAGACATCTGCTACCGCTGTGGGGAGTCTGGCCACCTTGCTAAGGATTGTGATCTGCAGGAGGATGCTTGCTATAACTGTGGCANA
  5   1   2       bld DMZ  5g3  in                         xl299m22.5p                                                                                                    GGGCAGCCTAAGCTAGTGAAAGCGCGCGTGCTTATTGGCTCACCGTGAGGCGGGACGCTGGGTTACTGATCTGATTGGGTGACCCGTCGAGGCGCCGTGCGCATACAGTCGAGTGCGTTGAGGCCGTGTGCAAACCGCGTGTGGCGCAGCGCAGGAGAACGGAGACCGGGACGAAAACTTCTCTGAAACCATGAGCAGCAACGAGTGCTTCAAGTGCGGCCGCACTGGTCATTGGGCAAGAGAGTGCCCAACAGGAGGAGGACGTGGCCGTgggggggggAGAGGCAGAGGTCGTGGGGGCTTCAGCTCGTCTAGAGGTTTCCAATTCATTTCTTCATCTCTTCCAGACATCTGCTACCGCTGTGGGGAGTCTGGCCACCTTGCTAAGGATTGTGATCTGCAGGAGGATGCTTGCTATAACTGTGGCAGAGGTGGGCATATTGCCAAGGACTGTAAGGAGCCCAGGAAAGAGAGGGAGCAGTGCTGCTATAACTGTGGGAAGCCGGGCCACCTTGCCCGTGACTGTGAGCACGCTGATGAACAGAAGTGCTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGATACTGGCCACGTGGCCATCAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGANAGTCGGGCCACCTGGCACGGGAATGCAC
  5   1   2       bld Ga15 5g                            XL485n15ex.5p                                                                                                     GGCAGCCTAAGCTAGTGAAAGCGCGCGTGCTTATTGGCTCACCGTGAGGCGGGACGCTGGGTTACTGATCTGATTGGGTGACCCGTCGAGGCGCCGTGCGCATACAGTCGAGTGCGTTGAGGCCGTGTGCAAACCGCGTGTGGCGCAGCGCAGGAGAACGGAGACCGGGACGAAAACTTCTCTGAAACCATGAGCAGCAACGAGTGCTTCAAGT
  5   1   2       bld DMZ  5g3  in                         xl287c23.5p                                                                                                              AGCTAGTGAAAGCGCGCGTGCTTATTGGCTCACCGTGAGGCGGGACGCTGGGTTACTGATCTGATTGGGTGACCCGTCGAGGCGCCGTGCGCATACAGTCGAGTGCGTTGAGGCCGTGTGCAAACCGCGTGTGGCGCAGCGCAGGAGAACGGAGACCGGGACGAAAACTTCTCTGAAACCATGAGCAGCAACGAGTGCTTCAAGTGCGGCCGCACTGGTCATTGGGCAAGAGAGTGCCCAACTGGAGGAGGACGTGGCCGTgggggggggAGAGGCAGAGGTCGTGGGGGCTTCAGCTCGTCTAGAGGTTTCCAATTCATTTCTTCATCTCTTCCAGACATCTGCTACCGCTGTGGGGAGTCTGGCCACCTTGCTAAGGATTGTGATCTGCAGGAGGATGCTTGCTATAACTGTGGCAGAGGCGGGCATATTGCCAAGGACTGTAAGGAGCCCAGGAAAGAGAGGGAGCAGTGCTGCTATAACTGTGGGAAGCCGGGCCACCTTGCCCGTGACTGTGAGCACGCTGATGAACAGAAGTGCTATTCTTGTGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGATACTGGCCACGTGGCCATCAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAG
  5   1   2       bld Gas3      in                      xlnga001k02.5p                                                                                                                                                    CGCGAGGCGGGACGCTGGGTCACTGGTCTGATTGGGTGACCCGTCGAGACGTCGTGCGCAGCCAGTCGGGTATTTTGAGGCCGTGTGCAAACCGCGTGTGGCGCAGAGGAACGGAGACCGGGACGAAAACTTCTCTGAAACCATGAGCAGCAACGAGTGCTTCAAGTGCGGCCGCACTGGTCACTGGGCAAGAGAGTGCCCAACTGGAGGAGGACGTGGCCGTgggggggggAGAGGCAGAGGCCGTGGGGGGTTCAGCTCGTCTAGAGGTTTCCAATTCATTTCTTCATCTCTTCCAGACATCTGCTACCGCTGTGGGGAGTCTGGCCACCTTGCTAAGGATTGTGATCTGCAGG
  5   1   2       bld Ga18                              xlk151h11ex.5p                                                                                                                                                                                                      TCACTGGTCTGATTGGGTGACCCGTCGAGACGTCGTGCGCNGNNGNCGGGTATTTTGAGGCCGTGTNNAAACCGCGTGTGGNGNAGAGGAACGGAGACCGGGACGAAAACTTCTCTGAAACCATGAGCAGCAACGAGTGCTTCAAGNGCGG
  5   1   2       bld Ga12      in                         XL213k14.5p                                                                                                                                                                                                            CGCAGCCAGTCGGGTATTTTGAGGCCGTGTGCAAACCGCGTGTGGCGCAGAGGAACGGAGACCGGGACGAAAACTTCTCTGAAACCATGAGCAGCAACGAGTGCTTCAAGTGCGGCCGCACTGGTCACTGGGCAAGAGAGTGCCCAACTGGAGGAGGACGTGGCCGTgggggggggAGAGGCAGAGGCCGTGGGGGGTTCAGCTCGTCTAGAGGTTTCCAATTCATTTCTTCATCTCTTCCAGACATCTGCTACCGCTGTGGGGAGTCTGGCCACCTTGCTAAGGATTGTGATCTGCAGGAGGATGCTTGCTATAACTGTGGCAGAGGTGGGCATATTGCCAAGGACTGTAAGGAGCCCAGGAAAGAGCGGGAGCAGTGCTGCTATAACTGTGGGAAGCCGGGCCACCTTGCCCGTGATTGTGACCACGCTGATGAACATAAGTGCTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGAGACTGGCCACGTGGCCATTAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAG
  5   1   2       bld DMZ  5g3  in                         xl228p10.5p                                                                                                                                                                                                                    GTGCGTTGAGGCCGTGTGCAAACCGCGTGTGGCGCAGCGCAGGAGAACGGAGACCGGGACGAAAACTTCTCTGAAACCATGAGCAGCAACGAGTGCTTCAAGTGCGGCCGCACTGGTCATTGGGCAAGAGAGTGCCCAACTGGAGGAGGACGTGGCCGTgggggggggAGAGGCAGAGGTCGTGGGGGCTTCAGCTCATCTAGAGGTTTCCAATTCATTTCTTCATCTCTTCCAGACATCTGCTACCGCTGTGGGGAGTCTGGCCACCTTGCTAAGGATTGTGATCTGCAGGAGGATGCTTGCTATAACTGTGGCAGAGGTGGGCATATTGCCAAGGACTGTAAGGAGCCCAGGAAAGAGAGGGAGCAGTGCTGCTATAACTGTGGGAAGCCGGGCCACCTTGCCCGTGACTGTGAGCACGCTGATGAACAGAAGTGCTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGATACTGGCCACGTGGCCATCAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGCCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAG
  5   1   2       bld DMZ  5g3  in                         xl292f04.5p                                                                                                                                                                                                                    GTGCGTTGAGGCCGTGTGCAAACCGCGTGTGGCGCAGCGCAGGAGAACGGAGACCGGGACGAAAACTTCTCTGAAACCATGAGCAGCAACGAGTGCTTCAAGTGCGGCCGCACTGGTCATTGGGCAAGAGAGTGCCCAACTGGAGGAGGACGTGGCCGTgggggggggAGAGGCAGAGGTCGTGGGGGCTTCAGCTCATCTAGAGGTTTCCAATTCATTTCTTCATCTCTTCCAGACATCTGCTACCGCTGTGGGGAGTCTGGCCACCTTGCTAAGGATTGTGATCTGCAGGAGGATGCTTGCTATAACTGTGGCAGAGGTGGGCATATTGCCAAGGACTGTAAGGAGCCCAGGAAAGAGAGGGAGCAGTGCTGCTATAACTGTGGGAAGCCGGGCCACCTTGCCCGTGACTGTGAGCACGCTGATGAACAGAAGTGCTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGATACTGGCCACGTGGCCATCAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGCCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAGTCCTCTTCACTTGCCAAAGGTTGGCAGATAGAGCTATTCCCAGGCCG
  5   1   2       bld DMZ  5g3  in                         xl331k21.5p                                                                                                                                                                                                                            AGGCCGTGTGCAAACCGCGTGTGGCGCAGCGCAGGAGAACGGAGACCGGGACGAAAACTTCTCTGAAACCATGAGCAGCAACGAGTGCTTCAAGTGCGGCCGCACTGGTCATTGGGCAAGAGAGTGCCCAACTGGAGGAGGACGTGGCCGTgggggggggAGAGGCANAGGTCGTGGGGGCTTCAGCTCGTCTAGAGGTTTCCAATTCATTTCTTCATCTCTTCCAGACATCTGCTACCGCTGTGGGGAGTCTGGCCACCTTGCTAAGGATTGTGATCTGCAGGAGGATGCTTGCTATAACTGTGGCAGAGGTGGGCATATTGCCAAGGACTGTAAGGAGCCCAGGAAAGAGAGGGAGCAGTGCTGCTATAACTGTGGGAAGCCGGGCCACCTTGCCCGTGACTGTGAGCACGCTGATGAACAGAAGTGCTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGATACTGGCCACGTGGCCATCAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGCCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAGTCCTCTTCACTTGCCAAAGGTTGGCAGATANAGCTATTCCC
  5   1   2       bld Neu7      in                         XL017i24.5p                                                                                                                                                                                                                                                     CGCACGAGGGAACGGAGNACCGGGNACGAAAACTTCTCTGAAACCATGAGCAGCAACGAGTGCTTCAAGTGCGGCCGCACTGGTCACTGGGCAAGAGAGTGCCCAACTGGAGGAGGACGTGGCCGTgggggggggAGAGGCAGAGGCCGTGGGGGGTTCAGCTCGTCTAGAGGTTTCCAATTCATTTCTTCATCTCTTCCAGACATCTGCTACCGCTGTGGGGAGTCAGGCCACCTTGCTAAGGATTGTGATCTGCAGGAGGATGCTTGCTATAACTGTGGCAGAGGTGGGCATATTGCCAAGGACTGTAAGGAGCCCAGGAAAGAGAGGGAGCAGTGCTGCTATAACTGTGGGAAGCCGGGCCACCTTGCCCGTGATTGTGACCACGCTGATGAACATAAGTGCTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGAGACTGGCCACGTGGCCATTAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGGCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTC
  5   1   2       bld Tbd7      in                         XL085o21.5p                                                                                                                                                                                                                                                          ACGAGGGCAAACCGCGTGTGGCGCAGCGCAGGNAGNAACGGAGTACCGGGACGAAAACTTCTCTGAAACCATGAGCAGCAACGAGTGCTTCAAGTGCGGCCGCACTGGTCATTGGGCAAGAGAGTGCCCAACTGGAGGAGGACGTGGCCGTgggggggggAGAGGCAGAGGTCGTGGGGGCTTCAGCTCATCTAGAGACATCTGCTACCGCTGTGGGGAGTCTGGCCACCTTGCTAAGGATTGTGATCTGCAGGAGGATGCTTGCTATAACTGTGGCAGAGGTGGGCATATTGCCAAGGACTGTAAGGAGCCCAGGAAAGAGAGGGAGCAGTGCTGCTATAACTGTGGGAAGCCGGGCCACCTTGCCCGTGACTGTGAGCACGCTGATGAACAGAAGTGCTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGATACTGGCCACGTGGCCATCAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGCCACCTGGCACGGGAATGCACCATTGAAGCC
  5   1   2       bld DMZ       in                         xl301n07.5p                                                                                                                                                                                                                                                                 GCCGTGTGCAAACCGCGTGTGGCGCAGAGGAACGGAGACCGGGACGAAAACTTCTCTGAAACCATGAGCAGCAACGAGTGCTTCAAGTGCGGCCGCACTGGTCACTGGGCAAGAGAGTGCCCAACTGGAGGAGGACGTGGCCGTgggggggggAGAGGCAGAGGCCGTGGGGGGTTCAGCTCGTCTAGAGACATCTGCTACCGCTGTGGGGAGTCTGGCCACCTTGCTAAGGATTGTGATCTGCAGGAGGATGCTTGCTATAACTGTGGCAGAGGTGGGCATATTGCCAAGGACTGTAAGGAGCCCAGGAAAGAGCGGGAGCAGTGCTGCTATAACTGTGGGAAGCCGGGCCACCTTGCCCGTGATTGTGACCACGCTGATGAACATAAGTGCTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGAGACTGGCCACGTGGCCATTAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGGCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAGTCCTCTTCACTGGCCAAAGGTTGGCAGATAGAGCTATTCCCAGGCCGTGAGCTTTACTTGACGTGTA
  5   1   2       bld Tbd7      in                         XL095f22.5p                                                                                                                                                                                                                                                                    CGGAGACCGGGACGAAAACTTCTCTGAAACCTGAGCAGCAACGAGTGCTTCAAGTGCGGCCGCACTGGTCACTGGGCAAGAGAGTGCCCAACTGGAGGAGGACGTGGCCGCgggggggggAGAGGCAGAGGCCGTGGGGGGTTCAGCTCGTCTAGAGGTTTCCAATTCATTTCTTCATCTCTTCCAGACATCTGCTACCGCTGTGGGGAGNNTGGCCACCTTGCTAAGGATTGTGATCTGCAGGAGGATGCTTGCTATAACTGTGGCAGAGGTGGGCATATTGCCAAGGACTGTAAGGAGCCCAGGAAAGAGCGGGAGCAGTGCTGCTATAACTGTGGGAAGCCGGGCCACCTTGCCCGTGATTGTGACCACGCTGATGAACATAAGTGCTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGAGACTGGCCACGTGGCCATTAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGGCACC
  5   1   2       bld DMZ       in                         xl296i21.5p                                                                                                                                                                                                                                                                                 gagagagagaggagaACGGAGACCGGGACGAAAACTTCTCTGAAACCATGAGCAGCAACGAGTGCTTCAAGTGCGGCCGCACTGGTCATTGGGCAAGAGAGTGCCCAACTGGAGGAGGACGTGGCCGTgggggggggAGAGGCAGAGGTCGTGGGGGCTTCAGCTCATCTAGAGACATCTGCTACCGCTGTGGGGAGTCTGGCCACCTTGCTAAGGATTGTGATCTGCAGGAGGATGCTTGCTATAACTGTGGCAGAGGTGGGCATATTGCCAAGGACTGTAAGGAGCCCAGGAAAGAGAGGGAGCAGTGCTGCTATAACTGTGGGAAGCCGGGCCACCTTGCCCGTGACTGTGAGCACGCTGATGAACAGAAGTGCTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGATACTGGCCACGTGGCCATCAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGCCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAGTCCTCTTCACTTGCCAAAGGTTGGCAGATAGAGCTATTCCCAGGCCGTGAGCTTTACTTGACGTGTAAAAGGAGGAAAGG
  5   1   2       bld DMZ       in                         xl308o07.5p                                                                                                                                                                                                                                                                                 gagagagagaggagaACGGAGACCGGGACGAAAACTTCTCTGAAACCATGAGCAGCAACGAGTGCTTCAAGTGCGGCCGCACTGGTCATTGGGCAAGAGAGTGCCCAACTGGAGGAGGACGTGGCCGTgggggggggAGAGGCAGAGGTCGTGGGGGCTTCAGCTCATCTAGAGACATCTGCTACCGCTGTGGGGAGTCTGGCCACCTTGCTAAGGATTGTGATCTGCAGGAGGATGCTTGCTATAACTGTGGCAGAGGTGGGCATATTGCCAAGGACTGTAAGGAGCCCAGGAAAGAGAGGGAGCAGTGCTGCTATAACTGTGGGAAGCCGGGCCACCTTGCCCGTGACTGTGAGCACGCTGATGAACAGAAGTGCTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGATACTGGCCACGTGGCCATCAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGCCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAGTCCTCTTCACTTGCCAAAGGTTGGCAGATAGAGCTATTCCCAGGCCGTGAGCTTTACTTGACGTGT
  5   1   2       bld Tbd7      in                         XL072l09.5p                                                                                                                                                                                                                                                                                     TCTCTGAAACCATGNAGCAGCAACGAGTGCTTCAAGTGCGGCCGCACTGGTCACTGGGCAAGAGAGTGCCCAACTGGNAGGAGGACGTGGCCGTgggggggggAGAGGCAGAGGCCGTGGGGGGTTCAGCTCGTCTAGAGGTTTCCAATTCATTTCTTCATCTCTTCCAGACATCTGCTACCGCTGTGGGGAGTCTGGCCACCTTGCTAAGGATTGTGATCTGCAGGAGGATGCTTGCTATAACTGTGGCAGAGGTGGGCATATTGCCAAGGACTGTAAGGAGCCCAGGAAAGAGCGGGAGCAGTGCTGCTATAACTGTGGGAAGCCGGGCCACCTTGCCCGTGATTGTGACCACGCTGATGAACATAAGTGCTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGAGACTGGCCACGTGGCCATTAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGGCACCTG
  5   1   2       bld Neu7      in                         XL049j13.5p                                                                                                                                                                                                                                                                                                               NAAAACTTCTCTGAAACCTGAGCAGCAACGAGTGCTTCAAGTGCGGCCGCACTGGTCATTGGGCAAGAGAGTGCCCAACTGGAGGAGGACGTGGCCGTgggggggggAGAGGCAGAGGTCGTGGGGGCTTCAGCTCGTCTAGAGACATCTGCTACCGCTGTGGGGAGTCTGGCCACCTTGCTAAGGATTGTGATCTGCAGGAGGATGCTTGCTATAACTGTGGCAGAGGCGGGCATATTGCCAAGGACTGTAAGGAGCCCAGGAAAGAGAGGGAGCAGTGCTGCTATAACTGTGGGAAGCCGGGCCACCTTGCCCGTGACTGTGAGCACGCTGATGAACAGAAGTGCTATTCTTGTGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGATACTGGCCACGTGGCCATCAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGCCACCTGGCACGGGAATGCACCATTGAAGCCA
  5   1   2       bld Tbd7      in                         XL083n10.5p                                                                                                                                                                                                                                                                                                                GTGCTTCAAGTGCGGCCGCACTGGTCACTGGGCAAGAGAGTGCCCAACTGGAGGAGGACGTGGCCGTgggggggggAGAGGCAGAGGCCGTGGGGGGTTCAGCTCGTCTAGAGGTTTCCAATTCATTTCTTCATCTCTTCCAGACATCTGCTACCGCTGTGGGGAGTCTGGCCACCTTGCTAAGGATTGTGATCTGCAGGAGGATGCTTGCTATAACTGTGGCAGAGGTGGGCATATTGCCAAGGACTGTAAGGAGCCCAGGAAAGAGCGGGAGCAGTGCTGCTATAACTGTGGGAAGCCGGGCCACCTTGCCCGTGATTGTGACCACGCTGATGAACATAAGTGCTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGAGACTGGCCACGTGGCCATTAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGGCACCTGGCACGGGAATGCACC
  3   1   2      seed Ga12      in                         XL210d13.3p                                                                                                                                                                                                                                                                                                                                           CTGGGCAAGAGAGTGCCCAACTGGAGGAGGACGTGGCCGTGGGGGGGGGAGAGGCAGAGGCCGTGGGGGGTTCAGCTCGTCTAGAGGTTTCCAATTCATTTCTTCATCTCTTCCAGACATCTGCTACCGCTGTGGGGAGTCTGGCCACCTTGCTAAGGATTGTGATCTGCAGGAGGATGCTTGCTATAACTGTGGCAGAGGTGGGCATATTGCCAAGGACTGTAAGGAGCCCAGGAAAGAGCGGGAGCAGTGCTGCTATAACTGTGGGAAGCCGGGCCACCTTGCCCGTGATTGTGACCACGCTGATGAACATAAGTGCTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGAGACTGGCCACGTGGCCATTAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGGCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAGTCCTCTTCACTGGCCAAAGGTTGGCAGATAGAGCTATTCCCAGGCCGTGAGCTTTACTTGACGTGTAAAAGGAGGAAAGGGGTGGAAACTATAAAAAAAACGAC
  5   1   2       bld DMZ       in                         xl299o19.5p                                                                                                                                                                                                                                                                                                                                                          CCCAACTGGAGGAGGACGTGGCCGTgggggggggAGAGGCAGAGGTCGTGGGGGCTTCAGCTCGTCTAGAGGTTTCCAATTCATTTCTTCATCTCTTCCAGACATCTGCTACCGCTGTGGGGAGTCTGGCCACCTTGCTAAGGATTGTGATCTGCAGGAGGATGCTTGCTATAACTGTGGCAGAGGTGGGCATATTGCCAAGGACTGTAAGGAGCCCAGGAAAGAGAGGGAGCAGTGCTGCTATAACTGTGGGAAGCCGGGCCACCTTGCCCGTGACTGTGAGCACGCTGATGAACAGAAGTGCTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGATACTGGCCACGTGGCCATCAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGCCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAGTCCTCTTCACTTGCCAAAGGTTGGCAGATAGAGCTATTCCCAGGCCGTGAGCTTTACTTGACGTGTAAAAGGAGGAAAGGGGTGGAAACAAAAAAATGACTTTCTGCATTTAACaaaaaaaaaTGTTTATGTTTAGT
  3   1   2       bld Neu7      in                         XL017i24.3p                                                                                                                                                                                                                                                                                                                                                                              CCGTGGGGGGGGGAGAGGCAGAGGCCGTGGGGGGTTCAGCCTCGTCTAGAGGTTTCCAATTCATTTCTTCATCTCTTCCAGACATCTGCTACCGCTGTGGGGAGTCAGGCCACCTTGCTAAGGATTGTGATCTGCAGGAGGATGCTTGCTATAACTGTGGCAGAGGTGGGCATATTGCCAAGGACTGTAAGGAGCCCAGGAAAGAGAGGGAGCAGTGCTGCTATAACTGTGGGAAGCCGGGCCACCTTGCCCGTGATTGTGACCACGCTGATGAACATAAGTGCTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGAGACTGGCCACGTGGCCATTAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGGCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAGTCCTCTTCACTGGCCAAAGGTTGGCAGATAGAGCTATTCCCAGGCCGTGAGCTTTACTTGACGTGTAAAAGGAGGAAAGGGGNGAAACTATAAAAAAAACGA
  5   1   2       bld DMZ       in                         xl299c04.5p                                                                                                                                                                                                                                                                                                                                                                                      GGGGGGAGAGGCAGAGGCCGTGGGGGGTTCAGCTCGTCTAGAGGTTTCCAATTCATTTCTTCATCTCTTCCAGACATCTGCTACCGCTGTGGGGAGTCTGGCCACCTTGCTAAGGATTGTGATCTGCAGGAGGATGCTTGCTATAACTGTGGCAGAGGTGGGCATATTGCCAAGGACTGTAAGGAGCCCAGGAAAGAGCGGGAGCAGTGCTGCTATAACTGTGGGAAGCCGGGCCACCTTGCCCGTGATTGTGACCACGCTGATGAACATAAGTGCTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGAGACTGGCCACGTGGCCATTAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGGCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAGTCCTCTTCACTGGCCAAAGGTTGGCAGATAGAGCTATTCCCAGGCCGTGAGCTTTACTTGACGTGTAAAAGGAGGAAAGGGGTGGAAACTATaaaaaaaacgactttctgcatttaacaaaaaaaaaa
  5   1   2       bld Tbd7      in                         XL089h21.5p                                                                                                                                                                                                                                                                                                                                                                                                          TGGGGGGTTCACCTCGTCTAGAGGTTTCCAATTCATTGCTTCATCTCTTCCAGACATCTGCTACCGCTGTGGGGAGTCTGGCCACCTTGCTAAGGATTGTGATCTGCAGGAGGATGCTTGCTATAACTGTGGCAG
  5   1   2       bld Lmb1                            IMAGE:8531909.5p                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAATTCCTGATGNNGNANAAAGTACCTAAATAAATTCGTCCCTGGCCACCTTGCTAAGGATTGTGATCTGCACGTTGATGCTTGCTATAACTGTGGCAGAGGTGGGCATATTGCCTATGACTGTAAGGAGCCCAGGAAAGAGAGGGAGCAGTGCTGCTATAACTGTGGGAAGCCGGGCCACCTTGCCCGTGACTGTGAGCACGCTGATGAACAGAAGTGCTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGATACTGGCCACGTGGCCATCAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGCCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAGTCCTCTTCACTTGCCAAAGGTTGGCTTTATTAcccccccccAGGCCGTGAGCTTTACTTGACGTGTAAAAGGAGGAAAGGGGTGGAAACAAAAAAATGACTTTCTGCATTTAACaaaaaaaaaTGTTTATGTTTAGTTTGGTAGAGGTGTAATGTATAATGCTTTGTTCAAGAACCCCCTTTCTGGACCACTGGTACTAGGGATTTCAATGGGAAGAGTCAGGTCAGTAGGACCCCCCAAGGGTAGCAGGAATTTGGCAGAGCACCTGCTCCACATGGAAAAGTGGCTTGGAGTTTCTGCACAACTTCCACCATTGAT
  5   1   2       bld Ga15      in                       XL487l22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCAGACATCTGCTACCGCTGTGGGGAGTCTGGCCACCTTGCTAAGGATTGTGATCTGCAGGAGGATGCTTGCTATAACTGTGGCAGAGGTGGGCATATTGCCAAGGACTGTAAGGAGCCCAGGAAAGAGCGGGAGCAGTGCTGCTATAACTGTGGGAAGCCGGGCCACCTTGCCCGTGATTGTGACCACGCTGATGAACATAAGTGCTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGAGACTGGCCACGTGGCCATTAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGGCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAGTCCTCTTCACTGGCCAAAGGTTGGCAGATAGAGCTATTCCCAGGCCGTGAGCTTTACTTGACGTGTAAAAGGAGGAAAGGGGTGGAAACTATaaaaaaaacgactttctgcatttaacaaaaaaaaaa
  5   1   2       bld Bone      in                    IMAGE:8739600.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACATCTGCTACCGCTGTGGGGAGTCTGGCCACCTTGCTAAGGATTGTGATCTGCAGGAGGATGCTTGCTATAACTGTGGCAGAGGTGGGCATATTGCCAAGGACTGTAAGGAGCCCAGGAAAGAGCGGGAGCAGTGCTGCTATAACTGTGGGAAGCCGGGCCACCTTGCCCGTGATTGTGACCACGCTGATGAACATAAGTGCTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGAGACTGGCCACGTGGCCATTAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGGCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAGTCCTCTTCACTGGCCAAAGGTTGGCAGATAGAGCTATTCCCAGGCCGTGAGCTTTACTTGACGTGTAAAAGGAGAAAGGGTGGAAACTATaaaaaaaacgactttctgcatttacaaaaaaaaaaaTGTTTATTGTTTAGTTTGGTAGAGTGTTATGTATATGCTTGTAAAGAACCCCTTCATGGCCTGTGACTAGGAATTCCATGAAGCTGGATTCGGCAGTAGAACCACCAGGCACACCAATGGCGATGTCTGTCTCAGACGAATGGAATTCCGGAAACTCGCATGATTTTAACGTCATGCAACTCGCGGTTATACGA
  5   1   2       bld FaBN                            IMAGE:8077356.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCCACCTTGCTAAGGATTGTGATCTGCAGGAGGATGCTTGCTATAACTGTGGCAGAGGTGGGCATATTGCCAAGGACTGTAAGGAGCCCAGGAAAGAGCGGGAGCAGTGCTGCTATAACTGTGGGAAGCCGGGCCACCTTGCCCGTGATTGTGACCACGCTGATGAACATAAGTGCTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGAGACTGGCCACGTGGCCATTAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGGCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAGTCCTCTTCACTGGCCAAAGGTTGGCAGATAGAGCTATTCCCAGGCCGTGAGCTTTACTTGACGTGTAAAAGGAGGAAAGGGGTGGAAACTATaaaaaaaacgactttctgcatttaacaaaaaaaaaaaTGTTTATGTTTAGTTTGGTAGAGGTGTTATGTATAATGCTTTGTTAAAGAACCCCCTTTCCATGCCCTGGTGACTAGGGGATTTCATGGAAAGAGTTGAGTCGGGCCAGTAGGAGCCCACCCAGGGCAGCAGCAATTTGGCAGATAGTCTGCTCCAGGGAAAAGCGATTGGAAGTTTCCGCTGAACTTCCGCAATTGAttttttttttttACGGTCTCATTGGCCGACTCGGCTGTTATAACGT
  5   1   2       bld Ga14                               Ga14-p6b11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCTTGCTAAGGATTGTGATCTGCAGGAGGATGCTTGCTATAACTGTGGCAGAGGTGGGCATATTGCCAAGGACTGTAAGGAGCCCAGGAAAGAGCGGGAGCAGTGCTGCTATAACTGTGGGAAGCCGGGCCACCTTGCCCGTGATTGTGACCACGCTGATGAACATAAGTGCTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACACGTGTGGGGAGATTGGCCACGTGGCCATTAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGGCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGAT
  5  -1   2       bld Egg1                               PBX0092E10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTAAGGAGCCCAGGAAAGAGCGGGAGCAGTGCTGCTATAACTGTGGGAAGCCGGGCCACCTTGCCCGTGATTGTGACCACGCTGATGAACATAAGTGCTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGAGACTGGCCACGTGGCCATTAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGGCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAGTCCTCTTCACTGGCCAAAGGTTGGCAGATAGAGCTATTCCCAGGCCGTGAGCTTTACTTGACGTGTAAAAGGAGGAAAGGGGTGGAAACTATaaaaaaaacgactttctgcatttaacaaaaaaaaaaaaaaaaaaGATTCGC
  5  -1   2       bld Egg1                               PBX0121H01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTAAGGAGCCCAGGAAAGAGCGGGAGCAGTGCTGCTATAACTGTGGGAAGCCGGGCCACCTTGCCCGTGATTGTGACCACGCTGATGAACATAAGTGCTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGAGACTGGCCACGTGGCCATTAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGGCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAGTCCTCTTCACTGGCCAAAGGTTGGCAGATAGAGCTATTCCCAGGCCGTGAGCTTTACTTGACGTGTAAAAGGAGGAAAGGGGTGGAAACTATaaaaaaaacgactttctgcatttaacaaaaaaaaaaaaaaaaaaGATTCGCCCTCGTGCC
  5  -1   2       bld Egg1                               PBX0155H09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAAGGAGCCCAGGAAAGAGCGGGAGCAGTGCTGCTATAACTGTGGGAAGCCGGGCCACCTTGCCCGTGATTGTGACCACGCTGATGAACATAAGTGCTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGAGACTGGCCACGTGGCCATTAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGGCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAGTCCTCTTCACTGGCCAAAGGTTGGCAGATAGAGCTATTCNCAGGCCGTGAGCTTTACTTGACGTGTAAAAGGAGGAAAGGGGTGGAAACTATaaaaaaaaCGACTTTCT
  3   1   2       bld Ga18      in                       xlk70l03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCAGGAAAGAGCGGGAGCAGTGCTGCTATAACTGTGGGAAGCCGGGCCACCTTGCCCGTGATTGTGACCACGCTGATGAACATAAGTGCTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGAGACTGCCACGTGGCCATTAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGGCACCTGGCACGGGAATGCACCATTGAANCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAGTCCTCTTCACTGGCCAAAGGTTGGCAGATAGAGCTATTCCCAGGCCGTGAGCTTTACTTGACGTGTAAAAGGAGGAAAGGGGTNGAANCNA
  5   1   2       bld Ga18      in                       xlk70l03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCAGGAAAGAGCNNNNNNTNNTGCTATAACTGTGGGAAGNCGGNNCACCTTGCCCGTGATTGTGACCACGCTGATGAACATAAGTGCTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGAGACTGGCCACGTGGCNNNTAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGGCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAGTCCTCTTCACTGGCCAAAGGTTGGCAGATAGAGCTATTCCCAGGCCGTGAGCTTTACTTGACGTGTAAAAGGAGGAAAGGGGTGGAAACTATAAAAAAAACGACTTTCTGCATTTAACaaaaaaaaaa
  5   1   2       bld Ga12      in                         XL141n20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGGGAGCAGTGCTGCTATAACTGTGGGAAGCCGGGCCACCTTGCCCGTGACTGTGAGCACGCTGATGAACAGAAGTGCTATTCTTGTGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGATACTGGCCACGTGGCCATCAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGCCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAAAATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAGTCCTCTTCACTTGCCAAAGGTTGGCAGATAGAGCTATTCCCAGGCCGTGAGCTTTACTTGACGTGTAAAAGGAGGAAAGGGGTGGAAACAAAAAAATGACTTTCTGCATTTAACaaaaaaaaaTGTTTATGTTTAGTTTGGTAGAGGTGTAATGTATAATGCTTTGTTCAAGAACCCCCTTTCCGGACCACTGGTACTAGGGATTTCAATGGGAAGAGTCAGGTCAGTAGGACCCCCCAAGGGGAGCAGGAATTTGGCAGAGCACCTGCTCCAC
  5   1   2       bld Tbd1                                 AW765397.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTGGGAAGCCGGGCCACCTTGCCCGTGACTGTGAGCACGCTGATGAACAGAAGTGCTATTCTTGCGGAGAGTGAGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGATACTGGCCACGTGGCCATCAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGCCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAGTCCTCTTCACTTGCCAAAGGTTGGCAGATAGAGCTATTCCCAGGCCGTGAGCTTTACTTGACGTGTTAAAGGAGGAAAGGTGTGGAAACATAAAAATGACTTTCTGCATTTAACTAAAAACAAATGTTTGTTTAGTATGGTAGAGGTGTAATGTATAATGCGTTTGTTCCAGTAACCCCCCTTT
  5   1   2       bld Ga15      in                       XL494h23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCCGGGCCACCTTGCCCGTGATTGTGACCACGCTGATGAACATAAGTGCTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGAGACTGGCCACGTGGCCATTAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGGCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAGTCCTCTTCACTGGCCAAAGGTTGGCAGATAGAGCTATTCCCAGGCCGTGAGCTTTACTTGACGTGTAAAAGGAGGAAAGGGGTGGAAACTATaaaaaaaacgactttctgcatttaacaaaaaaaaaa
  3   1   2       bld Gas3      in                      xlnga001k02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCGGGCCACCTTGCCCGTGATTGTGACCACGCTGATGAACATAAGTGCTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGAGACTGGCCACGTGGCCATTAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGGCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAGTCCTCTTCACTGGCCAAAGGTTGGCAGATAGAGCTATTCCCAGGCCGTGAGCTTTACTTGACGTGTAAAAGGAGGAAAGGGGTGGAAACTATAAAAAAAACGACTTTCTGCATTTAACAA
  5   1   2       chi Emb4                            IMAGE:5542789.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGATCAGGACGTACAGGAAGAGCTGGACGCACAGGTGTCTGCATATCCCTTTATGAACCATGGGAAAAGCATTATCTCAGGAATGTGGAGAGTCGGGGCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAGTCCTCTTCACTGGCCAAAGGTTGGCAGATAGAGCTATTCCCAGGCCGTGAGCTTTACTTGACGTGTAAAAGGAGGAAAGGGGTGGAAACTATaaaaaaaacgactttctgcatttaacaaaaaaaaaaaaTGTTTATGTTTAGTTTGGTAGAGGTGTTATGTATAATGCTTTGTTAAAGAACCCCCTTTCCATGCCCTGGTGACTAGGGATTTCAATGGAAAGAGTTGAGTCGGGCCAGTACGAGCCCACCCAGGGCAGCAGCAATTTGGCAGATAGTCTGCTCCAGGGAAAAGCGATTGGAAGTTTCCGCTGAACTTCCCCCAGCTGAttttttttCTTTGTCCGCGCTGGGGTGGGCGGCCACCGAATGCCAATAACCCAGGACTGGGTGCGGCCCTGGGGCAAGGCGCCAAGGGCGAGACGGCGCGCTCAGTGGGCCAGGTGGGCCCACGGCGGGAACGGCAAAATATCGATGGAGGCTGGGAAACACCCCGTGAAGAGAGACACGCCAGGGTTCAGGGGGCCCGCGCGCGGGGCTCGCATGCAGGCCGCGGAAGGCGGTCGAGGGGGCACAAGGGGGG
  5   1   2       bld Ga18                              xlk101b21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGCCACCTTGCCCGTGATTGTGACCACGCTGATGAACATAAGTGCTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGAGACTGGCCACGTGGCNNTAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGGCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAGTCCTCTTCACTGGCCAAAGGTTGGCAGATAGAGCTATTCCCAGGCCGTGAGCTTTACTTGACGTGTAAAAGGAGGAAAGGGGTGGAANNTATaaaaaaaacgactttctgcatttaacaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL487l22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GNNCATAAGTGNTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGAGACTNGCCACGTGGCCANTANCTGCAGCAAAACCAGTGAAGTCAACTGTTACCNCTGCGGAGAGTCGGGGCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTNGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAGTCCTCTTCACTGGCCAAAGGGTTGGCAGATATGANAATATTNCCCAGGCCGTGAGCTTTA
  3   1   2       bld Ga15      in                       XL494h23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGCTATTCTTGCGGAGAGTTTGGACACATCCAGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGAGACTGGCCACGTGGCCATTAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGGCACCTGGCACGGGAATGCACCATTGAAGCCACCGCNTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTACTGAGTCCTCTTCACTGGCCAAATGGTTGGCATGATAGACNCTATTNCC
  5   1   2       bld Ga15      in                       XL509g12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGATACTGGCCACGTGGCCATCAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGCCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAGTCCTCTTCACTTGCCAAAGGTTGGCAGATAGAGCTATTCCCAGGCCGTGAGCTTTACTTGACGTGTAAAAGGAGGAAAGGGGTGGAAACAAAAAAATGACTTTCTGCATTTAACaaaaaaaaaTGTTTATGTTTAGTTTGGTAGAGGTGTAATGTATAATGCTTTGTTCAAGAACCCCCTTTCCGGACCACTGGTACTAGGGATTTCAATGGGAAGAGTCAGGTCAGTAGGACCCCCCAAGGGGAGCAGGAATTTGGCAGAGCACCTGCTCCACATGGAAAAGTGGCTGGAAGTTTCTGCACAACTTCCACCAATTGATCTTTTTAGCCGGTCTCATTGGCCGACCTCGGCTCTTCATAAGTGTATGGGGGGGCAACACGTCAACATCANCCAGTGGCCCCATCGCAGCTCACTCTGCCGAAGCAGAAATTTGGCCACTGGGTTAGTATTTGAGATTCGGGTGGAAAAATCTGAACGANAttttttttttttttNTT
  5   1   2       bld Ga15      in                       XL510g12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGAAGGACTGCACCAAAGTGAAATGTTACAGGTGTGGGGATACTGGCCACGTGGCCATCAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGCCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAGTCCTCTTCACTTGCCAAAGGTTGGCAGATAGAGCTATTCCCAGGCCGTGAGCTTTACTTGACGTGTAAAAGGAGGAAAGGGGTGGAAACAAAAAAATGACTTTCTGCATTTAACaaaaaaaaaTGTTTATGTTTAGTTTGGTANAGGTGTAATGTATAATGCTTTGTTCAAGAACCCCCTTTCCGGACCACTGGTACTAGGGATTTCAATGGGAAGAGTCAGGTCAGTAGGACCCCCCAAGGGGAGCAGGAATTTGGCAGAGCACCTGCTCCACATGGAAAAGTGGCTGGAAGTTTCTGCACAACTTCCACCAATTGATCTTTTTAGCCGGTCTCATTGGCCGACCTCGGCTCTTCATAAGTGTATGGGGGGGCAACACNTCAACATCANCCAGTGGCCCCATCGCAGCTCACTCTGCCGAA
  3   1   2       bld Neu7                                 XL041d07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GACTGCACCAAAGTGAAATGTTACAGGTGTGGGGAGACTGGCCACGTGGCCATTAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGGCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAGTCCTCTTCACTGGCCAAAGGTTGGCAGATAGAGCTATTCCCAGGCCGTGAGCTTTACTTGACGTGTAAAAGGAGGAAAGGGGTGAAACTATAAAAAAAACGA
  5   1   2       bld Ga15      ?                        XL480n24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGCGTCCGATTTTCAGGTGTGGGGATACTGGCCACGTGGCCATCAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGCCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAGTCCTCTTCACTTGCCAAAGGTTGGCAGATAGAGCTATTCCCAGGCCGTGAGCTTTACTTGACGTGTAAAAGGAGGAAAGGGGTGGAAACAAAAAAATGACTTTCTGCATTTAACaaaaaaaaaTGTTTATGTTTAGTTTGGTAGAGGTGTAATGTATAATGCTTTGTTCAAGAACCCCCTTTCCGGACCACTGGTACTAGGGATTTCAATGGGAAGAGTCAGGTCAGTAGGACCCCCCAAGGGGAGCAGGAATTTGGCAGAGCACCTGCTCCACATGGAAAAGTGGCTGGAAGTTTCTGCACAACTTCCACCAATTGATCTTTTTAGCCGGTCTCATTGGCCGACCTCGGCTCTTCATAAGTGTATGGGGGGGCAACACGTCAACATCAGCCAGTGGCCCCATCGCAGCTCACTCTGCCGAAGCAGAAATTTGGCCACTGGGTTAGTATTTGAGATTCGGGTGGAANAATCTGAACGAGAttttttttttttttNTT
  5   1   2       add Ga18      in                      xlk125c05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGGGNTACTGGCCACGTNNNNNNAACTGCAGCAAAACCAGTGAAGTCAACTGTTACCGCTGCGGAGAGTCGGGCCACCTNNNNGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAGTCCTCTTCACTTGCCAAAGGTTGGCAGATAGAGCTATTCCCAGGCCGTGAGCTTTACTTGACGTGtaaaaggaggaaaggggnggaaacaaaaaaatgactttctgcatttaacaaaaaaaaaTGTTTATGTTTAGTTTGGTAGAGGTGTAATGTATAATGCTTTGTTCAAGAACCCCCTTTCCGGACCACTGGTACTAGGGATTTCAATGGGAAGAGNCAGGTCAGTAGGACCCCCCAAGGNNGCAGGAATTTGGCANNNNNCTGCTCCACATGGAAAAGTGGNTGGAAGTTTCTGCACAACTTCCACCNATTGATCTTTTTAGCCGGNCTCATTGGNCGACCTCGGNTCTTCATAAGTGTATGGGGNGNNNNACGTCAACATCAGCCAGTGGNCCCATCGCAGCTCACTCTGCCNGAAGCAGAAATTTGGCCACTGGGNTAGNATTTGAGANTCGGGTGGAAGAATCTGAACGAGAtttttttttttttttCTTCGTGGGNGTNAGATGGNAAAGGNGGAAGGNGCATCACGNNAGAGTGAAGC
  5   1   2       bld FaBN                            IMAGE:8078026.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AACCAGTGAAGTCAACTGTTACCGCCGCTGAGAGTCGGGGCACCTGGCACGGGAATGCACCATTGAAGCCACCGCTTAAATATCCTTCGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTCTTTTCTCTGAGTCCTCTTCACTGGCCAAAGGTTGGCAGATAGAGCTATTCCCAGGCCGTGAGCTTTACTTGACGTGTAAAAGGAGGAAAGGGGTGGAAACTATaaaaaaaacgactttctgcatttaacaaaaaaaaaaaTGTTTATGTTTAGTTTGGTAGAGGTGTTATGTATAATGCTTTGTTAAAGAACCCCCTTTCCATGCCCTGGTGACTAGGGATTTCAATGGAAAGAGTTGAGTCGGGCCAGTAGGAGCCCACCCAGGGCAGCTTCTATTTGGCTGATATTCCGCTCCAGGGAAAAGCAATTGGAAGTTTCCGCTGAAATTTCGCCAATTGAttttttttttttACGGTCTCATTGGCCGACCCCGGTTGTTTATAACGTTCAACTGTATCATGTCATGGTACAACGCAGAGGTTACAAATGTCAACATCGTCTAGTGGCCCCGGTGGATCTCTTTCTCTGGTTTTGAAATCATGCGAGAGATTCCtttttttttttCTTCTGCGAATCAAAGGCAATGTTTTCATGAACTCTACTTAAATATGTTATGATCAGTAAAAATGACTTTCAAAATTAAGAGGTTTTTTCTTCAAAATTCATTCGGACATGTATTTACTCGTTCTTCGATTTACATTGTTG
  3   1   2       bld Spl                             IMAGE:8463145.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACAACATGAATAATTTCCGGGGAGTGGGCACTGCAGGGATCCATGGAGCACGTTAAAATCTTGTGCCCTCTTTTTGGTGAAGGTGTATTTTTCTTGAGTCTTTCCTTGCAAAGGTTGCGATAGAGTATCCCAGGCCGTGAGCTTACTTGACGTTAAAAGGGGAAAGGGGGGAAACAAAAAATTGACTTTTTGCATTTACAAAAAAAAAATTTTTATGTTTAGTTTGGTAGAGGTGTAATGTATAATGCTTTGTTCAAGAACCCCCTTTCTGGACCACTGGTACTAGGGATTTCAATGGGAAGAGTCAGGTCAGTAGGACCCCCCCCAAGGGTAGCAGGAATTTGGCAGAGCTCCTGCTCCACATGGAAAAGTGGCTGGAAGTTTCTGCACAACTTCCACCAATTGATCTTTTTAGCCGGTCTCATTGGCCGACCTCGGCTCTTCATAAGTGTATGGGGGGGCAACACGTCAACATCAGCCAGTGGCCCCATCGCAGCTCACTCTGCCGAAGCAGAAATTTGGCCACTGGGTTAGTATTTGAGATTCGGGTGGAAGAATCTGAACGAGATTTTTTTTTTTTTTCTTTCGTGGGAGTGAGACGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTCGAAGCCCTTCCGGACGCTGCAGACAAATGACGTTTTCACAGAATCAAGACGTTATCTTTGTATAAGATATCACTCTAGGCAACTCGTCTGAGTTCACTTTGCTCGTAATCAGTCTTAACGTCGCGAACAGCTTCTACGTTGGCTTCACTCTCTCCGGAGCACCTCCGCCTTCCGTACCG
  3   1   2       bld Lmb1      in                    IMAGE:8532766.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACGGAATGCACCATGAGCCACCCGCTTAAATATCCTCGTCGCCCCTCCATTTTCTGATGATGTGTATCTTTTCTCTGAGTCCTCTCCCTGCCAAAGGTTGGCAGATAGAGCTATTCCCAGGCCGTGAGCTTTACTTGACGTGTAAAAGGAGGAAAGGGGTGGAAACAAAAAAATGACTTTCTGCATTTAACAAAAAAAAAATGTTTATGTTTAGTTTGGTAGAGGTGTAATGTATAATGCTTTGTTCAAGAACCCCCTTTCCGGACCACTGGTACTAGGGATTTCAATGGGAAGAGTCAGGTCAGTAGGACCCCCCAAGGGTAGCAGGAATTTGGCAGAGCACCTGCTCCACATGGAAAAGTGGCTGGAAGTTTCTGCACAACTTCCACCAATTGATCTTTTTAGCCGGTCTCATTGGCCGACCTCGGCTCTTCATAAGTGTATGGGGGGGCAACACGTCAACATCAGCCAGTGGCCCCATCGCAGCTCACTTTGCCGAAGCAGAAATTTGGCCACTGGGTTAGTATTTGAGATTCGGGTGGAAGAATTTGAACGAGATTTTTTTTTTTTTTCTTTCGTGGGAGTGAGATGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTCTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGCGAGGTACAAGAACCTTAACTTCACTCCCCCCGTCATGCACCTCCCGCTTTTCATCC
  3   1   2       bld Ga18      in                      xlk125c05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCNCNNNTTAAANNTCnnnnnnnnCCCNCCNTTTTTCTGATTGANGGTTGTATTCTTTTCTCTNNNTCCNNCNTCNCTTNCNNNNNGTTGGNAGATAGAGCTATTCCCANGCCGTGAGCTTTNCNTTNNGTGTAAAAGGAGGAAAGGGGTGGAAACAAAAAAATGACNTNNTGCATTNNACAAAAAAAAAATGTTTATGTTTAGTTTGGTAGAGGTGTAATGTATAATGCTTTGTTCAAGAACCCCCNTTCCGGNCCNCTGGTNNTAGGGATTTCAATNGGAAGAGTCAGGTCAGTAGGNCCCCAAGGGGAGCAGGAATTTGNCAGANNACCTGCTCCACATGGAAAAGTGGCTGGAAGTTTCTGCACAACTTCCNCCAATTGATCTTTTTAGCCGGTCTCATNNNNGNCCTCGGCTCTTCATAAGTGTATGGGGGGGCAACACGTCAACATNNNNAGTGGCCCCATCGCAGCTCACTNNGCCGAAGCAGAAATTTGGCCACTGGGTTAGTATTTGAGATTCGGGTGGAAGAATCTGAACGAGATTTTTTTTTTTTTTCTTTCGTGGGAGTGAGATGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAACATAGAAATGTA
  5  -1   2       bld Thy                             IMAGE:8549992.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCTCGGCGTAAGTTGGTGTCAGGCAGATCGTGACCATCTAGGCACAGATATTCGTGAGTGCCGCAGATCCTGACCGTAATCTGTGCTCTTTCATGAGTGATTTCTGATCTTCCTGCAAGTGCAGTAGAGTTCCAGCGTAGCTACTGAGGTAAGAGAAAGGGTGAACAAAAAGACTTTGCATTACAAAAAAATGTTAGTTAGTTGTAGAGGGTAAGTAAATGTTTGTCAAGACCCCCTNCTGGACCACTGGTACTAGGGATTCAATGGAAGAGTCAGGTCAGTAGGACCCCCCAAGGGTAGCAGGAATTTGGCAGAGCTCCTGCTCCACATGGAAAAGTGGCTGGAAGTTTCTGCACAACTTCCACCAATTGATCTTTTTAGCCGGTCTCATTGGCCGACCTCGGCTCTTCATAAGTGTATGGGGGGGCAACACGTCAACATCAGCCAGTGGCCCCATCGCAGCTCACTCTGCCGAAGCAGAAATTTGGCCACTGGGTTAGTATTTGAGATTCGGGTGGAAGAATCTGAACGAGAttttttttttttttCTTTCGTGGGAGTGAGACGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATAAGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAACATAGAAATGTAATTTTAAACTATCAATAAAGCTGGAGGAGGaaaaaaaaaaaGGGACGAATTGATTCATGACTCTC
  5  -1   2       bld Bone                            IMAGE:8741185.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCTGATGATGGCTGTATTCTTTCCTTGAGTCCTCTCACTGCCAAAGGTTGGCAGATAGAGCTATCCAGGCCGTGAGCTTACTTGACGTGTAAAAGGAGGAAAGGGGTGGAAACAAAAAAATGACTTTCTGCATTTAACaaaaaaaaaTGTTTATGTTTAGTTTGGTAGAGGTGTAATGTATAATGCTTTGTTCAAGAACCCCCTTTCTGGACCACTGGTACTAGGGATTTCAATGGGAAGAGTCAGGTCAGTAGGACCCCCCAAGGGTAGCAGGAATTTGGCAGAGCACCTGCTCCACATGGAAAAGTGGCTGGAAGTTTTTGCACAACTTCCACCAATTGATCTTTTTAGCCGGTCTCATTGGCCGACCTCGGCTCTTCATAAGTGTATGGGGGGGCAACACGTCAACATCAGCCAGTGGCCCCATCGCAGCTCACTCTGCCGAAGCAGAAATTTGGCCACTGGGTTAGTATTTGAGATTCGGGTGGAAGAATTTGAACGAGtttttttttttttttttCTTTCGTGGGAGTGAGACGGAAAAGGCAGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAACATAGAAATGTAATTTTAAACTATCAATAAAGCTGGAGGAGGAAGGGGaaaaaaaaaaaaaaaaaaaGGGACGAATTCGAATCGATCGATGACAGGAGTGGAGGAG
  5  -1   2       bld Lmb1      in                    IMAGE:8532766.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCTTGAAGTCCTCTTCACTTGCCAAAGGTTGGCAGAATAGAGCTATTCCCAGGCCGTGAGCTTACTTGACGTGTAAAAGGAGGAAAGGGGTGGAAACAAAAAAATGACTTTCTGCATTTAACaaaaaaaaaaaTGTTTATGTTTAGTTTGGTAGAGGTGTAATGTATAATGCTTTGTTCAAGAACCCCCTTTCCGGACCACTGGTACTAGGGATTTCAATGGGAAGAGTCAGGTCAGTAGGACCCCCCAAGGGTAGCAGGAATTTGGCAGAGCACCTGCTCCACATGGAAAAGTGGCTGGAAGTTTTTGCACAACTTCCACCAATTGATCTTTTTAGCCGGTCTCATTGGCCGACCTCGGCTCTTCATAAGTGTATGGGGGGGCAACACGTCAACATCAGCCAGTGGCCCCATCGCAGCTCACTCTGCCGAAGCAGAAATTTGGCCACTGGGTTAGTATTTGAGATTCGGGTGGAAGAATTTGAACGAGAttttttttttttttCTTTCGTGGGAGTGAGATGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAACATAGAAATGTAATTTTAAACTATCAATAAAGCTGGAGGAGGaaaaaaaaaaaaaaaaaaaaaaGGGACGAAGTACCAGCACGGACTCTTATCTGCACAGACTACATAT
  5  -1   2       bld Spl                             IMAGE:8462200.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGTATCTTTCTCGAGTCTCTTCACTGCCAAAGGTGGCAGAAGAGCTATCCCAGCCGTGAGCTTACTTGACGTTAAAGGGAGAAAGGGGTGAAACAAAAAAAGACTTTCTGCATTTACaaaaaaaaaTGTTTATGTTTAGTTTGGTAGAGGTGTAATGTATAATGCTTTGTTCAAGAACCCCCTTTCTGGACCACTGGTACTAGGGATTTCAATGGGAAGAGTCAGGTCAGTAGGAccccccccAAGGGTAGCAGGAATTTGGCAGAGCTCCTGCTCCACATGGAAAAGTGGCTGGAAGTTTCTGCACAACTTCCACCAATTGATCTTTTTAGCCGGTCTCATTGGCCGACCTCGGCTCTTCATAAGTGTATGGGGGGGCAACACGTCAACATCAGCCAGTGGCCCCATCGCAGCTCACTCTGCCGAAGCAGAAATTTGGCCACTGGGTTAGTATTTGAGATTCGGGTGGAAGAATCTGAACGAGAttttttttttttttCTTTCGTGGGAGTGAGACGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATAAGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAACATAGAAATGTAATTTTAAACTATCAATAAAGCTGGGGGaaaaaaaaaaaaaaaaaaaaaaaaaG
  5  -1   2       bld FaBN                            IMAGE:8077394.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGATAGAGCTATTCCCAGGCCGTGAGCTTTACTTGACGTGTAAAAGGAGGAAAGGGGTGGAAACAAAAAAATGACTTTCTGCATTTAACaaaaaaaaaTGTTTATGTTTAGTTTGGTAGAGGTGTAATGTATAATGCTTTGTTCAAGAACCCCCTTTCTGGACCACTGGTACTAGGGATTTCAATGGGAAGAGTCAGGTCAGTAGGACCCCCCCAAGGGTAGCAGGAATTTGGCAGAGCTCCTGCTCCACATGGAAAAGTGGCTGGAAGTTTCTGCACAACTTCCACCAATTGATCTTTTTAGCCGGTCTCATTGGCCGACCTCGGCTCTTCATAAGTGTATGGGGGGGCAACACGTCAACATCAGCCAGTGGCCCCATCGCAGCTCACTCTGCCGAAGCAGAAATTTGGCCACTGGGTTAGTATTTGAGATTCGGGTGGAAGAATCTGAACGAGAtttttttttttttCTTTCGTGGGAGTGAGACGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATAAGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAACATAGAAATGTAATTTTAAACTATCAATAAAGCTGGAGGAGG
  5  -1   2       bld FaB                             IMAGE:8074032.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCCCGGCGTAAGTTTTCTTGACGTTTAAAGAGAAAGGGGTGaaacaaaaaaatgctttttgcattaacaaaaaaaaTGTTTATGTTTAGTTGGTAGAGGGGTAATGTATAATGCTTTGTCCAAGAACCCCCTTTTTGGACCACTGGTATTAGGGATTTCAATGGGAAGAGTCAGGTCAGTAGGACCCCCCCAAGGGTAGCAGGAATTTGGCAGAGTTCCTGCTCCCACATGAAAAAGTGGCTGGAAGTTTTTGCACAACTTCCACCAATTGATTTTTTTAGCCGGTCTCATTGGCCGACCTCGGCTCTTCATAAGTGTATGGGGGGGCAACACGTCAACATCAGCCAGTGGCCCCATCGCAGCTCATTTTGCCGAAGCAGAAATTTGGCCACTGGGTTAGTATTTGAGATTCGGGTGGAAGAATTTGAACGAGAtttttttttttttttCTTTCGTGGGAGTGAGACGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATAAGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAACATAGAAATGTAATTTTAAACTATCAATAAAGCTGGAGGAGGAAGGGGAAAAAA
  5  -1   2       bld Emb9                            IMAGE:7976526.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGACGTGTAAAAGGACGAAAGGAGTGGAACCAAAAAATAGCTTTTTGCATTTAACaaaaaaaaaTGTTTTTGTTTCGTTTGGTAGAGGTTAAATGTATAATGCTTTGTTCAAGAACCCCCTTTCCGGACCACTGGTACTAGGGATTTCAATGGGAAGAGTCAGGTCAGTAGGACCCCCCAAGGGGAGCAGGAATTTGGCAGAGCACCTGCTCCACATGGAAAAGTGGCTGGAAGTTTCTGCACAACTTCCACCAATTGATCTTTTTAGCCGGTCTCATTGGCCGACCTCGGCTTTTCATAAGTGTATGGGGGGGCAACACGTCAACATCAGCCAGTGGCCCCATCGCAGCTCACTCTGCCGAAGCAGAAATTTGGCCACTGGGTTAGTATTTGAGATTCGGGTGGAAGAATTTGAACGAGAttttttttttttttCTTTCGTGGGAGTGAGATGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAACATAGAAATGTAATTTTAAACTATCAATAAAGCTGGAGGAGGAAGGGGaaaaaaaaaaaaaaaaaaaaaaaaG
  3   1   2       bld DMZ       in                         xl308o07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTGTAAAAGGGGGAAAGGGGGGGAAACAAAAAAATGnCTTTTTGCnTTTAACnAAAAAAAAANGTTTGTTTAGTTTGGTAGAGGNGTAANGTATAATGCTTTGTTCAAGAACCCCCNTTTTGGNCCNCTGGTNCTNGGGATTTCAATGGGAAGAGTCNGGTCNGTNGGNCCCCCCNAGGGGNGCNGGAATTTGGCNGAGCCCCTGCTCCCCNTGGAAAAGNGGCTGGAAGTTTTTGCNCAACTTCCCCCNATTGATNTTTTTAGCCGGTTTCNTTGGCCGACCTNGGCTNTTCATAAGNGTATGGGGGGGCAACNCGTCAACNTCAGCCNGNGGCCCCNTCGCAGCTCNCTNTGCCGAAGCNGAAATTTGGCCCCTGGGTTNGTNTTTGNGATTNGGGNGGAAGAATTTGAACGNGATTTTTTTTTTTTCTTTCGTGGGAGTGAGACGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAACATAGAAAT
  3   1   2       bld Ga15                               XL512j24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTAAAAGGNGGAAAGGGGNGGNAACNAAAAAANGACNTTTTGCNTTTAACAAAAAAAAAATGTTTGTTTAGTTTGGTAGAGGNGTAATGTATAATGCTTTGTTCAAGAACCCCCTTTNTGGACCNCTGGTACTAGGGATTTCAATGGGAAGAGTCAGGTCAGTAGGACCCCCCNAGGGGAGCNGGAATTTGGCAGAGCCCCTGCTCCNCATGGAAAAGTGGCTGGAAGTTTNTGCNCAACTTCCCCCAATTGATCTTTTTAGCCGGTNTCATTGGCCGACCTCGGCTNTTCATAAGTGTATGGGGGGGCAACNCGTCAACATCAGCCAGTGGCCCCATCGCAGCTCNCTNTGCCGAAGCAGAAATTTGGCCCCTGGGTTAGTATTTGAGATTCGGGNGGAAGAATNTGAACGAGATTTTTTTTTTTTCTTTCGTGGGAGTGAGACGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAACATAGAA
  3   1   2       bld DMZ  5g3  in                         xl292f04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTAAAAGGGGGAAAGGGGGGGAAACAAAAAAATGACCTTTTGCCTTTnACnAAAAAAAAATNTTTGTTTAGTTTGGTAGAGGNGTAATGTATAATGCTTTGTTCNAGAACCCCCNTTNTGGNCCCCTGGTNCTAGGGATTTCAATGGGAAGAGTCNGGTCNGTNGGNCCCCCCNAGGGGAGCNGGAATTTGGCNGAGCCCCTGCTCCNCNTGGAAAAGNGGCTGGAAGTTTTTGCNCAACTTCCCCCNATTGATNTTTTTAGCCGGTNTCNTTGGCCGACCTNGGCTNTTCATAAGNGTNTGGGGGGGCAACNCGTCAACNTCAGCCNGTGGCCCCNTCGCAGCTCNCTNTGCCGAAGCNGAAATTTGGCCCCTGGGTTNGTNTTTGAGATTCGGGNGGAAGAATTTGAACGAGATTTTTTTTTTTTCTTTCGTGGGAGTGAGACGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAACATA
  3   1   2       bld DMZ  5g3  in                         xl228p10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAAAGGGGNGGAAACAAAAAAATGACTTTTTGCNTTTAACNAAAAAAAAATGTTTGTTTAGTTTGGTAGAGGNGTAANGTATAATGCTTTGTTCAAGAACCCCCTTTTTGGNCCNCTGGTNCTAGGGATTTCAATGGGAAGAGTCNGGTCNGTAGGNCCCCCCNAGGGGAGCNGGAATTTGGCNGAGCCCCTGCTCCNCNTGGAAAAGNGGCTGGAAGTTTTTGCNCAACTTCCNCCAATTGATNTTTTTAGCCGGTNTCNTTGGCCGACCTNGGCTNTTCATAAGNGTATGGGGGGGCAACNCGTCAACNTCAGCCNGTGGCCCCNTCGCAGCTCNCTNTGCCGAAGCNGAAATTTGGCCCCTGGGTTAGTNTTTGAGATTCGGGNGGAAGAATNTGAACGAGATTTTTTTTTTTTCTTTCGTGGGAGTGAGACGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAACATA
  3   1   2       bld Tbd7      in                         XL085o21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACAAAAAAAAAATGTTTGTTTAGTTTGGTAAAGGTGTAATGTATAATGCTTTGTTCAAGAACCCCCTTTTTGGACCACTGGNACTAGGGATTTCAATGGGAAAAGTCAGGTCAGTAGGACCCCCCAANGGGANCAGGAATTTGGCANAGCNCCTGCTCCACATGGAAAANTGGCTGGAAGTTTTTGCNCAACTTCCNCCAATTNATNTTTTTANCCGGTNTCATTGGCCGACCTCGGCTTTTNATAAGTGTATGGGGGGGCAACACGTCAACATCANCCAGTGGCCCCATNGCAGCTCACTNTGCCGAANCANAAATTTGGCCNCTGGGTTAGTATTTTANATTCGGGTGGAANAATNTGAACNANATTTTTTTTTTTTTCTTTCGTGGGAGTGAGACGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAACATAGAAATGTAATTTTAAAC
  5   1   2       bld Egg1                            IMAGE:4678350.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCACGAGGCTTTGTTCAAGAACCCCCTTTCTGGACCACTGGTACTAGGGATTTCAATGGGAAGAGTCAGGTCAGTAGGACCCCCCAAGGGTAGCAGGAATTTGGCAGAGCACCTGCTCCACATGGAAAAGTGGCTGGAAGTTTCTGCACAACTTCCACCAATTGATCTTTTTAGCCGGTCTCATTGGCCGACCTCGGCTCTTCATAAGTGTATGGGGGGGCAACACGTCAACATCAGCCAGTGGCCCCATCGCAGCTCACTCTGCCGAAGCAGAAATTTGGCCACTGGGTTAGTATTTGAGATTCGGGTGGAAGAATCTGAACGAGAttttttttttttttCTTTCGTGGGAGTGAGACGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAACATAGAAATGTAATTTTAAACTATCAATAAAGCTGGAGGAGG
  5   1   2       bld DMZ       in                         xl307g12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTTGTTCAAGAACCCCCTTTCCGGACCACTGGTACTAGGGATTTCAATGGGAAGAGTCAGGTCAGTAGGACCCCCCCAAAGGTAGCAGGAATTTGGCAGAGCACCTGCTCCACATGGAAAAGTGGCTGGAAGTTTCTGCACAACTTCCACCAATTGATCTTTTTAGCCGGTCTCATTGGCCGACCTCGGCTCTTCATAAGTGTATGGGGGGGCAACACGTCAACATCAGCCAGTGGCCCCATCGCAGCTCACTCTGCCGAAGCAGAAATTTGGCCACTGGGTTAGTATTTGAGATTCGGGTGGAAGAATCTGAACGAGAtttttttttttttttCTTTCGGG
  5   1   2       bld Ga15      in                       XL447f10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGGTACTAGGGATTTCAATGGGAAGAGTCAGGTCAGTAGGACCCCCCAAGGGGAGCAGGAATTTGGCAGAGCACCTGCTCCACATGGAAAAGTGGCTGGAAGTTTCTGCACAACTTCCACCAATTGATCTTTTTAGCCGGTCTCATTGGCCGACCTCGGCTCTTCATAAGTGTATGGGGGGGCAACACGTCAACATCAGCCAGTGGCCCCATCGCAGCTCACTCTGCCGAAGCAGAAATTTGGCCACTGGGTTAGTATTTGAGATTCGGGTGGAAGAATCTGAACGAGAttttttttttttttNTTTCGG
  3   1   2       bld Ga15      in                       XL447f10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTNCTAGGGATTTCNANGGGAAGAGTCNGGTCNNTAGGNCCCCCCNAGGGGNGCNGGAATTTGGCNGAGCCCCNGCTCCCCNNGGAAAANNGGCTGGAANTTTTTGCCCNACTTCCCCCNANTGATNTTTTTANCCNGTTTCNTTGGCCGNCCTCGGCTTTTCATAAGNGTATGGGGGGGCNACNCGTCAACNTCAGCCNGNGGCCCCNTNGCAGCTCCCTTTGCCGAAGCNGAAATTTGGCCCCTGGGTTAGTATTTGAGATTNGGGNGGAAGAATTTGAACGNGATTTTTTTTTTTTTTCTTTCGTGGGAGTGAGATGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAACATAGAAAT
  3   1   2       bld DMZ       in                         xl296i21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGATTTCAATGGGAAGAGTCNGGTCNGTNGGNCCCCCCNAGGGGNGCNGGAATTTGGCNGAGCCCCTGCTCCCCNTGGAAAAGNGGCTGGAAGTTTTTGCNCAANTTCCCCCNATTGATNTTTTTAGCCGGTNTCNTTGGCCGACCTNGGCTNTTCATAAGNGTNTGGGGGGGCAACNCGTCAACNTCAGCCNGNGGCCCCNTCGCAGCTCNCTNTGCCGAAGCNGAAATTTGGCCCCTGGGTTNGTNTTTGAGATTCGGGNGGAAGAATNTGAACGAGATTTTTTTTTTTTCTTTCGTGGGAGTGAGACGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAACCATAGAAATGTAATTT
  5   1   2       bld Ga15      in                       XL471b11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCGGTCAGGTCAGTAGGACCCCCCAAGGGGAGCAGGAATTTGGCAGAGCACCTGCTCCACATGGAAAAGTGGCTGGAAGTTTCTGCACAACTTCCACCAATTGATCTTTTTAGCCGGTCTCATTGGCCGACCTCGGCTCTTCATAAGTGTATGGGGGGGCAACACGTCAACATCAGCCAGTGGCCCCATCGCAGCTCACTCTGCCGAAGCAGAAATTTGGCCACTGGGTTAGTATTTGAGATTCGGGTGGAAGAATCTGAACGAGAtttttttttttttNTTTCGGGGGAGNGAAACGGAAAAGG
  5   1   2       bld Ga18      ?                         xlk7f14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACCTNCTCCACATGGAAAAGTGGNTGGAAGTTTCTGCACAACTTCCACCNATTGATCTTTTTAGCCGGTCTCATTGGCCGACCTCNNNCTTCATAAGTGTATGGGGGGGCAACACGTCAACATCAGCCAGNNNNCCATCGCAGCTCACTCTGCCGAAGCAGAAATTTGGCCACTGGGTTAGTATTTGAGATTCGGGTGGAAGAATCTGAACGAGAttttttttttttttCTTTCGTGGGAGTGAGATGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGNAAAAGAAACTTAAGTCCTAGAACATAGAAATGTAATTTTAAACTATCAATAAAGCTGGAGGAGG
  3   1   2       add DMZ       in                         xl307g12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CNTGGAAAAGNGGCTGGAAGTTTTTGCNCNACTTCCCCCNANTGATNTTTTTNGCCGGTTTCNTTGGCCGNCCTNGGCTTTTNATAAGNGTNTGGGGGGGCAACNCGTCAACNTCAGCCNGNGGCCCCNTNGCAGCTCNCTTTGCCGAAGCNGAAATTTGGCCCCTGGGTTNGTNTTTGNGATTNGGGNGGAAGAATTTGAACGAGATTTTTTTTTTTTTTTCTTTCGTGGGAGTGAGACGGAAAAGGCGGAAGGTGCATCACAGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATAAGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAACATAGAAA
  3   1   2       bld Tbd7                                 XL095f24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATGGAAAANTGGCTGGAAGTTTTTGCNCAACTTNCNCCAATTNATNTTTTTAACCGGTNTCATTGGCCGACCTCGGCTTTTNATAAGTGTATGGGGGGGCAACACGTCAACATCANCCAGTGGCCCCATNGCAGCTCACTNTGCCGAANCANAAATTTGGCCNCTGGGTTAGNATTTTANATTCGGGTGGAANAATNTGAACNANATTTTTTTTTTTTTTCTTTCGTGGGAGTGAGATGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGNAGGTAAAAGAAACTTAAGTCCTAGAACATAGNAA
  3   1   2       bld DMZ       out                        xl306k11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CNTGGAAAAGNGGCTGGAAGTTTTTGCNCAACTTCCCCCNATTGATNTTTTTAGCCGGTTTCNTTGGCCGACCTNGGCTNTTCATAAGNGTATGGGGGGGGCAACNCGTCAACNTCAGCCNGTGGCCCCNTCGCAGCTCNCTNTGCCGAAGCNGAAATTTGGCCCCTGGGTTNGTATTTGAGATTCGGGNGGAAGAATNTGAACGAGATTTTTTTTTTTTCTTTCGTGGGAGTGAGACGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAAC
  3   1   2       add DMZ  5g3  in                         xl331k21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ANTGATNTTTTTNGCCGGTTTCNTTGGCCGNCCTTGGCTTTTNATAAGNGTNTGGGGGGGGCAACNCGTCAACNTNNGCCNGNGGCCCCNTNGCAGCTCNCTTTGCCGAAGCNGAAATTTGGCCCCTGGGTTNGTNTTTGAGATTNGGGNGGAAGAATTTGAACGAGATTTTTTTTTTTTTCTTTCGTGGGAGTGAGACGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTNTTAAANTCGNGAGNTAAAAGAAA
  5   1   2       bld DMZ       in                         xl267b17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GATCTTTTTAGCCGGTCTCATTGGCCGACCTCGGCTCTTCATAAGTGTATGGGGGGGCAACACGTCAACATCAGCCAGTGGCCCCATCGCAGCTCACTCTGCCGAAGCAGAAATTTGGCCACTGGGTTAGTATTTGAGATTCGGGTGGAAGAATCTGAACGAGAtttttttttttttNCTTNCGGGGNAGNGAAANGGAAAAGGCGNAAG
  3   1   2       bld Neu7      in                         XL049j13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATNTTTTTAACCGGTTTCATTGGCCGACCNCGGCTTTTNATAAGNGNATGGGGGGGCAANACGTCAACATCANCCAGNGGNCCCATNGCAGCTCNCTNTGCCGAANCANAAATTTGGCCCCTGGGTTAGNATTTTANANTCGGGTGGAANAATNTGAACNANATTTTTTTTTTTTTTCTTTCGTGGGAGTGAGATGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAACATAGAAATGTAATTTTAAA
  3   1   2       chi Ga15                               XL437f17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTNTTTAGGNGACCCTATAGAATNCNAGCTNCTTGTTNTTTTTGCNGGATCCCNTCGATTNGAATTNGTCGACCCCCGCGTCCNGAAGAATTTGAACGAGATTTTTTTTTTTTTCTTTCGTGGGAGTGAGACGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGACTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAACCATAGAAATGTAATTAA
  3   1   2       bld Ga15      in                       XL509g12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCGNGGCCCCCTNGCNGNTCCCTTTNCCGAANCNGAAANTTGGCCCCNGGGNTNGTNTTTGNGATTNGGGNGGAAGAATTTGAACGNGANTTTTTTTTTTTTTCTTTCGTGGGAGTGAGATGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAACATAGAAATGTAATTT
  3   1   2       chi Ga15      in                       XL471b11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCGNGGCCCCCTTGCNGNTCCCTTTNCCGAANCNGAAANTTGGCCCCNGGGNTNNTNTTTNNGANTNGGGNGGAANAATTTGAACGNGANTTTTTTTTTTTTCTTTCGTGGGAGTGAGACGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAACATAGAAAT
  3   1   2       bld Ga15                               XL510f12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GNGGCCCCCTTGCNGNTCCCTTTNCCGAANCNNAAANTTNGCCCCNGGGNTNNTNTTTNNGATTTGGGNGGNANAATTTNAACGNGANTTTTTTTTTTTTTCTTTCGTGGGAGTGAGATGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTACGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTNTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAAC
  3   1   2       bld Ga15                               XL479e22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCCCCNTTGCAGNTCCCTTTNCCGAANCNNAAANTTGGCCCCTGGGNTNNTNTTTGNGATTNGGGNGGAANAATTTNAACGNGANTTTTTTTTTTTTTCTTTCGTGGGAGTGAGATGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAACATAGAAATG
  3   1   2       chi Ga15      in                       XL510g12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCCCCCTTNCNGNTCCCTTTNCCGAANCCGAAANTTNGCCCCTGGGTTNNTNTTTGANATTNGGGNNGAANNATTTGAACGNGANTTTTTTTTTTTTTCTTTCGTGGGAGTGAGATGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAAGCATAGAAATGTA
  3   1   2       bld DMZ  5g3  in                         xl287c23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGCCCCNTNGCAGCTCNCTTTGCCGAAGCNGAAATTTGGCCCCTGGGTTNGTNTTTGAGATTNGGGNGGAAGAATTTGAACGAGATTTTTTTTTTTTTCTTTCGTGGGAGTGAGATGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAAC
  3   1   2       bld DMZ       in                         xl267b17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCNTCGCAGCTCNCTNTGCCGAAGCNGAAATTTGGCCCCTGGGTTNGTATTTGAGATTCGGGNGGAAGAATNTGAACGAGATTTTTTTTTTTTTTCTTTCGTGGGAGTGAGATGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTT
  3   1   2       bld DMZ  5g3  in                         xl299m22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CNNAAANTTGGCCCCNGGGTTNGTNTTTNNGATTNGGGGGGAANAATTTNAACNNGATTTTTTTTTTTTTTTCTTTCGTGGGAGTGAGACGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAACATAGAAA
  3   1   2       bld Ga15      out                      XL503a11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAANTTGGCCCCNGGGNTAGTATTTGAGATTCGGGNGGAAGAATTTGAACGNGANTTTTTTTTTTTTCTTTCGTGGGAGTGAGACGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGACTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAACATAGAAATG
  3   1   2       bld Ga15                               XL494o04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAANTTGGCCCCTGGGTTNNTNTTTNAGATTTNGGNGGAAGAATTTGAACGAGATTTTTTTTTTTTTCTTTCGTGGGAGTGAGATGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAACATAGAAAT
  3   1   2       bld DMZ       in                         xl299o19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GNTTNGGGGGGNANAATTTNAACNNGANTTTTTTTTTTTTTTTCTTTCGTGGGAGTGAGACGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAAACTTAAGTCCT
  3   1   2       bld Ga12      in                         XL141n20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ANATTTTTTTTTTTTTTCTTTCGTGGGAGTGAGATGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCC
  3   1   2       bld Ga18                               rxlk1a23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCCCCCCNNGAGATGGAAAAGGCGGAAGGTGCATCACGGAGAGAGTGAAGCCAAACGTAGAAGCTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGAGTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAACATAGAAANG
  5   1   2       bld Ga15      in                       XL458n10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGAAATGATGTTTTCACAGAATCNAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGACTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAACATAGAAATGTAATTTTAAACTATCAATAAAGCTGGAGGAGGAAGGGGaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL458n10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGACTTTACTTTGCTTGTAATCAGTTTTTAAAGTCGGGAGGTAAAAGAAACTTAAGTCCTAGAACATAGAAATGTAATT
  5   1   2       e50                            Xl3.1-IMAGE:8460788.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAGAGTTGAGTCGGGCCAGTAGGAGCCCACCCAGGGCAGCAGCAATTTGGCAGATAGTCTGCTCCAGGGAAAAGCGATTGGAAGTTTCCGCTGAACTTCCGCCAATTTTTTTTTTTTTTTAACGGTCTCATTGGCCGACCTCGGCTGTTAATAACGTGCAACTGTATCAGGTCTGTGTACAGCGCAGTGGCAACAACACGTCAACATCGGCCAGTGGCCCCGGTGGCATCTCAGTCTCGTGGTATTGGAGATACAGGTGAGAGGATCCGCTGTTTTTGTTTCTTCGTGGGAAATGAGAAGGCAAAGGCGTATCATGGAGCCAAACGTAGAAACTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGACTTTACTTTGCTTGTAATCAGTTTTTAAAAGTCGGGAGGTAAAAGAAATGTAAGTCCTAGAACATAGAAATGTAATTTTAAACTATCAATAAAGCTGG
                                                  Xl3.1-CHK-1012691345                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTGAGTCGGGCCAGTAGGAGCCCACCCAGGGCAGCAGCAATTTGGCAGATAGTCTGCTCCAGGGAAAAGCGATTGGAAGTTTCCGCTGAACTTCCGxxxxxTTTTTTTTTTTTTTAACGGTCTCATTGGCCGACCTCGGCTGTTAATAACGTGCAACTGTATCAGGTCTGTGTACAGCGCAGTGGCAACAACACGTCAACATCGGCCAGTGGCCCCGGTGGCATCTCAGTCTCGTGGTATTGGAGATACAGGTGAGAGGATCCGCTGTTTTTGTTTCTTCGTGGGAAATGAGAAGGCAAAGGCGTATCATGGAGCCAAACGTAGAAACTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGACTTTACTTTGCTTGTAATCAGTTTTTAAAAGTCGGGAGGTAAAAGAAATGTAAGTCCTAGAACATAGAxAxxTxxxxTTxAACTATCAATAAAGCTGGAGGAGG
  3   1   2       bld Bone      in                    IMAGE:8739600.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCAGAAGAGTTTTGACACACTTCCAGAGAATCTGCAACAAAGTGAAATGTACAGTGTGGGGAGACCTGGCCACGTGCCATTAACTGCAGCAAACCAGTGAAGTCAACTGTTACGCTGCGGAGAGTCCGGGCACCCTGGCACGGGAATGCACATTGAAGCCACCGCTTAATTATCTTCGTCGGCCCTCCTTTTTCTGATTGATGGGTGTAATCTTTCTCTGAGTCCTCTTCACTGGCCAAAGGTTGGCAGATAGAGCTATTCCAGGCCGTGAGCTTTACTTGACGTGTAAAAGGAGGAAAGGGGTGGAAACTATAAAAAAAACGACTTTCTGCATTTAACAAAAAAAAAAATGTTTATGTTTAGTTTGGTAGAGGTGTTATGTATAATGCTTTGTTAAAGAACCCCCTTTCCATGCCCTGGTGACTAGGGATTTCAATGGAAAGAGTTGAGTCGGGCCAGTAGGAGCCCACCCAGGGCAGCAGCAATTTGGCAGATAGTCTGCTCCAGGGAAAAGCGATTGGAAGTTTCCGCTGAACTTCCGCCAATTGATTTTTTTTTTTAACGGTCTCATTGGCCGACCTCGGCTGTTAATAACGTGCAACTGTATCAGGTCTGTGTACAGCGCAGTGGCAACAACACGTCAACATCGGCCAGTGGCCCCGGTGGCATCTCAGTCTCGTGGTATTGGAGATACAGGTGAGAGGATCCGCTGTTTTTGTTTCTTCGTGGGAAATGAGAAGGCAAAGGCGTATCATGGAGCCAAACGTAGAAACTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGACTTTCCCCTGCTTGTAATCAGTTTTTAAAAGTCGGGAGGTAAACAGAAATGTAAGTCCTAGCAACATCGAAATGTCATTTAAACTCCAAGCCCCCA
  3   1   2       bld Emb9                            IMAGE:7974972.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GATTGAATGGTTGTATCTTTTCTCTGAGTCCTCTTCACTGGCCCAAAGGTTGGCAGATAGAGCTATTCCCAGGCCGTGAGCTTTACTTGACGTGTAAAAAGGAGGAAAGGGGTGGAAACTATAAAAAAAACGACTTTCTGCATTTAACAAAAAAAAAAAATGTTTATGTTTAGTTTGGTAGAGGTGTTATGTATAATGCTTTGTTAAAGAACCCCCTTTCCATGCCCTGGTGACTAGGGATTTCAATGGAAAGAGTTGAGTCGGGCCAGTAGGAGCCCACCCAGGGCAGCAGCAATTTGGCAGATAGTCTGCTCCAGGGAAAAGCGATTGGAAGTTTCCGCTGAACTTCCGCCAGTTGATTTTTTTTTTTTTTAACGGTCTCATTGGCCGACCTCGGCTGTTAATAACGTGCAACTGTATCAGGTCTGTGTACAGCGCAGTGGCAACAACACGTCAACATCGGCCAGTGGCCCCGGTGGCATCTCAGTCTCGTGGTATTGGAGATACAGGTGAGAGGATCCGCTGTTTTTGTTTCTTCGTGGGAAATGAGAAGGCAAAGGCGTATCATGGAGCCAAACGTAGAAACTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGACTTTACTTTGCTTGTAATCAGTTTTTAAAAGTCGGGAGGTAAAAGAAATGTAAGTCCTCCAACAACAGAACACGTTATAACAGCCCAAAGTCGCCCAG
  5  -1   2       bld Spl                             IMAGE:8460788.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCTGACCCCGTTAATTCTTGTTGCCTCTTTTTTATGGAGGTGATCTTTCTCGAGTCTCTCCCGGCAAAGTTGCAGAAGAGTTTTCCCAGCCTGAGCTTTCTTGACGGTAAAGGAGAAAGGGTGGAAACTTTAAAAAAACGACTTCTGCATTTACaaaaaaaaaaaTGTTATGTTTAGTTTGGTAGAGGTGTTATGTATAATGCTTGTTAAAGAACCCCCTTTCCATGCCCTGGTGACTAGGGATTCAATGGAAAGAGTTGAGTCGGGCCAGTAGGAGCCCACCCAGGGCAGTAGCAATTTGGCAGATAGTCTGCTCCAGGGAAAAGCGATTGGAAGTTTCCGCTGAACTTCCGCCAATTGAtttttttttttAACGGTCTCATTGGCCGACCTCGGCTGTTAATAACGTGCAACTGTATCAGGTCTGTGTACAGCGCAGTGGCAACAACACGTCAACATCGGCCAGTGGCCCCGGTGGCATCTCAGTCTCGTGGTATTGGAGATACAGGTGAGAGGATCCGCTGTTTTTGTTTCTTCGTGGGAAATGAGAAGGCAAAGGCGTATCATGGAGCCAAACGTAGAAACTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGACTTTACTTTGCTTGTAATCAGTTTTTAAAAGTCGGGAGGTAAAAGAAATGTAAGTCCTAGAACATAGAAATGTAATTTTAAACTATCAATAAAGCTGGAGGAGGaaaaaaaaaaaaaaaaaaaaaaaaaGGGCGGGGGNCGATTTTTATTGATGTTCTCNNNGAATCGTGANNNTTTTT
  5  -1   2       add FaB                             IMAGE:8074325.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAATTGGAATATAGATATACCTGGCCGGAGTTTACTGATAGTATAAGTAGTAACTAGTGCGCTCATAGAAAACAACTTTTTGGCTTAACaaaaaaaaaaaGTTACTTTAAGTTAGAATGAAGTGTAAGATAAAAGATTTGTTAAAAGACCCCCTTTCCAAGCCCTGTGAAATAGGGGTTTCAAAGGAAAGACATTAAGTAATGCCTATAAGAGCCCCCCCGAGGAAGCGCATTTTTAGCAAATATTTTGTTCCCAGGTAAAGCGTATTGAAAGTTTCTGCGTAAATTCCGCCCATTAGAtttttttttttAGCGGTTACAATGGCCGACCTCCGCTTTTTAATAACGAGCAATTGAATCATGTCTTTGTACAGCGCAGTGGCAACAACACGTTAACATCGGCCAGGTGGCCCCGGTGGCATCTCAGTTTCGGGGTATTGGAGATACAGATGAGAGGATCCGCAGTTTTTGTTTCTTAGTGGGAAATGAGAAGGCAAAGGGGTATCATGGAGCCAAACGTAGAAACTGTTCGGGAGCTGCAGTAGAAATGATGTTTTCACAGAATCCAGATGTTATTTTTGTATTACGATATCACCTTAGGCAACTGTTTGACTTTACTTTGCTTGTAATCAGTTTTTAAAAGTCGGGAGGCAAAAGAAATGTAAGTCCTAGAACATAGAAATGTCATTTTCAACTATCAATAAAGCTGGAGGAGGAAGTGGAAAAAAA
  3   1   2       bld Ga15                               XL513g10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TNTTGNCCCCCNNGNNCNNNTTNACNAAAAAAAAAAANGTTTANGTTTANTTTGGTAGAGGNGTTANGTATAANGCTTTGTTAAANAACCCCCNTTCCNNGCCCTGGNGNCTAGGGATTTCNANGGAAAGAGTTGANTNGGGCCNNTAGGAGCCCCCCCNGGGCNGCNGCNANTTGGCNGATANTTTGCTCCNGGGAAAANCGANTGGAANTTTNCNCTGAACTTCCNCCNANTGTTTTTTTTTTTTAACGGTCTCATTGGCCGACCTCGGCTGTTAATAACGTGCAACTGTATCAGGTCTGTGTACAGCGCAGTGGCAACAACACGTCAACATCGGCCAGTGGCCCCGGTGGCATCTCAGTCTCGTGGTATTGGAGATACAGGTGAGAGGATCCGCTGTTTTTGTTTCTTCGTGGGAAATGAGAAGGCAAAGGCGTATCATGGAGCCAAACGTAGAAACTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGACTTTACTTTGCTTGTAATCAGTTTTTAAAAGTCGGGAGGTAAAAGAAATGTAAGTCCTAGAACATAGAAAT
  3   1   2       bld Tbd7      in                         XL083n10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCAATGGAAAAAGTTNAGTCGGGCCAGTAGGAGCCCACCCAGGGCAGCANCAATTTGGCAAATAGTNTGCTCCAGGGAAAANCGATTGGAAGTTTCCNCTGAACTTCCNCCAATTGTTTTTTTTTTTTAACGGTCTCATTGGCCGACCTCGGCTGTTAATAACGTGCAACTGTATCAGGTCTGTGTACAGCGCAGTGGCAACAACACGTCAACATCGGCCAGTGGCCCCGGTGGCATCTCAGTCTCGTGGTATTGGAGATACAGGTGAGAGGATCCGCTGTTTTTGTTTCTTCGTGGGAAATGAGAAGGCAAAGGCGTATCATGGAGCCAAACGTAGAAACTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTNTGTATCCGATATCACTTTAGGCAA
  3   1   2       bld Ga12      in                         XL213k14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGGGAAAAGNGATTGGAAGTTTNCNCTGAACTTCCNCCAGTTGATTTTTTTTTTTTTTAACGGTCTCATTGGCCGACCTCGGCTGTTAATAACGTGCAACTGTATCAGGTCTGTGTACAGCGCAGTGGCAACAACACGTCAACATCGGCCAGTGGCCCCGGTGGCATCTCAGTCTCGTGGTATTGGAGATACAGGTGAGAGGATCCGCTGTTTTTGTTTCTTCGTGGGAAATGAGAAGGCAAAGGCGTATCATGGAGCCAAACGTAGAAACTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGACTTTACTTTGCTTGTAATCAGTTTTTAAAAGTCGGGAGGTAAAAGAAATGTAAGTCCTAGAACATAGAAAT
  3   1   2       bld Tbd7      in                         XL095f22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGGGAAAAGCGATTGGAAGTTTCCGCTGAACTTCCGCCAATTGTTTTTTTTTTTTAACGGTCTCATTGGCCGACCTCGGCTGTTAATAACGTGCAACTGTATCAGGTCTGTGTACAGCGCAGTGGCAACAACACGTCAACATCGGCCAGTGGCCCCGGTGGCATCTCAGTCTCGTGGTATTGGAGATACAGGTGAGAGGATCCGCTGTTTTTGTTTCTTCGTGGGAAATGAGAAGGCAAAGGCGTATCATGGAGCCAAACGTAGAAACTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATNTNTGTANCACGATATCACTTTAGGCAACTGTTTGACTTTACTCTTGCTTGTNANCAGTTTTTAAAAGTCGGGAGGTAAAAGNANTGTAAGNCCTAGCA
  3   1   2       bld Ga15      in                       XL460l08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCCGCGTCCGTTTTTTTTTTTAACGGTCTCATTGGCCGACCTCGGCTGTTAATAACGTGCAACTGTATCAGGTCTGTGTACAGCGCAGTGGCAACAACACGTCAACATCGGCCAGTGGCCCCGGTGGCATCTCAGTCTCGTGGTATTGGAGATACAGGTGAGAGGATCCGCTGTTTTTGTTTCTTCGTGGGAAATGAGAAGGCAAAGGCGTATCATGGAGCCAAACGTAGAAACTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGACTTTACTTTGCTTGTAATCAGTTTTTAAAAGTCGGGAGGTAAAAGAAATGTAAGTCCTAGAACATAGAAAT
  3   1   2      seed DMZ       in                         xl299c04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCNGTTGATTTTTTTTTTTTTTAACGGTCTCATTGGCCGACCTCGGCTGTTAATAACGTGCAACTGTATCAGGTCTGTGTACAGCGCAGTGGCAACAACACGTCAACATCGGCCAGTGGCCCCGGTGGCATCTCAGTCTCGTGGTATTGGAGATACAGGTGAGAGGATCCGCTGTTTTTGTTTCTTCGTGGGAAATGAGAAGGCAAAGGCGTATCATGGAGCCAAACGTAGAAACTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGACTTTACTTTGCTTGTAATCAGTTTTTAAAAGTCGGGAGGTAAAAGAAATGTAAGTC
  3   1   2       bld DMZ                                 rxl289d13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CNNTTGATTTTTTTTTTTTTTAACGGTCTCATTGGCCGACCTCGGCTGTTAATAACGTGCAACTGTATCAGGTCTGTGTACAGCGCAGTGGCAACAACACGTCAACATCGGCCAGTGGCCCCGGTGGCATCTCAGTCTCGTGGTATTGGAGATACAGGTGAGAGGATCCGCTGTTTTTGTTTCTTCGTGGGAAATGAGAAGGCAAAGGCGTATCATGGAGCCAAACGTAGAAACTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGA
  3   1   2       bld DMZ       in                         xl301n07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CNGTTGATTTTTTTTTTTTTTAACGGTCTCATTGGCCGACCTCGGCTGTTAATAACGTGCAACTGTATCAGGTCTGTGTACAGCGCAGTGGCAACAACACGTCAACATCGGCCAGTGGCCCCGGTGGCATCTCAGTCTCGTGGTATTGGAGATACAGGTGAGAGGATCCGCTGTTTTTGTTTCTTCGTGGGAAATGAGAAGGCAAAGGCGTATCATGGAGCCAAACGTAGAAACTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGACTTTACTTTGCTTGTAATCAGTTTTTAAAAGTCGGGAGGTAAAAGAAATGTAAGTCCTAGA
  3   1   2       bld Tbd7      in                         XL072l09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ANTTTATTTTTTTTTTTTTTAACGGTCTCATTGGCCGACCTCGGCTGTTAATAACGTGCAACTGTATCAGGTCTGTGTACAGCGCAGTGGCAACAACACGTCAACATCGGCCAGTGGCCCCGGTGGCATCTCAGTCTCGTGGTATTGGAGATACAGGTGAGAGGATCCNCTGTTTTTGTTTCTTCGTGGGAAATGAGAAGGCAAAGGCGTATCATGGAGCCAAACGTAGAAACTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTANTTTTGTACACGATATCNCTTTAGGCAACTGTTTGACTTTAC
  3   1   2       bld Tbd7      in                         XL089h21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGTTNATTTTTTTTTTTTTTAACGGTCTCATTGGCCGACCTCGGCTGTTAATAACGTGCAACTGTATCAGGTCTGTGTACAGCGCAGTGGCAACAACACGTCAACATCGGCCAGTGGCCCCGGTGGCATCTCAGTCTCGTGGTATTGGAGATACAGGTGAGAGGATCCGCTGTTTTTGTTTCTTCGTGGGAAATGAGAAGGCAAAGGCGTATCATGGAGCCAAACGTAGAAACTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTANCACGATATCACTTTAGGCAACTGTTTGACTTNACCTTGGCTTGTNANCAGTTTTTAAAAGTCGGGAGGTAAAAGNANTGTAAGNCCTAGCAA
  5   1   2       add Ga15      in                       XL460l08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AACGGTCTCATTGGCCGACCTCGGCTGTTAATAACGTGCAACTGTATCAGGTCTGTGTACAGCGCAGNGGCAACAACNCGTCAACATCGGCCAGNGGCCCCGGNGGCATCTCAGTCTCGNGGTATTGGANATACAGGTGANAGGATCCNCTGTTTTTGTTTCTTCGNGGGAAATGANAAGGCAAAGGCGTATCATGGAGCCAAACGTAAAAACTGTTCGGGAGCTGCANANAAATGATGTTTTCNCANAATCAANATGTTATTTTTGTATACNATATCACTTTAGGCAACTGTTTGACTTTACTTTGCTTGTAATCAGTTTTTAAAAGTCGGGAGGTAAAANAAATGTAAGTCCTAAAACATANAAATGTCATTTTAAACTATCAATAAAGCTGGAGGAGGAAGGGGaaaaaaaaaa
  3   1   2       bld Ga18                             rxlk133c22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGTGGCNNCANCNNNNNAACATNGCCAGTGGNNCNGGTGGCATCTNAGTCTCGTGGTATTGGANANACAGGTGAGAGGATCCGCTGTTTTTGTTTCTTCGTGGGAAATGAGAAGGCAAAGGCGTATCATGGAGCCAAACGTAGAAACTGTTCGGGAGCTGCAGAGAAATGATGTTTTCACAGAATCAAGATGTTATTTTTGTATACGATATCACTTTAGGCAACTGTTTGACTTTACTTTGCTTGTAATCAGTTTTTAAAAGTCGGGAGGTAAAAGAAATGTAANTCCTAGNACATAGAAATGTCA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)