Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL203i04.3                           12 END     10         16       83                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:3401647-IMAGp.5.5              26 PI      75        438     1154                (no blast hit)
     3   0.0    0Xl3.1-XL203i04.3                           12 PI      86       1773     2572                (no blast hit)
     4   0.0    0Xl3.1-IMAGE:7010758.5                       5 PI      78        392      790                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012837742 Xl3.1-IMAGE:5156278.5.5 - 60 ESTs
                                                                       .-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:5156278.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAGGAGGAGGAGGGTAGGTGGGTGGTTATTGCTCGTCTTGTTTCCTGCTCTAGTTTCTGTACGAGAGAGGAGGGGACCTCGCCTCGTATCTGAGCCTGCTCCAGCCTGGAACTTGCCTTCACCCCGTTTTATGCGACCATTGGCCTCCCCCGCCGCCGGAAATCCTCCTCTCCAGCACAATAATAAAGCCAATCTCTTCCTGCTGCCCAGCTCTGGGCTGCTCCTCCTACTTCTCCTGGGGGCCCGGACTCAGGCAGAGGGAACCCCGGGGACCGGGAGAGGCTTCTCGGACTCGCAGTGGATCTAAGGGCCGGGGCTGTGCTGCAGGGACATCAGTATGAGTCACTCCCCGGTGCAGCACGGCCTGCCTGCGATAATACAGAATCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAGAATAGGCAAAGGCTCATTTGGAGAAGTCTTTAAAGGAATTGACTATAGGACTCAGAAAGTTGTGGCCATAAAAATAATAGATTTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATCACTGTGCTCAGCCAATGTGATAGCCCTTACGTAACAAAGTATTATGGCTCCTATCTTAAGGACACAAAATTATGGATCATTATGGAATACCTTGGAGGAGGCTCAGCTCTGGATCTGTTAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAATCTTAAAGGGACTTGACTACTTGCATTCAGAGAAGAAAATTCACAGGGATATTAAAGCTGCCAATGTGCTGTTATCTGAAAATGGGGAGGTGAAAATAGCCGACTTTGGTGTTGCAGGACAACTTACTGACACTCAGATCAAGAGGAACACCTTTGTTGGAACTCCATTCTGGATGGCACCAGAAGTCATAAAGCAGTCTGCATATGATTCCAAGGCAGATATCTGGTCCCTGGGCATAACGGCTATTGAACTCGCAAAAGGAGAACCTCCTCATTCAGAGCTGCATCCCATGAAAGTCTTGTTCCTTATACCCAAGAACAATCCTCCCTTGCTGGAAGGGAACTACAGCAAAGGTCTGAAGGAGTTTGTAGAAGCCTGCTTAAACAAGGAGCCCAGTTTTAGACCCTCGGCTAAGGAACTGCTGAAACACAAGTTTATTATGCGAAATGCAAAGAAAACCTCCTACTTAACAGAACTCATAGACAGGTACAAGAGATGGAAGATAGAACAAGGCCATGAAGCCTCCAGCTCGGACTCTGATGAGGAAGAAGTAGAACAAGCTGCTGGCAGTGAGAAGGATTATTGGAACTTCACAAGAAGAAAGAGAGACTTGAAAAACTTGGAGCCTGTTCCAGCACAACCAGAAGAGGTTAAAGACATTCCCAAGAGGCCTTTGTCTCAATGCTTATCTACAATAATGTCTCCTTTATTTGCAGAGCTCAAGGAGAAGAGTCAGGCGTGCGGTGGGAATGTAGGCTCAATAGAGGAATTGAGAGAGGCAATTTATTTAGCTGAAGAGGCCTGTCCGGGTATCTCGGACTCCATGGTTTCTCAGCTTCTTATTAGGCTTCAGAGGTATTCTGTTAATGGAGTGGACTCTTCCTCGCACTGAAGGATGTTTTTGTCCTTTTTAAGGCAAAAATGGACCTTGCATTATTCTCCCTATGGAACACGCCTCTGCTCATGGATATCACAGGATGTGGACCTTCCTGAATGATGAGTGACTATAGATAGGGAGTTGGTGAAAGCTATAGTTTTTATGATTTTCTTTTTTTTTTCTCTAATCATAATGCGAATATATAAAAATGTAAAAAAAAAACTTCTGCAAATTACTGTGATAAGGCAAACGAAGATATTGTGAAACCTCAGGTATCTTGCTGTAAGCAGTCCGTTGTGCTGGAGATGGAATGAAATCTTGGTTTAATTCCTCTATGGAAAGTTATCAGATGCCTCGGCCTTCTTTCCTCAAGCCGCTGTGAGCTCCCAGCATGCCCAGCAGTTGAAGCCTATGAATGGTGGGAGATGCAAATCACAACAGCTGGAGGGACGTGGGCTGACATTCCAATTTTACAGTTGACTTTTTACTAGAGTTTGCCAACCTACAAACAGACCCAGGGCATCCCTAGGTGCAAGATGCCATGTTCTGTTTATGGATTTCATATCTGGCAGCCATATTTTATGTTTTATGCTAATGGTTTAAATGAAGCGCCAAGTTGAGTTTTGTTATCTACATACAGAAGCCCTGTGGGACATGTGTTAGATGATACCAGTGTAATGTTTTGTCTAAATATACATGACATTGTACAGTATTGCCGTTTTCTTCAGAAAACAAACTGTGGCATTTAGATATATCTTCTATACATTTATCGATACACATTATTTGTATATACTTAAAAGACAGAGGATAAGGTACTGTCACAATGAAGTTTTACTGTTTTTAATTTATAGATATGTCTGAAATATGTAAGGCTCCGCCTCATCACTGGGATAAGTTATGAGAATATTATAACACAATACGTACAGCAGTGTGTGCAGTTATTCTATACGTGTCTCTGTTTGTCTGTGCAGCCAGTGGAGCAGTGTCAGTAGCAGTATCTCTGGGAATATACTGTGAGTGTGAATGGTGAGCTGAAATGATTGTAACACAG
                                                  Xl3.1-CHK-1012721374                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAGGAGGGTAGGTGGGTGGTTATTGCTCGTCTTGTTTCCTGCTCTAGTTTCTGTACGAGAGAGGAxxxxxxCTCGCCTCGTATxxGxxxCTGCTCCAGCCTGGAACTTGCCTTCACCCCGTTTTATGCGACCATTGGCCTCCCCCGCCGCCGGAAATCCTCCTCTCCAGCACAATAATAAAGCCAATCTCTTCCTGCTGCCCAGCxCxxGGCTGCTCCTCCTACTTCxCxxxxGGGCCCxxxCxxAGGCAGAGGGAACCCCGGGGACCGGGAGAGGCTTCTCGGACTCGCAGTGGATCTAAGGGCCGGGGCTGTGCTGCAGGGACATCAGTATGAGTCACTCCCCGGTGCAGCACGGCCTGCCTGCGATAATACAGAATCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAGAATAGGCAAAGGCTCATTTGGAGAAGTCTTTAAAGGAATTGACTATAGGACTCAGAAAGTTGTGGCCATAAAAATAATAGATTTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATCACTGTGCTCAGCCAATGTGATAGCCCTTACGTAACAAAGTATTATGGCTCCTATCTTAAGGACACAAAATTATGGATCATTATGGAATAxCTxGGAGGAGGCTCAGCTCTGGATCTGTTAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAATCTTAAAGGGACTTGACTACTTGCATTCAGAGAAGAAAATTCACAGGGATATTAAAGCTGCCAATGTGCTGTTATCTGAAAATGGGGAGGTGAAAATAGCCGACTTTGGTGTTGCAGGACAACTTACTGACACTCAGATCAAGAGGAACACCTTTGTTGGAACTCCATTCTGGATGGCACCAGAAGTCATAAAGCAGTCTGCATATGATTCCAAGGCAGATATCTGGTCCCTGGGCATAACGGCTATTGAACTCGCAAAAGGAGAACCTCCTCATTCAGAGCTGCATCCCATGAAAGTCTTGTTCCTTATACCCAAGAACAATCCTCCCTTGCTGGAAGGGAACTACAGCAAAGGTCTGAAGGAGTTTGTAGAAGCCTGCTTAAACAAGGAGCCCAGTTTTAGACCCTCGGCTAAGGAACTGCTGAAACACAAGTTTATTATGCGAAATGCAAAGAAAACCTCCTACTTAACAGAACTCATAGACAGGTACAAGAGATGGAAGATAGAACAAGGCCATGAAGCCTCCAGCTCGGACTCTGATGAGGAAGAAGTAGAACAAGCTGCTGGCAGTGAGAAGGATTATTGGAACTTCACAAGAAGAAAGAGAGACTTGAAAAACTTGGAGCCTGTTCCAGCACAACCAGAAGAGGTTAAAGACATTCCCAAGAGGCCTTTGTCTCAATGCTTATCTACAATAATGTCTCCTTTATTTGCAGAGCTCAAGGAGAAGAGTCAGGCGTGCGGTGGGAATGTAGGCTCAATAGAGGAATTGAGAGAGGCAATTTATTTAGCTGAAGAGGCCTGTCCGGGTATCTCGGACTCCATGGTTTCTCAGCTTCTTATTAGGCTTCAGAGGTATTCTGTTAATGGAGTGGACTCTTCCTCGCACTGAAGGATGTTTTTGTCCTTTTTAAGGCAAAAATGGACCTTGCATTATTCTCCCTATGGAACACGCCTCTGCTCATGGATATCACAGGATGTGGACCTTCCTGAATGATGAGTGACTATAGATAGGGAGTTGGTGAAAGCTATAGTTTTTATGATTTTCTTTTTTTTTTCTCTAATCATAATGCGAATATATAAAAATGTAAAAAAAAAACTTCTGCAAATTACTGTGATAAGGCAAACGAAGATATTGTGAAACCTCAGGTATCTTGCTGTAAGCAGTCCGTTGTGCTGGAGATGGAATGAAATCTTGGTTTAATTCCTCTATGGAAAGTTATCAGATGCCTCGGCCTTCTTTCCTCAAGCCGCTGTGAGCTCCCAGCATGCCCAGCAGTTGAAGCCTATGAATGGTGGGAGATGCAAATCACAACAGCTGGAGGGACGTGGGCTGACATTCCAATTTTACAGTTGACTTTTTACTAGAGTTTGCCAACCTACAAACAGACCCAGGGCATCCCTAGGTGCAAGATGCCATGTTCTGTTTATGGATTTCATATCTGGCAGCCATATTTTATGTTTTATGCTAATGGTTTAAATGAAGCGCCAAGTTGAGTTTTGTTATCTACATACAGAAGCCCTGTGGGACATGTGTTAGATGATACCAGTGTAATGTTTTGTCTAAATATACATGACATTGTACAGTATTGCCGTTTTCTTCAGAAAACAAACTGTGGCATTTAGATATATCTTCTATACATTTATCGATACACATTATTTGTATATACTTAAAAGACAGAGGATAAGGTACTGTCACAATGAAGTTTTACTGTTTTTAATTTATAGATATGTCTGAAATATGTAAGGCTCCGCCTCATCACTGGGATAAGTTATGAGAATATTATAACACAATACGTACAGCAGTGTGTGCAGTTATTCTATACGTGTCTCTGTTTGTCTGTGCAGCCAGTGGAGCAGTGTCAGTAGCAGTATCTCTGGGAATATACTGTGAGTGTGAATGGTGAGCTGAAATGATTGTAACACAGTGCTGC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               3     5     3     5     2     5     3     6     3     7     3    10     5    13     6    16     5    16     5    16     5    16     5    16     5    16     5    15     5    15     5    15     5    15     5    15     7    16    10    20    10    20    11    21    11    21    11    22    13    24    13    24    13    25    14    27    14    27    15    27    13    27    14    27    26    27    26    27    26    27    25    26    25    26    24    26    25    26    25    26    22    26    25    26    25    26    25    27    27    27    27    27    27    27    26    26    26    26    24    26    25    26    25    26    25    26    17    24    21    23    19    21    18    21    19    21    17    20    18    20    16    19    17    18    18    18    16    19    18    19    19    19    16    19    15    17    15    17    14    16    13    16    13    15    11    14    11    14    11    13     9    12    10    10     9     9     8     8     8     8     7     8     7     7     6     9     9    10     8    10     9     9     9     9     8     9     8    10     5    10    10    10     9    10    10    10     8     9     7     9     8     9     9    10     9    10     9     9     9     9     8     8     8     8     8     8     8     8     7     8     6     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     6     7     6     7     7     8     6     8     8     9     8     9     8     9     9    10    10    11    11    13    12    13    12    13    10    13    11    13    11    13    11    13    10    13    11    13    11    13    11    13    11    16    13    16    13    16    13    16    13    15    13    15    13    15    13    15    11    15    13    14    10    12    11    13    11    14     6    12     8    12    10    14    10    14     8    13    10    13    10    13    10    13    10    14     9    14    11    15    10    15    11    15    11    15    11    15     9    13     9    13     9    12     9    12    10    12    11    12    11    12    11    12    11    12    12    13    12    13    12    13    10    11    10    11    10    11    10    11    10    10    10    10    10    10    10    10     9    10    10    10    10    10    10    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     8    10     9    10     8     9     9     9     6     6     3     5     3     5     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
  5   1   2      en>5                            Xl3.1-IMAGE:5156278.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAGGAGGAGGAGGGTAGGTGGGTGGTTATTGCTCGTCTTGTTTCCTGCTCTAGTTTCTGTACGAGAGAGGAGGGGACCTCGCCTCGTATCTGAGCCTGCTCCAGCCTGGAACTTGCCTTCACCCCGTTTTATGCGACCATTGGCCTCCCCCGCCGCCGGAAATCCTCCTCTCCAGCACAATAATAAAGCCAATCTCTTCCTGCTGCCCAGCTCTGGGCTGCTCCTCCTACTTCTCCTGGGGGCCCGGACTCAGGCAGAGGGAACCCCGGGGACCGGGAGAGGCTTCTCGGACTCGCAGTGGATCTAAGGGCCGGGGCTGTGCTGCAGGGACATCAGTATGAGTCACTCCCCGGTGCAGCACGGCCTGCCTGCGATAATACAGAATCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAGAATAGGCAAAGGCTCATTTGGAGAAGTCTTTAAAGGAATTGACTATAGGACTCAGAAAGTTGTGGCCATAAAAATAATAGATTTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATCACTGTGCTCAGCCAATGTGATAGCCCTTACGTAACAAAGTATTATGGCTCCTATCTTAAGGACACAAAATTATGGATCATTATGGAATACCTTGGAGGAGGCTCAGCTCTGGATCTGTTAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAATCTTAAAGGGACTTGACTACTTGCATTCAGAGAAGAAAATTCACAGGGATATTAAAGCTGCCAATGTGCTGTTATCTGAAAATGGGGAGGTGAAAATAGCCGACTTTGGTGTTGCAGGACAACTTACTGACACTCAGATCAAGAGGAACACCTTTGTTGGAACTCCATTCTGGATGGCACCAGAAGTCATAAAGCAGTCTGCATATGATTCCAAGGCAGATATCTGGTCCCTGGGCATAACGGCTATTGAACTCGCAAAAGGAGAACCTCCTCATTCAGAGCTGCATCCCATGAAAGTCTTGTTCCTTATACCCAAGAACAATCCTCCCTTGCTGGAAGGGAACTACAGCAAAGGTCTGAAGGAGTTTGTAGAAGCCTGCTTAAACAAGGAGCCCAGTTTTAGACCCTCGGCTAAGGAACTGCTGAAACACAAGTTTATTATGCGAAGTGCAAAGAAAACCTCCTACTTAACCGAGCTCATAGACAGGTACAAGAGATGGAAGATAGAACAAGGCCATGAAGCCTCCAGCTCAGACTCTGAGGAGGATGAAGCGGAACAAGCTGCTGGCAGTGAGAAGGATTACTGGAATTTCACAAGAAGAAAGAGGGACTTGAAAAACTTGGAGCCTGTTCCAGCACAGCCAG
  5   1   2      en>5                               Xl3.1-PBX0028H07.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATATAGTGAAAACCCTCATTCAGAGCTGCATCCCATGAAAGTCTTGTTCCTTATACCCAAGAACAATCCTCCCACGCTGGAAGGAAACTACAGCAAGTTCCTGAAGGAGTTTGTAGAAGCCTGCTTAAACAAGGAGCCCAGTTTTAGACCCTCTGCTAAGGAACTGCTGAAACACAAGTTTATTATGCGAAATGCAAAGAAAACCTCCTACTTAACAGAACTCATAGACAGGTACAAGAGATGGAAGATAGAACAAGGCCATGAAGCCTCCAGCTCGGACTCTGATGAGGAAGAAGTAGAACAAGCTGCTGGCAGTGAGAAGGATTATTGGAACTTCACAAGAAGAAAGAGAGACTTGAAAAACTTGGAGCCTGTTCCAGCACAACCAGAAGAGGTTAAAGACATTCCCAAGAGGCCTTTGTCTCAATGCTTATCTACAATAATGTCTCCTTTATTTGCAGAGCTCAAGGAGAAGAGTCAGGCGTGCGGTGGGAATGTAGGCTCAATAGAGGAATTGAGAGAGGCAATTTATTTAGCTGAAGAGGCCTGTCCGGGTATCTCGGACTCCATGGTTTCTCAGCTTCTTATTAGGCTTCAGAGGTATTCTGTTAATGGAGTGGACTCTTCCTCGCACTGAAGGATGTTTTTGTCCTTTTTAAGGCAAAAATGGACCTTGCATTATTCTCCCTATGGAACACGCCTCTGCTCATGGATATCACAGGATGTGGACCTTCCTGAATGATGAGTGACTATAGATAGGGAGTTGGTGAAAGCTATAGTTTTTATGATTTTCTTTTTTTTTTCTCTAATCATAATGCGAATATATAAAAATGTAAAAAAAAAACTTCTGCAAATTACTGTGATAAGGCAAACGAAGATATTGTGAAACCTCAGGTATCTTGCTGTAAGCAGTCCGTTGTGCTGGAGATGGAATGAAATCTTGGTTTAATTCCTCTATGGAAAGTTATCAGATGCCTCGGCCTTCTTTCCTCAAGCCGCTGTGAGCTCCCAGCATGCCCAGCAGTTGAAGCCTATGAATGGTGGGAGATGCAAATCACAACAGCTGGAGGGACGTGGGCTGACATTCCAATTTTACAGTTGACTTTTTACTAGAGTTTGCCAACCTACAAACAGACCCAGGGCATCCCTAGGTGCAAGATGCCATGTTCTGTTTATGGATTTCATATCTGGCAGCCATATTTTATGTTTTATGCTAATGGTTTAAATGAAGCGCCAAGTTGAGTTTTGTTATCTACATACAGAAGCCCTGTGGGACATGTGTTAGATGATACCAGTGTAATGTTTTGTCTAAATATACATGACATTGTACAGTATTGCCGTTTTCTTCAGAAAACAAACTGTGGCATTTAGATATATCTTCTATACATTTATCGATACACATTATTTGTATATACTTAAAAGACAGAGGATAAGGTACTGTCACAATGAAGTTTTACTGTTTTTAATTTATAGATATGTCTGAAATATGTAAGGCTCCGCCTCATCACTGGGATAAGTTATGAGAATATTATAACACAATACGTACAGCAGTGTGTGCAGTTATTCTATACGTGTCTCTGTTTGTCTGTGCAGCCAGTGGAGCAGTGTCAGTAGCAGTATCTCTGGGAATATACTGTGAGTGTGAATGGTGAGCTGAAATGATTGTAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AACCGTGGGGACCTCGCCTCGTAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTCTGAACCTTGCCTTCTCCCCGTTCCATGCGATCATTGGCCTCCGCTGCCGCCGCCGGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATCCTCCTCTCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGCACAATAATAAAGGCAATCTCTTCCTGCTGCCCAGCTCGGCCCCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCTCGGCTGCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCTCCTCCTCCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTAGGCAGAGGGAACCCCGGACACCGGGGCATCGCTGCTCGGATTAGCAGTGGATCTAAGGGCCGGGGCTGTGCTGCAGGGACATCAATATGAGTCACTCCCCGGTGCAGCCCGGCCTGCATGGGATACAGA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----C--T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -C-----C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------T--C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --T----T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --------AC--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------C--G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----C-------
                                               BLH ATG     338     673                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          
                                               BLH MIN     338     284                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          
                                               BLH OVR     338     440                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          
                                               ORF LNG     338      41                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          
  5   1   2      en>5                            Xl3.1-IMAGE:5156278.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAGGAGGAGGAGGGTAGGTGGGTGGTTATTGCTCGTCTTGTTTCCTGCTCTAGTTTCTGTACGAGAGAGGAGGGGACCTCGCCTCGTATCTGAGCCTGCTCCAGCCTGGAACTTGCCTTCACCCCGTTTTATGCGACCATTGGCCTCCCCCGCCGCCGGAAATCCTCCTCTCCAGCACAATAATAAAGCCAATCTCTTCCTGCTGCCCAGCTCTGGGCTGCTCCTCCTACTTCTCCTGGGGGCCCGGACTCAGGCAGAGGGAACCCCGGGGACCGGGAGAGGCTTCTCGGACTCGCAGTGGATCTAAGGGCCGGGGCTGTGCTGCAGGGACATCAGTATGAGTCACTCCCCGGTGCAGCACGGCCTGCCTGCGATAATACAGAATCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAGAATAGGCAAAGGCTCATTTGGAGAAGTCTTTAAAGGAATTGACTATAGGACTCAGAAAGTTGTGGCCATAAAAATAATAGATTTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATCACTGTGCTCAGCCAATGTGATAGCCCTTACGTAACAAAGTATTATGGCTCCTATCTTAAGGACACAAAATTATGGATCATTATGGAATACCTTGGAGGAGGCTCAGCTCTGGATCTGTTAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAATCTTAAAGGGACTTGACTACTTGCATTCAGAGAAGAAAATTCACAGGGATATTAAAGCTGCCAATGTGCTGTTATCTGAAAATGGGGAGGTGAAAATAGCCGACTTTGGTGTTGCAGGACAACTTACTGACACTCAGATCAAGAGGAACACCTTTGTTGGAACTCCATTCTGGATGGCACCAGAAGTCATAAAGCAGTCTGCATATGATTCCAAGGCAGATATCTGGTCCCTGGGCATAACGGCTATTGAACTCGCAAAAGGAGAACCTCCTCATTCAGAGCTGCATCCCATGAAAGTCTTGTTCCTTATACCCAAGAACAATCCTCCCTTGCTGGAAGGGAACTACAGCAAAGGTCTGAAGGAGTTTGTAGAAGCCTGCTTAAACAAGGAGCCCAGTTTTAGACCCTCGGCTAAGGAACTGCTGAAACACAAGTTTATTATGCGAAGTGCAAAGAAAACCTCCTACTTAACCGAGCTCATAGACAGGTACAAGAGATGGAAGATAGAACAAGGCCATGAAGCCTCCAGCTCAGACTCTGAGGAGGATGAAGCGGAACAAGCTGCTGGCAGTGAGAAGGATTACTGGAATTTCACAAGAAGAAAGAGGGACTTGAAAAACTTGGAGCCTGTTCCAGCACAGCCAG
                                                  Xl3.1-CHK-1012687773                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAGGAGGGTAGGTGGGTGGTTATTGCTCGTCTTGTTTCCTGCTCTAGTTTCTGTACGAGAGAGGAxxxxxxCTCGCCTCGTATxxGxxxCTGCTCCAGCCTGGAACTTGCCTTCACCCCGTTTTATGCGACCATTGGCCTCCCCCGCCGCCGGAAATCCTCCTCTCCAGCACAATAATAAAGCCAATCTCTTCCTGCTGCCCAGCxCxxGGCTGCTCCTCCTACTTCxCxxxxGGGCCCxxxCxxAGGCAGAGGGAACCCCGGGGACCGGGAGAGGCTTCTCGGACTCGCAGTGGATCTAAGGGCCGGGGCTGTGCTGCAGGGACATCAGTATGAGTCACTCCCCGGTGCAGCACGGCCTGCCTGCGATAATACAGAATCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAGAATAGGCAAAGGCTCATTTGGAGAAGTCTTTAAAGGAATTGACTATAGGACTCAGAAAGTTGTGGCCATAAAAATAATAGATTTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATCACTGTGCTCAGCCAATGTGATAGCCCTTACGTAACAAAGTATTATGGCTCCTATCTTAAGGACACAAAATTATGGATCATTATGGAATAxCTxGGAGGAGGCTCAGCTCTGGATCTGTTAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAATCTTAAAGGGACTTGACTACTTGCATTCAGAGAAGAAAATTCACAGGGATATTAAAGCTGCCAATGTGCTGTTATCTGAAAATGGGGAGGTGAAAATAGCCGACTTTGGTGTTGCAGGACAACTTACTGACACTCAGATCAAGAGGAACACCTTTGTTGGAACTCCATTCTGGATGGCACCAGAAGTCATAAAGCAGTCTGCATATGATTCCAAGGCAGATATCTGGTCCCTGGGCATAACGGCTATTGAACTCGCAAAAGGAGAACCTCCTCATTCAGAGCTGCATCCCATGAAAGTCTTGTTCCTTATACCCAAGAACAATCCTCCCTTGCTGGAAGGGAACTACAGCAAAGGTCTGAAGGAGTTTGTAGAAGCCTGCTTAAACAAGGAGCCCAGTTTTAGACCCTCGGCTAAGGAACTGCTGAAACACAAGTTTATTATGCGAAGTGCAAAGAAAACCTCCTACTTAACCGAGCTCATAGACAGGTACAAGAGATGGAAGATAGAACAAGGCCATGAAGCCTCCAGCTCAGACTCTGAGGAGGATGAAGCGGAACAAGCTGCTGGCAGTGAGAAGGATTACTGGAATTTCACAAGAAGAAAGAGGGACTTGAAAAACTTGGAGCCTGTTCCAGCAC
  5  -1   2       bld FaBN                            IMAGE:8078515.5p TTCGACAACATTTTCTTTCTGAAGCTAAAGTGGTAGTTATTAGGGAGCCCAGAAGTGACATGTTGGGTTCCCCTCACTCAGCACCACTAATAGAGCAGCAGCATTAGACTGGAGTCAGGGCCCTGGCAAGTTTGTGCTGCTCTTGTTGGATTTCCTCTCAGATACATAAGTATAGTAAGTATGTAGCAGGTCAGACAGTAGTAATGTAGAGGTACTTGTAAACTTAGCAATGGCATAAGCCACAGGACCGCCATCAGAAATCGCTGGGCCCTTTACAACAACATTTCCTGAGCCCCCTGGGCTGCGCCCACCGCACATTATAAGAAAATTGGTGGCCAGGGCCCCTTTAACGTCCATGCTTTCCCGAAGTCATCAGCTCTCAGAAAGATGGGGGGCCTGACTAATCAAGTAAGGGGCCCTAGGGGCCCCCTACAGCTTTCTCCCCTGATGGCTGCCCTGATAAGCCATACGGGCACCCAGGGGTGACTCAGGGCACGAGGGGGAATGTCCCTGGGGGAAAAGTGGACGAGTCCGAGCTAAACTGACGTGCCATTGCCCTGGCGAGAGTGAAGGCGCAGGAGGAGCTGTGTGAGGGGAAGAGACAGGAGAAGGAGGAGGTGGTTATTACTCTTCTAGTTTCCTGCTCTAGTTTGTGTACGAGAAAGGAAGCCGTGGGGACCTCGCCTCGTATCTGAGCGTCTGAACCTTGCCTTCTCCCCGTTCCATGCGATCATTGGCCTCCGCTGCCGCCGCCGGAAA
  5   1   2       bld Ga12 5g3  out                        XL145d02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCTCAGGGTAGAGGGGAAAGGCTCCCCGGNATGAGAAGTTGACGAGTCCGAGCTGAACTGACGTCCCACTGGCCTGGCGAGAGTGAGGGCGCAGGAGGAGCTGTGTGAGGGGAAGAGACAGGAGGAGGAGGAGGGTAGGTGGGTGGTTATTGCTCGTCTTGTTTCCTGCTCTAGTTTCTGTACGAGAGAGGAAACCGTGGGGACCTCGCCTCGTATCTGCTCCAGCCTGGAACTTGCCTTCACCCCGTTTTATGCGACCATTGGCCTCCCCCGCCGCCGGAAATCCTCCTCTCCAGCACAATAATAAAGCCAATCTCTTCCTGCTGCCCAGCTCTGCCCTCGGCTGCTTCTCCTCCTCCTGGGCCCGGACTCGTAGGCAGAGGGAACCCCGGACACCGGGGCATCGCTGCTCGGATTAGCAGTGGATCTAAGGGCCGGGGCTGTGCTGCAGGGACATCAATATGAGTCACTCCCCGGTGCAGCCCGGCCTGCATGGGATACAGAATCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAAAATA
  5   1   2       bld Gas9 5g                              BG409642.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCACGCGTCCGTGTCCCTGGGGGAGAAGTGGACGAGTCCGAGCTAAACTGACGTGCCATTGCCCTggcgagagtgaaggcgcaggaggagctgtgtgaggggaagagacaggagaaggaggaggTGGTTATTACTCTTCTAGTTTCCTGCTCTAGTTTGTGTACGAGAAAGGAAGCCGTGGGGACCTCGCCTCGTATCTGAGCGTCTGAAACCTTGCCTTCTCCCCGTTCCATGCGATCATTGGCCTCCGCTGCCGCCGCCGGAAATCCTCCTCTTCAGCACAATAATAAAGGCAATCTCTTCCTGCTGCCCAGCTCGGCCCCCGGCTGCTCCTCCTACTTCTCCTGGGCCCGGACTTGTAGGCAGAGGGAACTCCGGGGACCGGGAGAGGCTTCTCGGACTCGCAGTGGATCTAAGGGCCGGGGCTGTGCTGCAGGGACATCAGTATGAGTCACTCCCCGGTGCAGCACGGCCTGCCTGGGATAATACAGAATCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAGAATAGGCAAAGGCTCATTTGGAGAAGTCTTTAAAGGAATTGACTATAGGACTCAAAAAGTTGTAGCCATAAAAATAATAGATTTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATCACTGTGCTCANC
  5   1   2       bld Emb1 5g                         IMAGE:5155295.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGGATGAGAAGTTGACGAGTCCGAGCTGAACTGACGTCCCACTGGCCTGGCGAGAGTGAGGGCGCAGGAGGAGCTGTGTGAGGGGAAGAGACAGGAGGAGGAGGGTAGGTGGGTGGTTATTGCTCGTCTTGTTTCCTGCTCTAGTTTCTGTACGAGAGAGGAAACCGTGGGGACCTCGCCTCGTATCTGCTCCAGCCTGGAACTTGCCTTCACCCCTTTATGCGACCATTGGCCTCCCCCGCCGCCGGAAATCCTCCTCTCCAGCACAATAATAAAGCCAATCTCTTCCTGCTGCCCAGCTCTGCCCTCGGCTGctcctcctcctcctcctcctGGGCCCGGACTCGTAGGCAGAGGGAACCCCGGACACCGGGGCATCGCTGCTCGGATTAGCAGTGGATCTAAGGGCCGGGGCTGTGCTGCAGGGACATCAATATGAGTCACTCCCCGGTGCAGCCCGGCCTGCATGGGATACAGAATCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAAAATAGGCAAAGGCTCGTTTGGAGAAGTTTTTANAGGAATTGACTATAGGACTCAGAAAGTTGTGGCCATAAAAATTATAGATCTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATCACTGTGCTCAGCCAATGTGACAGCCCCTATGTAACCAAGTACTATGGCTCCTATCTTAAGGACACAAAATTATGGATCATTATGGAATACCCTTGGGAGGAGCTCAGCTTCTGGATTTGNTAGAANCCTGGTCCCTTTAGATTGAAACACANGATTGGCAACCATTTTTACCGGGAAATT
  5   1   2       bld Ga12 5g3  out                        XL199k24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAGGAGGAGGAGGGTAGGTGGGTGGTTATTGCTCGTCTTGTTTCCTGCTCTAGTTTCTGTACGAGAGAGGAAACCGTGGGGACCTCGCCTCGTATCTGCTCCAGCCTGGAACTTGCCTTCACCCCGTTTTATGCGACCATTGGCCTCCCCCGCCGCCGGAAATCCTCCTCTCCAGCACAATAATAAAGCCAATCTCTTCCTGCTGCCCAGCTCTGCCCTCGGCTGCTTCTCCTCCTCCTGGGCCCGGACTCGTAGGCAGAGGGAACCCCGGACACCGGGGCATCGCTGCTCGGATTAGCAGTGGATCTAAGGGCCGGGGCTGTGCTGCAGGGACATCAATATGAGTCACTCCCCGGTGCAGCCCGGCCTGCATGGGATACAGAATCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAAAATAGGCAAAGGCTCGTTTGGAGAAGTTTTTAAAGGAATTGACTATAGGACTCAGAAAGTTGTGGCCATAAAAATTATAGATCTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATCACTGTGCTCAGCCAATGTGACAGCCCCTATGTAACCAAGTACTATGGCTCCTATCTTAAGGACACAAAATTATGGATCATTATGGAATACCTTG
  5   1   2       bld Ga12 5g3  out                        XL192e11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGTGCTCGTCTTGTTTCCTGCTCTAGTTTCTGTACGAGAGAGGAAACCGTGGGGACCTCGCCTCGTATCTGCTCCAGCCTGGAACTTGCCTTCACCCCGTTTTATGCGACCATTGGCCTCCCCCGCCGCCGGAAATCCTCCTCTCCAGCACAATAATAAAGCCAATCTCTTCCTGCTGCCCAGCTCTGCCCTCGGCTGCTTCTCCTCCTCCTGGGCCCGGACTCGTAGGCAGAGGGAACCCCGGACACCGGGGCATCGCTGCTCGGATTAGCAGTGGATCTAAGGGCCGGGGCTGTGCTGCAGGGACATCAATATGAGTCACTCCCCGGTGCAGCCCGGCCTGCATGGGATACAGAATCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAAAATAGGCAAAGGCTCGTTTGGAGAAGTTTTTAAAGGAATTGACTATAGGACTCAGAAAGTTGTGGCCATAAAAATTATAGATCTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATCACTGTGCTCAGCCAATGTGACAGCCCCTATGTAACCAAGTACTATGGCTCCTATCTTAAGGACACAAAATTATGGATCATTATGGAATACCTTGGAGGAGGCTCAGCTCTGGATT
  5   1   2       bld Brn1 5g                         IMAGE:6954667.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTGTGTACGAGAAAGGAAGCCGTGGGGACCTCGCCTCGTATCTGAGCGTCTGAACCTTGCCTTCTCCCCGTTCCATGCGATCATTGGCCTCCGCTGCCGCCGCCGGAAATCCTCCTCTCCAGCACAATAATAAAGGCAATCTCTTCCTGCTGCCCAGCTCGGCCCCCGGCTGCTCCTCCTACTTCTCCTGGGCCCGGACTCGTAGGCAGAGGGAACCCCGGGGACCGGGAGAGGCTTCTCGGACTCGCAGTGGATCTAAGGGCCGGGGCTGTGCTGCAGGGACATCAGTATGAGTCACTCCCCGGTGCAGCACGGCCTGCCTGCGATAATACAGAATCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAGAATAGGCAAAGGCTCATTTGGAGAAGTCTTTAAAGGAATTGACTATAGGACTCAGAAAGTTGTGGCCATAAAAATAATAGATTTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATCACTGTGCTCAGCCAATGTGATAGCCCTTACGTAACAAAGTATTATGGCTCCTATCTTAAGGACACAAAATTATGGATCATTATGGAATACCTCGGAGGAGGCTCAGCTCTGGATCTGTTAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAATCTTAAAGGGACTTGACTACTTGCATTCAGAGAAGAAAATTCACAGGGATATTAAAGCTGCCAATGTGCTGTTATCTGAAAATGGGGAGGTGAAAATAGCCGACTTTGGTGTTGCAGGACAACTTACTGACACTCAGATCAAGAGGGAACACCTTTTGTTGGAAACTCCATTCTGGGATGGCCACCTGAAAGTCATAN
  5   1   2       bld Ov1  5g                         IMAGE:5048650.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTACGAGAAAGGAAGCCGTGGGGACCTCGCCTCGTATCTGAGCGTCTGAACCTTGCCTTCTCCCCGTTCCATGCGATCATTGGCCTCCGCTGCCGCCGCCGGAAATCCTCCTCTCCAGCACAATAATAAAGGCAATCTCTTCCTGCTGCCCAGCTCGGCCCCGGCTGCTCCTCCTACTTCTCCTGGGCCCGGACTCGTAGGCAGAGGGAACCCCGGGGACCGGGAGAGGCTTCTCGGACTCGCAGTGGATCTAAGGGCCGGGGCTGTGCTGCAGGGACATCAGTATGAGTCACTCCCCGGTGCAGCACGGCCTGCCTGCGATAATACAGAATCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAGAATAGGCAAAGGCTCATTTGGAGAAGTCTTTAAAGGAATTGACTATAGGACTCAGAAAGTTGTGGCCATNAAAATAATAGATTTGGAAGAAGCAGAAGATGANATAGAGGATATTCAGCAAGAAATCACTGTGCTCAGCCAATGTGATAGCCCTTACGTAACAAAGTATTATGGCTCCTATCTTAAGGACACAAAATTATGGATCATTATG
  5   1   2       bld Tbd7 5g3  out                        XL076p14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGCACGNGGTGGGGNACCTCGCCTCGTNTCTGCTCCAGCCTGGNAACTTGCCTTCACCCCGTTTTATGCGACCATTGGCCTCCCCCGCCGCCGGNAAATCCTCCTCTCCAGCACAATAATAAAGCCAATCTCTTCCTGCTGCCCAGCTCTGCCCTCGGCTGctcctcctcctcctcctcctGGGCCCGGNCTCGTAGGCAGAGGGAACCCCGGACACCGGGGCATCGCTGCTCGGATTAGCAGTGGATCTAAGGGCCGGGGCTGTGCTGCAGGGACATCAATATGAGTCACTCCCCGGTGCAGCCCGGCCTGCATGGGATACAGAATCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAAAATAGGCAAAGGCTCGTTTGGAGAAGTTTTTAAAGGAATTGACTATAGGACTCAGAAAGTTGTGGCCATAAAAATTATAGATCTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATCACTGTGCTCAGCCAATGTGACAGCCCCTATGTAACCAAGTACTATGGCTCCTATCTTAAGGACACAAAATTATGGATCATTATGGAATACCT
  5   1   2       bld Sp1  5g                         IMAGE:5506115.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGACGCGTGGGAAACCGTGGGGACCTCGCCTCGTATCTGCTCCAGCCTGGAACTTGCCTTCACCCCGTTTTATGCGACCATTGGCCTCCCCCGCCGCCGGAAATCCTCCTCTCCAGCACAATAATAAAGCCAATCTCTTCCTGCTGCCCAGCTCTGCCCTCGGCTGCTCCTCCTCCTCCTGGGCCCGGACTCGTAGGCAGAGGGAACCCCGGACACCGGGGCATCGCTGCTCGGATTAGCAGTGGATCTAAGGGCCGGGGCTGTGCTGCAGGGACATCAATATGAGTCACTCCCCGGTGCAGCCCGGCCTGCATGGGATACAGAATCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAAAATAGGCAAAGGCTCGTTTGGAGAAGTTTTTAAAGGAATTGACTATAGGACTCAGAAAGTTGTGGCCATAAAAATTATAGATCTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATCACTGTGCTCAGCCAATGTGACAGCCCCTATGTAACCAAGTACTATGGCTCCTATCTTAAGGACACAAAATTATGGATCATTATGGAATACCTTGGAGGAGGCTCAGCTCTGGATTTGTTAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAATCTTAAAGGGACTTGACTACTTGCATTCAGAGAAGAAAATTCACAGGGATATTAAAGCTGCCAATGTGCTNGTATCTGAACACGGGGAGN
  5   1   2       bld DMZ  5g3  in                         xl302i22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAAGCCGTGGGGACCTCGCCTCGTATCTGAGCGTCTGAACCTTGCCTTCTCCCCGTTCCATGCGATCATTGGCCTCCGCTGCCGCCGCCGGAAATCCTCCTCTCCAGCACAATAATAAAGGCAATCTCTTCCTGCTGCCCAGCTCGGCCCCCGGCTGCTCCTCCTACTTCTCCTGGGCCCGGACTCGTAGGCAGAGGGAACCCCGGGGACCGGGAGAGGCTTCTCGGACTCGCAGTGGATCTAAGGGCCGGGGCTGTGCTGCAGGGACATCAGTATGAGTCACTCCCCGGTGCAGCACGGCCTGCCTGCGATAATACAGAATCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAGAATAGGCAAAGGCTCATTTGGAGAAGTCTTTAAAGGAATTGACTATAGGACTCAGAAAGTTGTGGCCATAAAAATAATAGATTTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATCACTGTGCTCAGCCAATGTGATAGCCCTTACGTAACAAAGTATTATGGCTCCTATCTTAAGGACACAAAATTATGGATCATTATGGAATACCTCGGAGGAGGCTCAGCTCTGGATCTGTTAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAA
  5   1   2       bld Ga15 5g                            XL511l10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAACCGTGGGGACCTCGCCTCGTATCTGCTCCAGCCTGGAACTTGCCTTCACCCCGTTTTATGCGACCATTGGCCTCCCCCGCCGCCGGAAATCCTCCTCTCCAGCACAATAATAAAGCCAATCTCTTCCTGCTGCCCAGCTCTGCCCTCGGCTGctcctcctcctcctcctcctGGGCCCGGACTCNNAGGCAGAGGGAACCCCGGACACCGGGGCATCGCTGCTCGGATTAGCAGTGGATCTAAGGGCCGGGGCTGTGCTGCANGGACATCAATATGAGTCACTCCCCGGTGCAGCCCGGCCTGCATGGGATACAGAATCTTAAAGCTGATCCAGAGGAACTGTTCANAAAACTAGAGAAAATAGGCAAAGGCTCGTTTGGAGAAGTTTTTAAAGGAATTGACTATAGGACTCANAAAGTTGTGGCCATAAAAATTATAGATCTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATCACTGTGCTCAGCCAATGTGACAGCCCCTATGTAACCAAGTACTATGGCTCCTATCTTAAGGACACAAAATTATGGATCATTATGGAATACCTTGGAGGAGGCTCAGCTCTGGATTTGTTAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAATCTTAAAGGGACTTGACTACTTGCATTCAGAGAAGAAAATTCACAGGGATATTAAAGCTGCCAATGTGCTGTTATCTGAACACGGGGGAGGTGAAACTAGCTGACTTTGGTGTTGCANGGACAACTTACT
  5   1   2       bld Tbd7 5g3  out                        XL107g17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGTGGGGACCTCGCCTCGTATCTGCTCCAGCCTGGAACTTGCCTTCACCCCGTTTTATGCGACCATTGGCCTCCCCCGCCGCCGGAAATCCTCCTCTCCAGCACAATAATAAAGCCAATCTCTTCCTGCTGCCCAGCTCTGCCCTCGGCTGctcctcctcctcctcctcctGGGCCCGGACTCGTAGGCAGAGGGAACCCCGGACACCGGGGCATCGCTGCTCGGATTAGCAGTGGATCTAAGGGCCGGGGCTGTGCTGCAGGGACATCAATATGAGTCACTCCCCGGTGCAGCCCGGCCTGCATGGGATACAGAATCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAAAATAGGCAAAGGCTCGTTTGGAGAAGTTTTTAAAGGAATTGACTATAGGACTCAGAAAGTTGTGGCCATAAAAATTATAGATCTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATCACTGTGCTCAGCCAATGTGACAGCCCCTATGTAACCAAGTACTATGGCTCCTATCTTAAGGACACAAAATTATGGATCATTATGGAATACCTTGGAGGAGGCTCAGCTCTGGATTTGTTAGAACCTGGTCCTTTAGATGAAACACAGA
  5   1   2       bld Ga12 5g3  out                        XL203i04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGAGGGGGGACCTCGCCTCGTATCTGCTCCAGCCTGGAACTTGCCTTCACCCCGTTTTATGCGACCATTGGCCTCCCCCGCCGCCGGAAATCCTCCTCTCCAGCACAATAATAAAGCCAATCTCTTCCTGCTGCCCAGCTCTGCCCTCGGCTGCTTCTCCTCCTCCTGGGCCCGGACTCGTAGGCAGAGGGAACCCCGGACACCGGGGCATCGCTGCTCGGATTAGCAGTGGATCTAAGGGCCGGGGCTGTGCTGCAGGGACATCAATATGAGTCACTCCCCGGTGCAGCCCGGCCTGCATGGGATACAGAATCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAAAATAGGCAAAGGCTCGTTTGGAGAAGTTTTTAAAGGAATTGACTATAGGACTCAGAAAGTTGTGGCCATAAAAATTATAGATCTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATCACTGTGCTCAGCCAATGTGACAGCCCCTATGTAACCAAGTAATGGCTCCTATCTTAAGGACACAAAATTATGGATCATTATGGAATACCTTGGAGGAGGCTCAGCTCTGGATTTGTTAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAATCTTAAAGGGACTTGACTACTTGCATTCAGA
  5   1   2       bld Neu7 5g3  in                         XL017n16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCTCGCCTCGTATCTGAGNCGTCTGAACCTTGCCTTCTCCCCGTTCCATGCGATCATTGGCCTCCGCTGCCGCCGCCGGAAATCCTCCTCTCCAGCACAATAATAAAGGCAATCTCTTCCTGCTGCCCAGCTCGGCCCCGGCTGCTCCTCCTACTTCTCCTGGGCCCGGACTCGTAGGCAGAGGGAACCCCGGGGACCGGGAGAGGCTTCTCGGACTCGCAGTGGATCTAAGGGCCGGGGCTGTGCTGCAGGGACATCAGTATGAGTCACTCCCCGGTGCAGCACGGCCTGCCTGCGATAATACAGAATCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAGAATAGGCAAAGGCTCATTTGGAGAAGTCTTTAAAGGAATTGACTATAGGACTCAGAAAGTTGTGGCCATAAAAATAATAGATTTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATCACTGTGCTCAGCCAATGTGATAGCCCTTACGTAACAAAGTATTATGGCTCCTATCTTAAGGACACAAAATTATGGATCATTATGGAATACCTCGGAGGAGGCTCAGCTCTGG
  5   1   2       bld FaBN 5g3  in                    IMAGE:8075488.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGCCTCGTATCTGAGCGTCTGAACCTTGCCTTCTCCCCGTTCCATGCGATCATTGGCCTCCGCTGCCGCCGCCGGAAATCCTCCTCTCCAGCACAATAATAAAGGCAATCTCTTCCTGCTGCCCAGCTCGGCCCCCGGCTGCTCCTCCTACTTCTCCTGGGCCCGGACTCGTAGGCAGAGGGAACCCCGGGGACCGGGAGAGGCTTCTCGGACTCGCAGTGGATCTAAGGGCCGGGGCTGTGCTGCAGGGACATCAGTATGAGTCACTCCCCGGTGCAGCACGGCCTGCCTGGGATAATACAGAATCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAGAATAGGCAAAGGCTCATTTGGAGAAGTCTTTAAAGGAATTGACTATAGGACTCAGAAAGTTGTGGCCATAAAAATAATAGATTTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATCACTGTGCTCAGCCAATGTGATAGCCCTTACGTAACAAAGTATTATGGCTCCTATCTTAAGGACACAAAATTATGGATCATTATGGAATACCTCGGAGGAGGCTCAGCTCTGGATCTGTTAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAATCTTAAAGGGGCTTGACTACTTGCATTCAGAGAAGAAAATTCACAGGGATATTAAAGCTGCCAATGTGCTGTTATCTGAAAATGGGGA
  5   1   2       bld Ga12 5g3  in                         XL216a24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGGGCTCCTCCTACTTCTCCTGGGCCCGGACTCGTAGGCAGAGGGAACCCCGGGGACCGGGAGAGGCTTCTCGGACTCGCAGTGGATCTAAGGGCCGGGGCTGTGCTGCAGGGACATCAGTATGAGTCACTCCCCGGTGCAGCACGGCCTGCCTGGGATAATACAGAATCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAGAATAGGCAAAGGCTCATTTGGAGAAGTCTTTAAAGGAATTGACTATAGGACTCAGAAAGTTGTAGCCATAAAAATAATAGATTTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATCACTGTGCTCAGCCAATGTGATAGCCCTTACGTAACAAAGTATTATGGCTCCTATCTTAAGGACACAAAATTATGGATCATTATGGAATATCTCGGAGGAGGCTCAGCTCTGGATCTGTTAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAATCTTAAAGGGACTTGACTACTTGCATTCAGAGAAGAAAATTCACAGGGATATTAAAGCTGCCAATGTGCTGTTATCTGAAAATGGGGAGGTGAAAATAGCCGACTTTGGTGTTGCAGGACAACTTACTGACACTCAGATCAAGAGGAA
  5   1   2       bld Ov1  5g                         IMAGE:8331339.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCTCCTCCTACTTCTCCTGGGCCCGGACTCGTAGGCAGAGGGAACCCCGGGGACCGGGAGAGGCTTCTCGGACTCGCAGTGGATCTAAGGGCCGGGGCTGTGCTGCAGGGACATCAGTATGAGTCACTCCCCGGTGCAGCACGGCCTGCCTGCGATAATACAGAATCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAGAATAGGCAAAGGCTCATTTGGAGAAGTCTTTAAAGGAATTGACTATAGGACTCAGAAAGTTGTGGCCATAAAAATAATAGATTTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATCACTGTGCTCAGCCAATGTGATAGCCCTTACGTAACAAAGTATTATGGCTCCTATCTTAAGGACACAAAATTATGGATCATTATGGAATATCTCGGAGGAGGCTCAGCTCTGGATCTGTTAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAATCTTAAAGGGACTTGACTACTTGCATTCAGAGAAGATAATTCACAGGGATATTAAAGCTGCCAATGTGCTGTTATCTGAGAATGGGGAGGTGAAAATAGCCGACTTTGGTGTTGCAGGACACTTACTGAACCTCAGATCAAGAGGAACACCTTTGTTGGAACTCCATTCTGGATGGCACTGAAGTCATAAAGCATTCTGC
  5   1   2       bld DMZ  5g3  in                         xl295m22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCTCCTCCTACTTCTCCTGGGCCCGGACTCGTAGGCAGAGGGAACCCCGGGGACCGGGAGAGGCTTCTCGGACTCGCAGTGGATCTAAGGGCCGGGGCTGTGCTGCAGGGACATCAGTATGAGTCACTCCCCGGTGCAGCACGGCCTGCCTGGGATAATACAGAATCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAGAATAGGCAAAGGCTCATTTGGAGAAGTCTTTAAAGGAATTGACTATAGGACTCAGAAAGTTGTAGCCATAAAAATAATAGATTTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATCACTGTGCTCAGCCAATGTGATAGCCCTTACGTAACAAAGTATTATGGCTCCTATCTTAAGGACACAAAATTATGGATCATTATGGAATATCTCGGAGGAGGCTCAGCTCTGGATCTGTTAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAATCTTAAAGGGACTTGACTACTTGCATTCAGAGAAGAAAATTCACAGGGATATTAAAGCTGCCAATGTGCTGTTATCTGAAAATGGGGAGGTGAAAATAGCCGACTTTGGTGTTGCAGGACAACTTACTGACACTCAGATCAAGAGGAACACCTTTGTTGGAACTCCATTCTGGATGGCACCTGAAGTCATAAAGCAGTCTGCATATGATTCCANG
  5   1   2       bld Em10 5g                         IMAGE:8319294.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCTCCTCCTCCTCCTGGGCCCGGACTCGTAGGCAGAGGGAACCCCGGACACCGGGGCATCGCTGCTCGGATTAGCAGTGGATCTAAGGGCCGGGGCTGTGCTGCAGGGACATCAATATGAGTCACTCCCCGGTGCAGCCCGGCCTGCATGGGATACAGAATCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAAAATAGGCAAAGGCTCGTTTGGAGAAGTTTTTAAAGGAATTGACTATAGGACTCAGAAAGTTGTGGCCATAAAAATTATAGATCTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATCACTGTGCTCAGCCAATGTGACAGCCCCTATGTAACCAAGTACTATGGCTCCTATCTTAAGGACACAAAATTATGGATCATTATGGAATACCTTGGAGGAGGCTCAGCTCTGGATTTGTTAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAATCTTAAAGGGACTTGACTACTTGCATTCAGAGAAGAAAATTCACAGGGATATTAAAGCTGCCAATGTGCTGTTATCTGAACACGGGGAGGTGAAATTAGCTGACTTTGGTGTTGCAGGACAACTTACTGACACTCAGATCAAGAGGAACACCTTTGTTGGAACTCCATTCTGGATGGCACCAGAA
  5   1   2       bld Gas5 5g3  in                    IMAGE:3749806.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TACTTCTCCTGGGCCCGGACTCGTAGGCAGAGGGAACCCCGGGGACCGGGAGAGGCTTCTCGGACTCGCAGTGGATCTAAGGGCCGGGGCTGTGCTGCAGGGACATCAGTATGAGTCACTCCCCGGTGCAGCACGGCCTGCCTGCGATAATACAGAATCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAGAATAGGCAAAGGCTCATTTGGAGAAGTCTTTAAAGGAATTGACTATAGGACTCAGAAAGTTGTGGCCATAAAAATAATAGATTTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATCACTGTGCTCAGCCAATGTGATAGCCCTTACGTAACAAAGTATTATGGCTCCTATCTTAAGGACACAAAATTATGGATCATTATGGAATATCTCGGAGGAGGCTCAGCTCTGGATCTGTTAGAAACCTGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAATCTTAGAGGGACTTGACTACTTGCATTCAGAGAAGAANATTCACAGGGATATTAAAGCTGCCAATGTGCTGNTATCTGNAAATGGGGAGGTGAAAATAGCCCGACTTGGT
  5   1   2       bld Emb1 5g                         IMAGE:5156278.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACTTGTAGGCAGAGGGAACTCCGGGGACCGGGAGAGGCTTCTCGGACTCGCAGTGGATCTAAGGGCCGGGGCTGTGCTGCAGGGACATCAGTATGAGTCACTCCCCGGTGCAGCACGGCCTGCCTGGGATAATACAGAATCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAGAATAGGCAAAGGCTCATTTGGAGAAGTCTTTAAAGGAATTGACTATAGGACTCAGAAAGTTGTAGCCATAAAAATAATAGATTTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATCACTGTGCTCAGCCAATGTGATAGCCCTTACGTAACAAAGTATTATGGCTCCTATCTTAAGGACACAAAATTATGGATCATTATGGAATATCTTGGAGGAGGCTCAGCTCTGGATCTGTTAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAATCTTAAAGGGACTTGACTACTTGCATTCAGAGAAGAAAATTCACAGGGATATTAAAGCTGCCAATGTGCTGTTATCTGAAAATGGGGAGGTGAAAATAGCCGACTTTGGTGTTGCAGGACAACTTACTGACACTCAGATCAAGAGGAACACCTTTGTTGGAACTCCATTCTGGATGGCACCTGAAGTCATAAAGCAGTCTGCATATGATTCCAAGGCAGATATCTGGTCCCTGGGTATAACTGCTATTGAACTCGCAAAAGGGGAACCGCCTCATTCAGAGCTGCATCCCCATGAAGTCTTGTTCCTTATACCCAAGAACATCCCTCCACGCTGGNAAGGAACTACAGCAAGTTCCTGAAAGGAGTTTGTAGAAGCCTGGCTAAACAAGGAGCCCAGTTTTTAGACCCTCTGCCTAAGGAACTGCCTGAACCCAAGTTTATTATGCCGAATGCAAAGAAA
  5   1   2       bld Tbd7 5g3  in                         XL098o07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGAGAGGCTTCTCGGNACTCGCAGTGGATCTAAGGGCCGGGGCTGTGCTGCAGGGACATCAGTATGAGTCACTCCCCGGTGCAGCACGGCCTGCCTGGGATAATACAGAATCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAGAATAGGCAAAGGCTCATTTGGAGAAGTCTTTAAAGGAATTGACTATAGGACTCAGAAAGTTGTGGCCATAAAAATAATAGATTTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATCACTGTGCTCAGCCAATGTGATAGCCCTTACGTAACAAAGTATTATGGCTCCTATCTTAAGGACACAAAATTATGGATCATTATGGAATATCTCGGAGGAGGCTCAGCTCTGGATCTGTTAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAATCTTAAAGGGACTTGACTACTTGCATTCAGAGAAGAAAATTCACAGGGATATTAAAGCTGCCAATGTGCTGTTATCTGAAAATGGGGAGGTGAAAATAGCCGACTTTGGTGTTGCAGGACAACTTACTGACACTCAGATCAAGAGGAACACCCTTTGTTGGAACT
  5   1   2       bld Ga18 5g3  in                        xlk3n01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GNTTCTCGGACTCGCAGTGGATCTAAGGGCCGNNNNNNNTNCAGGGACATCAGTATGAGTCACTCCCCGGNGCAGCACGGNCTNNCTGGGATAATACAGAATCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAGAATAGGCAAAGGCTCATTTGGAGAAGNCTTTAAAGGAATTGACTATAGGACTCAGAAAGNTGTAGCCATAAAAATAATAGANTTGGAAGAAGNAGAAGATGAAATAGAGGATATTCAGCAAGAAATCACTGTGCTCAGCCAATGTGATAGCCCTTACGTAACAAAGTATTATGGCTCCTATCTTAAGGACACAAAATTATGGATCATTATGGAATATCTCGGAGGAGGCTCAGCTCTGGATCTGTTAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAATCTTAAAGGGACTTGACTACTTGCATTCAGAGAAGAAAATTCACAGGGATATTAAAGCTGCCAATGTGCTGTTATCTGAAAATGGGGAGGTGAAAATAGCCGACTTTGGTGTTGCAGGACAACTTACTGACACTCAGATCAAGAGGAACACCTTTGTTGGAACTCCATTCTGGATGGCACCTGAAGTCATAAAGCAGTCTGCATATGATTCCAAGGCAGANATCTGGTCCCTGGGTATAACTGCTATTGAACTCGCAAAAGGGNNCNNCTCATTCAGAGCTGCATCCCATGAAAGNCTT
  5   1   2       bld Ov1  5g                         IMAGE:8331540.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCGGACTCGCAGTGGATCTAAGGGCCGGGGCTGTGCTGCAGGGACATCAGTATGAGTCACTCCCCGGTGCAGCACGGCCTGCCTGCGATAATACAGAATCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAGAATAGGCAAAGGCTCATTTGGAGAAGTCTTTAAAGGAATTGACTATAGGACTCAGAAAGTTGTGGCCATAAAAATAATAGATTTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATCACTGTGCTCAGCCAATGTGATAGCCCTTACGTAACAAAGTATTATGGCTCCTATCTTAAGGACACAAAATTATGGATCATTATGGAATATCTCGGAGGAGGCTCAGCTCTGGATCTGTTAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAATCTTAAAGGGACTTGACTACTTGCATTCAGAGAAGAAAATTCACAGGGATATTAAAGCTGCCAATGTGCTGTTATCTGAAAATGGGGAGGTGAAAATAGCCGACTTTGGTGTTGCAGGACAACTTACTGACACTCAGATCAAGAGGAACACCTTTGTTGGAACTCCATTCTGGATGGCACCTGAAGTCATAAAGCAGTCTGCATATGATTCCAAGGCAGATATCTGGTCCCTGGGTATAACTGCTAATG
  5   1   2      seed Emb1 5g                IMAGE:3402438-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGCCGGGGCTGTGCTGCAGGGACATCAATATGAGTCACTCCCCGGTGCAGCCCGGCCTGCATGGGATACAGAATCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAAAATAGGCAAAGGCTCGTTTGGAGAAGTTTTTAAAGGAATTGACTATAGGACTCAGAAAGTTGTGGCCATAAAAATTATAGATCTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATCACTGTGCTCAGCCAATGTGACAGCCCCTATGTAACCAAGTACTATGGCTCCTATCTTAAGGACACAAAATTATGGATCATTATGGAATACCTTGGAGGAGGCTCAGCTCTGGATTTGTTAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAATCTTAAAGGGACTTGACTACTTGCATTCAGAGAAGAAAATTCACAGGGATATTAAAGCTGCCAATGTGCTGTTATCTGAACACGGGGAGGTGAAATTAGCTGACTTTGGTGTTGCAGGACAACTTACTGACACTCAGATCAAGAGGAACACCTTTGTTGGAACTCCATTCTGGATGGCACCAGAAGTCATAAAGCAGTCTGCATATGATTCCAAGGCAGATATCTGGTCCCTGGGCATAACGGCTATTGAACTCGCAAAAGGAGAACCTCCTCATTCAGAGCTGCATCCCATGAAAGTCTTGTTCCTTATACCCAAGAACAATCCTCCCTTGCTGGAAGGGAACTACAGCAAAGGTCTGAAGGAGTTTGTAGAAGCCTGCTTAAACAAGGAGCCCAGTTTTAGACCCTCGGCTAAGGAACTGCTGAAACACAAGTTTATTATGCGAAGTGCAAAGAAAACCTCCTACTTAACCGAGCTCATAG
  5   1   2       bld Emb1 5g3  out                   IMAGE:3402438.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCGGGGCTGTGCTGCAGGGACATCAATATGAGTCACTCCCCGGTGCAGCCCGGCCTGCATGGGATACAGAATCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAAAATAGGCAAAGGCTCGTTTGGAGAAGTTTTTAAAGGAATTGACTATAGGACTCAGAAAGTTGTGGCCATAAAAATTATAGATCTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATCACTGTGCTCAGCCAATGTGACAGCCCCTATGTAACCAAGTACTATTGGTTCTATCTTAAGGACACAAAATTATGGATCATTATGGAATACCTTGGAGGAGGCTCAGCTCTGGATTTGTTAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAATCTTAAAGGGACTTGACTACTTGCATTCAGAGAAGAAAATTCACAGGGATATTAAAGCTGCCAATGTGCTGTTATCTGAACACGGCGAGGTGAAATTAGCTGACTNTGGT
  5   1   2       bld Tbd3 5g3  out                   IMAGE:3549525.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGTGCTGCAGGACATCAATTGTGTCACTCCCCGGTGCAGCCCGGCCTCGCATGGGAACAGAATCTTAAAGCTGATCCAGNAGNNAACTGTTCAGNAAAACTAGNANAAAATAGGCAAAGGCTCGTTTGGAGAAGTTTTTAAAGGAATTGACTATAGGACTCAGAAGTTGTGGCCATAAAAATTATAGATCTGGAAGAAGCAGAGGAGGAAATAGAGGATATTCAGCAAGAAATCACTGTGCTCAGCCAATGTGACAGCCCCTATGTAACCAAGTACTATGGCTCCTATCTTAAGGACACAAAATTAAGGATCATTATGGAATACCTTGGAGGAGGCTCAGCTCTGGATTTGTTAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTAACGGGAAANTTAAAGGGACTTGACTACTTGCATTCAGAGAAGAAAATNCCAGGGATAT
  5   1   2       bld Ga12                                 XL152b02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAGAAGCANAAGATGAAATAGAGGATATTCANCAAGAAATCACTGTGCTCAGCCAATGTGATAGCCCTTACGTAACAAAGTATTATGGCTCCTATCTTAAGGACACAAAATTATGGATCATTATGGAATATCTCGGAGGAGGCTCAGCTCTGGATCTGTTAGAACCTGGNCCTTTAGATGAAACACANATTGCNACCATTTTACGGGAAATCTTAAAGGGACTTGACTACTTGCATTCAGAGAAGAAAATTCACAGGGATATTAAAGCTGCCAATGTGCTGTTATCTGAAAATGGGGAGGTGAAAATAGCCGACTTTGGTGTTGCAGGACAACTTACTGACACTCACATCAAGAGGAACACCTTTGTTGGAACTCCATTCTGGATGGCACCTGANGTCATAAAGCAGTCTGCATA
  5   1   2       bld Tbd7      out                        XL110a13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCTTGACTACTTGCATTCAGAGAAGAAAATTCACAGGGATATTAAAGCTGCCAATGTGCTGTTATCTGAACACGGGGAGGTGAAATTAGCTGACTTTGGTGTTGCAGGACAACTTACTGACACTCAGATCAAGAGGAACACCTTTGTTGGAACTCCATTCTGGATGGCACCAGAAGTCATAAAGCAGTCTGCATATGATTCCAAGGCAGATATCTGGTCCCTGGGCATAACGGCTATTGAACTCGCAAAAGGAGAACCTCCTCATTCAGAGCTGCATCCCATGAAAGTCTTGTTCCTTATACCCAAGAACAATCCTCCCTTGCTGGAAGGGAACTACAGCAAAGGTCTGAAGGAGTTTGTAGAAGCCTGCTTAAACAAGGAGCCCAGTTTTAGA
  5   1   2       bld Brn1                            IMAGE:6952342.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGGACCGGTCCGGAATTCCGGGATGGAATTAAAGCTGCCAATGTGCTGTTATCTGAACACGGGGAGGTGAAATTAGCTGACTTTGGTGTTGCAGGACAACTTACTGACACTCAGATCAAGAGGAACACCTTTGTTGGAACTCCATTCTGGATGGCACCAGAAGTCATAAAGCAGTCTGCATATGATTCCAAGGCAGATATCTGGTCCCTGGGCATAACGGCTATTGAACTCGCAAAAGGAGAACCTCCTCATTCAGAGCTGCATCCCATGAAAGTCTTGTTCCTTATACCCAAGAACAATCCTCCCTTGCTGGAAGGGAACTACAGCAAAGGTCTGAAGGAGTTTGTAGAAGCCTGCTTAAACAAGGAGCCCAGTTTTAAACCCTCGGCTAAGGAACTGCTGAAACACAAGTTTATTATGCGAAGTGCAAAGAAAACCTCCTACTTAACCGAGCTCATAGACAGGTACAAGAGATGGAAAATAGAACAAGGCCATGAAGCCTCCAGCTTCAGACTCTGAGGAGGATGAAACGGAACAAGCCTGCTGGCAGTGATGAAGGAATTACTGGAATTTTCCAAGGAAAAAAGAGGGACTTGGAAAAACTTGGAGCCCTGTTCCAACCCCAATCCAGAAAAAGGGTTAAAGAACATTTCCCAAACCGGGCCTTTTTGGTCCCTCACGTGGCTTAATCCACCAAGAAAAGGTCCCCCTTTTCATTTGGACATAGCCTCTAAGGGAAACAAAATTCAGGGCCAAGTGGGTGGAGGAATCTTATAGGCTCCAAATATAAGAAAATTTCGCAGGAAGGGCAACTCttttttttCCCCTGTAAAGAAAGGCCTCGCTACCAGGGTAATACATTCGGCAAATCCCATGAGATTTTACCGCCGCCGTCTTCATTAATTAGCGGCCTTCACAGGAACGGNTACTTCCCGGCGGTAACATAGGACGGGTGGAGACATACTCTTTCTCCACCN
  5   1   2       bld Tbd7      out                        XL107m21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAAATTNCAGGGATATTAAAGCTGCCAATGTGCTGTTATCTGAACACGGGGAGGTGAAATTAGCTGACTTTGGTGTTGCAGGACAACTTACTGACACTCAGATCAAGAGGAACACCTTTGTTGGAACTCCATTCTGGATGGCACCAGAAGTCATAAAGCAGTCTGCATATGATTCCAAGGCAGATATCTGGTCCCTGGGCATAACGGCTATTGAACTCGCAAAAGGAGAACCTCCTCATTCAGAGCTGCATCCCATGAAAGTCTTGTTCCTTATACCCAAGAACAATCCTCCCTTGCTGGAAGGGAACTACAGCAAAGGTCTGAAGGAGTTTGTAGAAGCCTGCTTAAACAAGGAGCCCAGTTTTAGACCCTCGGCTAAGGAACTGCTGAAACACAAGTTTATTATGCGAAGTGCAAAGAAAACCTCCTACTTAACCGAGCTCATAGACAGGTACAAGAGATGGAAGATAGAACAAGGCCATGAAGCCTCCAGCTCAGACTCTGAGGAGGATGAAGCGGAACAAGCTGCTGGCAGTGAGAAGGATTACTGGAATTTCACAAGAAGAAAGAGGGACTTGAAAAACTTGGAGCCTGTTCCAGCACAGCCAGAA
  5   1   2       bld Int2                            IMAGE:8527897.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAAACCTCATATTGAGNAGAAGATCATCAAAAAAATTCGTCCCGGAAACCTTTGTTGGAACTCCATTCTGGATGGCACCAGAAGTCATAAAGCAGTCTGCATATGATTCCAAGGCAGATATCTGGTCCCTGGGCATAACGGCTATTGAACTCGCAAAAGGAGAACCTCCTCATTCAGAGCTGCATCCCATGAAAGTCTTGTTCCTTATACCCAAGAACAATCCTCCCTTGCTGGAAGGGAACTACAGCAAAGGTCTGAAGGAGTTTGTAGAAGCCTGCTTAAACAAGGAGCCCAGTTTTAGACCCTCGGCTAAGGAACTGCTGAAACACAAGTTTATTATGCGAAGTGCAAAGAAAACCTCCTACTTAACCGAGCTCATAGACAGGTACAAGAGATGGAAGATAGAACAAGGCCATGAAGCCTCCAGCTCAGACTCTGAGGAGGATGAAGCGGAACAAGCTGCTGGCAGTGAGAAGGATTACTGGAATTTCACAAGAAGAAAGAGGGACTTGAAAAACTTGGAGCCTGTTCCAGCACAGCCAGAAGAGGTTAAAGACATTCCTAAACGGCCTTTGTCTCAGTGCTTATCTACAATAATGTCTCCTTTATTTGCAGAGCTTAATGAGAAGAGTCATGCATGTGGTGGGAACGTATGCTCAATATAAGAACTGAGAGAGGCATTTATTTATCTGAAGAGCCTGTCCGGGTATCTCGATTCATGTTTCCCAGCTTCTATTTGCTTCAGAGGTTTCCGTATGGGGTGACTCTTCCCCACGAAGAAGTTCCTCTTTTAAGCAAATGACTTACTTTTACCTATGATAGCACACCAGGATCAA
  5   1   2      en>5                               Xl3.1-PBX0028H07.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATATAGTGAAAACCCTCATTCAGAGCTGCATCCCATGAAAGTCTTGTTCCTTATACCCAAGAACAATCCTCCCACGCTGGAAGGAAACTACAGCAAGTTCCTGAAGGAGTTTGTAGAAGCCTGCTTAAACAAGGAGCCCAGTTTTAGACCCTCTGCTAAGGAACTGCTGAAACACAAGTTTATTATGCGAAATGCAAAGAAAACCTCCTACTTAACAGAACTCATAGACAGGTACAAGAGATGGAAGATAGAACAAGGCCATGAAGCCTCCAGCTCGGACTCTGATGAGGAAGAAGTAGAACAAGCTGCTGGCAGTGAGAAGGATTATTGGAACTTCACAAGAAGAAAGAGAGACTTGAAAAACTTGGAGCCTGTTCCAGCACAACCAGAAGAGGTTAAAGACATTCCCAAGAGGCCTTTGTCTCAATGCTTATCTACAATAATGTCTCCTTTATTTGCAGAGCTCAAGGAGAAGAGTCAGGCGTGCGGTGGGAATGTAGGCTCAATAGAGGAATTGAGAGAGGCAATTTATTTAGCTGAAGAGGCCTGTCCGGGTATCTCGGACTCCATGGTTTCTCAGCTTCTTATTAGGCTTCAGAGGTATTCTGTTAATGGAGTGGACTCTTCCTCGCACTGAAGGATGTTTTTGTCCTTTTTAAGGCAAAAATGGACCTTGCATTATTCTCCCTATGGAACACGCCTCTGCTCATGGATATCACAGGATGTGGACCTTCCTGAATGATGAGTGACTATAGATAGGGAGTTGGTGAAAGCTATAGTTTTTATGATTTTCTTTTTTTTTTCTCTAATCATAATGCGAATATATAAAAATGTAAAAAAAAAACTTCTGCAAATTACTGTGATAAGGCAAACGAAGATATTGTGAAACCTCAGGTATCTTGCTGTAAGCAGTCCGTTGTGCTGGAGATGGAATGAAATCTTGGTTTAATTCCTCTATGGAAAGTTATCAGATGCCTCGGCCTTCTTTCCTCAAGCCGCTGTGAGCTCCCAGCATGCCCAGCAGTTGAAGCCTATGAATGGTGGGAGATGCAAATCACAACAGCTGGAGGGACGTGGGCTGACATTCCAATTTTACAGTTGACTTTTTACTAGAGTTTGCCAACCTACAAACAGACCCAGGGCATCCCTAGGTGCAAGATGCCATGTTCTGTTTATGGATTTCATATCTGGCAGCCATATTTTATGTTTTATGCTAATGGTTTAAATGAAGCGCCAAGTTGAGTTTTGTTATCTACATACAGAAGCCCTGTGGGACATGTGTTAGATGATACCAGTGTAATGTTTTGTCTAAATATACATGACATTGTACAGTATTGCCGTTTTCTTCAGAAAACAAACTGTGGCATTTAGATATATCTTCTATACATTTATCGATACACATTATTTGTATATACTTAAAAGACAGAGGATAAGGTACTGTCACAATGAAGTTTTACTGTTTTTAATTTATAGATATGTCTGAAATATGTAAGGCTCCGCCTCATCACTGGGATAAGTTATGAGAATATTATAACACAATACGTACAGCAGTGTGTGCAGTTATTCTATACGTGTCTCTGTTTGTCTGTGCAGCCAGTGGAGCAGTGTCAGTAGCAGTATCTCTGGGAATATACTGTGAGTGTGAATGGTGAGCTGAAATGATTGTAA
                                                  Xl3.1-CHK-1012688424                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGAAAACCCTCATTCAGAGCTGCATCCCATGAAAGTCTTGTTCCTTATACCCAAGAACAATCCTCCCACGCTGGAAGGAAACTACAGCAAGTTCCTGAAGGAGTTTGTAGAAGCCTGCTTAAACAAGGAGCCCAGTTTTAGACCCTCTGCTAAGGAACTGCTGAAACACAAGTTTATTATGCGAAATGCAAAGAAAACCTCCTACTTAACAGAACTCATAGACAGGTACAAGAGATGGAAGATAGAACAAGGCCATGAAGCCTCCAGCTCGGACTCTGATGAGGAAGAAGTAGAACAAGCTGCTGGCAGTGAGAAGGATTATTGGAACTTCACAAGAAGAAAGAGAGACTTGAAAAACTTGGAGCCTGTTCCAGCACAACCAGAAGAGGTTAAAGACATTCCCAAGAGGCCTTTGTCTCAATGCTTATCTACAATAATGTCTCCTTTATTTGCAGAGCTCAAGGAGAAGAGTCAGGCGTGCGGTGGGAATGTAGGCTCAATAGAGGAATTGAGAGAGGCAATTTATTTAGCTGAAGAGGCCTGTCCGGGTATCTCGGACTCCATGGTTTCTCAGCTTCTTATTAGGCTTCAGAGGTATTCTGTTAATGGAGTGGACTCTTCCTCGCACTGAAGGATGTTTTTGTCCTTTTTAAGGCAAAAATGGACCTTGCATTATTCTCCCTATGGAACACGCCTCTGCTCATGGATATCACAGGATGTGGACCTTCCTGAATGATGAGTGACTATAGATAGGGAGTTGGTGAAAGCTATAGTTTTTATGATTTTCTTTTTTTTTTCTCTAATCATAATGCGAATATATAAAAATGTAAAAAAAAAACTTCTGCAAATTACTGTGATAAGGCAAACGAAGATATTGTGAAACCTCAGGTATCTTGCTGTAAGCAGTCCGTTGTGCTGGAGATGGAATGAAATCTTGGTTTAATTCCTCTATGGAAAGTTATCAGATGCCTCGGCCTTCTTTCCTCAAGCCGCTGTGAGCTCCCAGCATGCCCAGCAGTTGAAGCCTATGAATGGTGGGAGATGCAAATCACAACAGCTGGAGGGACGTGGGCTGACATTCCAATTTTACAGTTGACTTTTTACTAGAGTTTGCCAACCTACAAACAGACCCAGGGCATCCCTAGGTGCAAGATGCCATGTTCTGTTTATGGATTTCATATCTGGCAGCCATATTTTATGTTTTATGCTAATGGTTTAAATGAAGCGCCAAGTTGAGTTTTGTTATCTACATACAGAAGCCCTGTGGGACATGTGTTAGATGATACCAGTGTAATGTTTTGTCTAAATATACATGACATTGTACAGTATTGCCGTTTTCTTCAGAAAACAAACTGTGGCATTTAGATATATCTTCTATACATTTATCGATACACATTATTTGTATATACTTAAAAGACAGAGGATAAGGTACTGTCACAATGAAGTTTTACTGTTTTTAATTTATAGATATGTCTGAAATATGTAAGGCTCCGCCTCATCACTGGGATAAGTTATGAGAATATTATAACACAATACGTACAGCAGTGTGTGCAGTTATTCTATACGTGTCTCTGTTTGTCTGTGCAGCCAGTGGAGCAGTGTCAGTAGCAGTATCTCTGGGAATATACTGTGAGTGTGAATGGTGAGCTGAAATGATTGTAACACAGT
  5   1   2       bld DMZ       in                         xl270c18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATATAGTGAAAACCCTCATTCAGAGCTGCATCCCATGAAAGTCTTGTTCCTTATACCCAAGAACAATCCTCCCACGCTGGAAGGAAACTACAGCAAGTTCCTGAAGGAGTTTGTAGAAGCCTGCTTAAACAAGGAGCCCAGTTTTAGACCCTCTGCTAAGGAACTGCTGAAACACAAGTTTATTATGCGAAATGCAAAGAAAACCTCCTACTTAACAGAACTCATAGACAGGTACAAGAGATGGAAGATAGAACAAGGCCATGAAGCCTCCAGCTCGGACTCTGATGAGGAAGAAGTAGAACAAGCTGCTGGCAGTGAGAAGGATTATTGGAACTTCACAAGAAGAAAGAGAGACTTGAAAAACTTGGAGCCTGTTCCAGCACAACCAGAAGAGGTTAAAGACATTCCCAAGAGGCCTTTGTCTCAATGCTTATCTACAATAATGTCTCCTTTATTTGCAGAGCTCAAGGAGAAGAGTCAGGCGTGCGGTGGGAATGTAGGCTCAATAGAGGAATTGAGAGAGGCAATTTATTTAGCTGAAGAGGCCTGTCCGGGTATCTCGGACTCCATGGTTTCTCAGCTTCTTATTAGGCTTCAGAGGTATTCTGTTAATGGAGTGGACTCTTCCTCGCACTGAAGGATGTTTTTGTCCTTTTTAAGGCAAAAATGGACCTTGCATTATTCTCCCTATGGAACACGCCTCTGCTCATGGATATCACAGGATGTGGACCTTCCTGAATGATGAGTGACTAT
  5   1   2       bld DMZ       in                         xl338f12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATATAGTGAAAACCCTCATTCAGAGCTGCATCCCATGAAAGTCTTGTTCCTTATACCCAAGAACAATCCTCCCACGCTGGAAGGAAACTACAGCAAGTTCCTGAAGGAGTTTGTAGAAGCCTGCTTAAACAAGGAGCCCAGTTTTAGACCCTCTGCTAAGGAACTGCTGAAACACAAGTTTATTATGCGAAATGCAAAGAAAACCTCCTACTTAACAGAACTCATAGACAGGTACAAGAGATGGAAGATAGAACAAGGCCATGAAGCCTCCAGCTCGGACTCTGATGAGGAAGAAGTAGAACAAGCTGCTGGCAGTGAGAAGGATTATTGGAACTTCACAAGAAGAAAGAGAGACTTGAAAAACTTGGAGCCTGTTCCAGCACAACCAGAAGAGGTTAAAGACATTCCCAAGAGGCCTTTGTCTCAATGCTTATCTACAATAATGTCTCCTTTATTTGCAGAGCTCAAGGAGAAGAGTCAGGCGTGCGGTGGGAATGTAGGCTCAATAGAGGAATTGAGAGAGGCAATTTATTTAGCTGAAGAGGCCTGTCCGGGTATCTCGGACTCCATGGTTTCTCAGCTTCTTATTAGGCTTCAGAGGTATTCTGTTAATGGAGTGGACTCTTCCTCGCACTGAAGGATGTTTTTGTCCTTTTTAAGGCAAAAATGGACCTTGCATTATTCTCCCTATGGAACACGCCTCTGCTCATGGATATCACAGGATGTGGACCTTCCTGAATGATGAGTGACTA
  5   1   2       bld Ga12                                 XL200j07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCATTCAGAGCTGCATCCCATGAAAGTCTTGTTCCTTATACCCAAGAACAATCCTCCCACGCTGGAAGGAAACTACAGCAAGTTCCTGAAGGAGTTTGTAGAAGCCTGCTTAAACAAGGAGCCCAGTTTTAGACCCTCTGCTAAGGAACTGCTGAAACACAAGTTTATTATGCGAAATGCAAAGAAAACCTCCTACTTAACAGAACTCATAGACAGGTACAAGAGATGGAAGATAGAACAAGGCCATGAAGCCTCCAGCTCGGACTCTGATGAGGAAGAAGTAGAACAAGCTGCTGGCAGTGAGAAGGATTATTGGAACTTCACAAGAAGAAAGAGAGACTTGAAAAACTTGGAGCCTGTTCCAGCACAACCAGAAGAGGTTAAAGACATTCCCAAGAGGCCTTTGTCTCAATGCTTATCTACAATAATGTCTCCTTTATTTGCAGAGCTCAAGGAGAAGAGTCAGGCGTGCGGTGGGAATGTAGGCTCAATAGAGGAATTGAGAGAGGCAATTTATTTAG
  3   1   2       bld Ga12                                 XL164b21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGAAGGAAANTACAGCAAGTTCCTGAAGGAGTTTGTAGAAGCCTGNTTAAACAAGGAGCCCAGTTTTAGACCCTTTGNTAAGGAACTGCTGAAACACAAGTTTATTATGCGAAATGCAAAGAAAACCTCCTACTTAACAGAACTCATAGACAGGTACAAGAGATGGAAGATAGAACAAGGCCATGAAGCCTCCAGCTCGGACTTTGATGAGGAAGAAGTAGAACAAGCTGCTGGCAGTGAGAAGGATTATTGGAACTTCACAAGAAGAAAGAGAGACTTGAAAAACTTGGAGCCTGTTCCAGCACAACCAGAAGAGGTTAAAGACATTCCCAAGAGGCCTTTGTCTCAATGCTTATNTACAATAATGTCTCCTTTATTTGCAGAGCTCAAGGAGAAGAGTCAGGCGTGCGGTGGGAATGTAGGCTCAATAGAGGAATTGAGAGAGGCAATTTATTTAGCTGAAGAGGCCTGTCCGGGTATCTCGGACTCCATGGTTTNTCAGCTTNTTATTAGGCTTCAGAGGTATTCTGTTAATGGAGTGGACTNTTCCTCGCACTGAAGGATGTTTTTGTCCTTTTTAAGGCAAAAATGGACCTTGCATTATTCTCCCTATGGAACACGCCTNTGCTCATGGATATCACAGGATGTGGACCTTCCTGAATGATGAGTGACTTTAGATAGGGAGTTGGTGAAAGCTATAGTTTTTA
  3   1   2       bld Neu7 5g3  in                         XL017n16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGAAACACAAGTTTATTATGCGAAATGCAAAGAAAACCTCCTACTTAACAGAACTCATAGACAGGTACAAGAGATGGAAGATAGAACAAGGCCATGAAGCCTCCAGCTCGGACTCTGATGAGGAAGAAGTAGAACAAGCTGCTGGCAGTGAGAAGGATTATTGGAACTTCACAAGAAGAAAGAGAGACTTGAAAAACTTGGAGCCTGTTCCAGCACAACCAGAAGAGGTTAAAGACATTCCCAAGAGGCCTTTGTCTCAATGCTTATCTACAATAATGTCTCCTTTATTTGCAGAGCTCAAGGAGAAGAGTCAGGCGTGCGGTGGGAATGTAGGCTCAATAGAGGAATTGAGAGAGGCAATTTATTTAGCTGAAGAGGCCTGTCCGGGTATCTCGGACTCCATGGTTTCTCAGCTTCTTATTAGGCTTCAGAGGTATTCTGTTAATGGAGTGGACTCTTCCTCGCACTGAAGGATGTTTTTGTCCTTTTTAAGGCAAAAATGGACCTTGCATTATTCTCCCTATGGAACACGCCTCTGCTCATGGATATCACAGGATGTGGACCTTCCTGAATGATGAGTGACTTTAGATAGGGAGTTGGTGAAAGCTATAGTTTTTAnATTTTCTTTTTTTTTTCTCNAATCATAATGCGNA
  5   1   2       bld Egg1                               PBX0025G07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACGAGGGAGGCCTTTGTCTCAATGCTTATCTACAATAATGTCTCCTTTATTTGCAGAGCTCAAGGAGAAGAGTCAGGCGTGCGGTGGGAATGTAGGCTCAATAGAGGAATTGAGAGAGGCAATTTATTTAGCTGAAGAGGCCTGTCCGGGTATCTCGGACTCCATGGTTTCTCAGCTTCTTATTAGGCTTCAGAGGTATTCTGTTAATGGAGTGGACTCTTCCTCGCACTGAAGGATGTTTTTGTCCTTTTTAAGGCAAAAATGGACCTTGCATTATTCTCCCTATGGAACACGCCTCTGCTCATGGATATCACAGGATGTGGACGTTCCTGAATGATGAGTGACTATAGATAGGGAGTTGGTGAAAGCTATAGtttttatgattttcttttttttttctctaatcataatgcgaatatataaaaatgtaaaaaaaaaaCTTCTGCAAATTACTGTGATAAGGCAAACGAAGATATTGTGAAACCTCAGGTATCTTGCTGTAAGCAGTCCGTTGTGCTGGAGATGGAATGAAATCTTGGTTTAATTCCTCTATGGAAAGTTATC
  5   1   2       bld Egg1                               PBX0028H07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCTTATCTACAATAATGTCTCCTTTATTTGCAGAGCTCAAGGAGAAGAGTCAGGCGTGCGGTGGGAATGTATGCTCAATAGAGGAATTGAGAGAGGCAATTTATTTAGCTGAAGAGGCCTGTCCGGGTATCTCGGACTCCATGGTTTCTCAGCTTCTTATTAGGCTTCAGAGGTATTCTGTTAATGGAGTGGACTCTTCCTCGCACTGAAGGATGTTTTTGTCCTTTTTAAGGCAAAAATGGACCTTGCATTATTCTCCCTATGGAACACGCCTCTGCTCATGGATATCACAGGATGTGGACGTTCCTGAATGATGAGTGACTATAGATAGGGAGTTGGTGAAAGCTATAGTTTTTATGATTNTCttttttttttctctaatcataatgcgaatatataaaaatgtaaaaaaaaaaCTTCTGCAAATTACTGTGATAAGGCAAACGAAGATATTGTGAAACCTCAGGTATCTTGCTGTAAGCAGTCCGTTGTGCTGGAGATGGAATGAAATCTTGGTTTAATTCCTCTATGGAAAGTTATCAGATGCCTCGGCCTTCTTTCCTCAAGCCGCTGTGAGCTCCCAGCATGCCCAGCAGTTGAAGCCTATGAATGGTGGGAGATGCAAATCACAACAGCTGGAGGGACGTGGGCTGACATTCCAATTTTACAGTTGACTTTTTACT
  5   1   2       bld DMZ                                  xl309g18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGGAGAAGAGTCAGGCGTGCGGTGGGAATGTAGGCTCAATAGAGGAATTGAGAGAGGCAATTTATTTAGCTGAAGAGGCCTGTCCGGGTATCTCGGACTCCATGGTTTCTCAGCTTCTTATTAGGCTTCAGAGGTATTCTGTTAATGGAGTGGACTCTTCCTCGCACTGAAGGATGTTTTTGTCCTTTTTAAGGCAAAAATGGACCTTGCATTATTCTCCCTATGGAACACGCCTCTGCTCATGGATATCACAGGATGTGGACCTTCCTGAATGATGAGTGACTATAGATAGGGAGTTGGTGAAAGCTATAGtttttatgattttcttttttttttctctaancataatgcgaatatataaaaatgtaaaaaaaaaNCTTCTGCAAATTACNG
  5   1   2       bld DMZ                                  xl240i13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCGTGCGGTGGGAATGTAGGCTCAATAGAGGAATTGAGAGAGGCAATTTATTTAGCTGAAGAGGCCTGTCCGGGTATCTCGGACTCCATGGTTTCTCAGCTTCTTATTACGCTTCNGAGGTATTCNGTTAATGGAGTGGACTCTTCCTCGCACTGAANGATGTTTTTGTCCTTTTTAAGGCAAAAATGGACCTTGCATTATTCTCCCTATGGAACACGCCTCTGCTCATGGATATCACAGGATGTGGACCTTCCTGAATGATGAGTGACTATNGATAGGGAGTTGGTGAAAGCTATAGtttttatgattttcttttttttttCC
  5   1   2       bld Ga15      in                       XL500g13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGGTGGGAATGTAGGCTCAATAGAGGAATTGAGAGAGGCAATTTATTTAGCTGAAGAGGCCTGTCCGGGTATCTCGGACTCCATGGTTTCTCAGCTTCTTATTAGGCTTCAGAGGTATTCTGTTAATGGAGTGGACTCTTCCTCGCACTGAAGGATGTTTTTGTCCTTTTTAAGGCAAAAATGGACCTTGCATTATTCTCCCTATGGAACACGCCTCTGCTCATGGATATCACAGGATGTGGACCTTCCTGAATGATGAGTGACTTTAGATAGGGAGTTGGTGAAAGCTATAGtttttatgattttcttttttttttctctaatcataatgcgaatatataaaaatgtaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL500g13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGGTGGGAATGTAGGCTCAATAGAGGAATTGAGAGAGGCAATTTATTTAGCTGAAGAGGCCTGTCCGGGTATCTCGGACTCCATGGTTTCTCAGCTTCTTATTAGGCTTCAGAGGTATTCTGTTAATGGAGTGGACTCTTCCTCGCNCTGAAGGATGTTTTTGTCCTTTTTAAGGCAAAAATGGACCTTGCATTATTCTCCCTATGGAACACGCCTCTGCTCATGGATATCACAGGATGTGGACCTTCCTGAATGATGAGTGACTTTAGATAGGGAGTTGGTGAAAGCTATAGTTTTTATGATTT
  5   1   2       bld Ov1                             IMAGE:5074287.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCACGCGTCCGGGCCTGTCCGGGTATCTCGGACTCCATGGTTTCTCAGCTTCTTATTAGGCTTCAGAGGTATTCTGTTAATGGAGTGGACTCTTCCTCGCACTGAAGGATGTTTTTGTCCTTTTTAAGGCAAAAATGGACCTTGCATTATTCTCCCTATGGAACACGCCTCTGCTCATGGATATCACAGGATGTGGACCTTCCTGAATGATGAGTGACTATAGATAGGGAGTTGGTGAAAGCTATAGtttttatgattttcttttttttttctctaatcataatgcgaatatataaaaatgtaaaaaaaaaaCTTCTGCAAATTACTGTGATAAGGCAAACGAAGATATTGTGAAACCTCAGGTATCTTGCTGTAAGCAGTCCGTTGTGCTGGAGATGGAATGAAATCTTGGTTTAATTCCTCTATGGAAAGTTATCAGATGCCTCGGCCTTCTTTCCTCAAGCCGCTGTGAGCTCCCAGCATGCCCAGCAGTTGAAGCCTATGAATGGTGGGAGATGCAAATCACAACAGCTGGAGGGACGTGGGCTGACATTCCAATTTTACAGTTGACTTTTTACTAGAGTTTGCCAACCTACAAACAGACCCAGGGCATCCCTAGGTGCAAGATG
  5   1   2       bld Egg1                               PBX0019D11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGCACTGAACGATGTTTTTGTCCTTTTTAAGGCAAAAATGGACCTTGCATTATTCTCCCTATGGAACACGCCTCTGCTCATGGATATCACAGGATGTGGACTTTCCTGAATGATGAGTGACTATAGATAGGGAGTTGGTGAAAGCTATAGtttttatgattttcttttttttttctctaatcataatgcgaatatataaaaatgtaaaaaaaaaaaCTTCTGCAAATTACTGTGATAAGGCAAACGAAGATATTGTGAAACCTCAGGTATCTTGCTGTAAGCAGTCCGTTGTGCTGGAGATGGAATGAAATCTTGGTTTAATTCCTCTATGGAAAGTTATCAGATGCCTCGGCCTTCTTTCCTCAAGCCGCTGTGAGCTCCCAGCATGCCCAGCAGTTGAAGCCTATGAATGGTGGGAGATGCAAATCACAACAGCTGGAAGGACGTGGGCTGACATTCCAATTTTACAGTTGACTTTTTACTAGAGTTT
  5   1   2       bld Egg1                               PBX0017E12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCACTGAAGGATGTTTTTGTCCTTTTTAAGGCAAAAATGGACCTTGCATTATTCTCCCTATGGAACACGCCTCTGCTCATGGATATCACAGGATGTGGACTTTCCTGAATGATGAGTGACTATAGATAGGGAGTTGGTGAAAGCTATAgtttttatgattttctttcttttttctctaatcataatgcgaatatatcaaaatgtaaaaaaaaaaaCTTCTGCAAATTACTGTGATAAGGCAAACGAAGATATTGTGAAACCTCAGGTATCTTGCTGTAAGCAGTCCGTTGTGCTGGAGATGGAATGAAATCTTGGTTTAATTCCTCTATGGAAAGTTATCAGATGCCTCGGCCTTCTTTCC
  5   1   2       bld Egg1                               PBX0017F12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCACTGAAAGATGTATTTGTCCTTTTTAAGGCAAAAATGGACCTTGCATTATTCTCCCTATGGAACACGCCTCTGCTCATGGATATCACAGGATGTGGACTTTCCTGAATGATGAGTGACTATAGATAGGGAGTTGGTGAAAGCTATAGTGCATATGATATGCTTTCCTTTATCTCTAATCATAATGCGAATATATCAAAATGTaaaaaaaaaaaCTTCTGCAAATTACTGTGATAAGGCAAACGAAGATATTGTGAAACCTCAGGTATCTTGCTGTAAGCAATCCGTTGTGCTGGAGATGGAATGAAATCTTGGTTTAATTCCTCTATGGAAAGCTATCATATGCTCTCGGCCTTCTTTACTCAAGCCGCTGTGAGCTCCCAGCATGCCCAGCAGTTGAAGCCTATGAATGGTGGGAGATGCATATCACAACAGCTGGAAGGACGTGGGCTGA
  3   1   2       bld DMZ  5g3  in                         xl295m22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GATAGGGAGTTGGNGAAAGCNATAGTTTTTAnGATTTTCnTTTTTTTTCTCTAATCATAATGCGAATATATAAAAATGTAAAAAAAAAACTTCTGCAAATTACTGTGATAAGGCAAACGAAGATATTGTGAAACCTCAGGTATCTTGCTGTAAGCAGTCCGTTGTGCTGGAGATGGAATGAAATCTTGGTTTAATTCCTCTATGGAAAGTTATCAGATGCCTCGGCCTTCTTTCCTCAAGCCGCTGTGAGCTCCCAGCATGCCCAGCAGTTGAAGCCTATGAATGGTGGGAGATGCAAATCACAACAGCTGGAGGGACGTGGGCTGACATTCCAATTTTACAGTTGACTTTTTACTAGAGTTTGCCAACCTACAAACAGACCCAGGGCATCCCTAGGTGCAAGATGCCATGTTCTGTTTATGGATTTCATATCTGGCAGCCATATTTTATGTTTTATGCTAATGGTTTAAATGAAGCGCCAAGTTGAGTTTTGTTATCTACATACAGAAGCCCTGTGGGACATGTGTTAGATGATACCAGTGTAATGTTTTGTCTAAATATACATGACATTGTACAGTATTGCCGTTTTCTTCAGAAAACAAACTGTGGCATTTAGATATATCTTCTATACATTTATCGATACACATTATTTGTATATACTTAAAAGACAGAGGATAAGGTACTGTCACAATGAAGTTTTATTGTTTTTAATTTATAGATATGTCTGAAATATGTAAGGCTCCGCCT
  3   1   2       bld FaBN 5g3  in                    IMAGE:8075488.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGCTATAGTTTTTATGATTTTCTTTTTTTTTTTCTCTAATCATAATGCGAATATATAAAAATGTAAAAAAAAAAACTTCTGCAAATTACTGTGATAAGGCAAACGAAGATATTGTGAAACCTCAGGTATCTTGCTGTAAGCAGTCCGTTGTGCTGGAGATGGAATGAAATCTTGGTTTAATTCCTCTATGGAAAGTTATCAGATGCCTCGGCCTTCTTTCCTCAAGCCGCTGTGAGCTCCCAGCATGCCCAGCAGTTGAAGCCTATGAATGGTGGGAGATGCAAATCACAACAGCTGGAGGGACGTGGGCTGACATTCCAATTTTACAGTTGACTTTTTACTAGAGTTTGCCAACCTACAAACAGACCCAGGGCATCCCTAGGTGCAAGATGCCATGTTCTGTTTATGGATTTCATATCTGGCAGCCATATTTTATGTTTTATGCTAATGGTTTAAATGAAGCGCCAAGTTGAGTTTTGTTATCTACATACAGAAGCCCTGTGGGACATGTGTTAGATGATACCAGTGTAATGTTTTGTCTAAATATACATGACATTGTACAGTATTGCCGTTTTCTTCAGAAAACAAACTGTGGCATTTAGATATATCTTCTATACATTTATCGATACCCATTACTTGTATATACTTAAAAGACAGAGGATAAGGTACCGTCACAACGAAGTTTTACCGTTTTTCATTCACAGATACGTCTGAAATATGTCAGGCTCCGCCTCACCACTGGGTAAGCAGTAATCTAGCTACTATTT
  3   1   2       bld DMZ       in                         xl338f12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTTTCTTTTTTTTTTCTCTAATCATAATGCGAATATATAAAAATGTAAAAAAAAAACTTCTGCAAATTACTGTGATAAGGCAAACGAAGATATTGTGAAACCTCAGGTATCTTGCTGTAAGCAGTCCGTTGTGCTGGAGATGGAATGAAATCTTGGTTTAATTCCTCTATGGAAAGTTATCAGATGCCTCGGCCTTCTTTCCTCAAGCCGCTGTGAGCTCCCAGCATGCCCCAGCAGTTGAAGCCTATGAATGGTGGGAGATGCAAATCACAACAGCTGGAGGGACGTGGGCTGACATTCCAATTTTACAGTTGACTTTTTACTAGAGTTTGCCAACCTACAAACAGACCCAGGGCATCCCTCGGTGCAAGATGCCATGTTCTGTTTATGGATTTCATATCTGGCAGCCATATTTTATGTTTTATGCTAATGGTTTAAATGAAGCGCCAAGTTGAGTTTTGTTATCTACATACAGAAGCCCTGTGGGACATGTGTTAGATGATACCAGTGTAATGTTTTGTCTAAATATACATGACATTGTACAGTATTGCCGTTTTCTTCAGAAAACAAACTGTGGCATTTAGATATATCTTCTATACATTTATCGATACACATTATTTGTATATACTTAAAAGACAGAGGATAAGGTACTGTCACAATGAAGTTTTACTGTTTTTAATTTATAGATATGTCTGAAATATGTAAGGCTCCGCCTCA
  3   1   2      seed DMZ  5g3  in                         xl302i22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCTAATCATAATGCGAATATATAAAAATGTAAAAAAAAAACTTCTGCAAATTACTGTGATAAGGCAAACGAAGATATTGTGAAACCTCAGGTATCTTGCTGTAAGCAGTCCGTTGTGCTGGAGATGGAATGAAATCTTGGTTTAATTCCTCTATGGAAAGTTATCAGATGCCTCGGCCTTCTTTCCTCAAGCCGCTGTGAGCTCCCAGCATGCCCAGCAGTTGAAGCCTATGAATGGTGGGAGATGCAAATCACAACAGCTGGAGGGACGTGGGCTGACATTCCAATTTTACAGTTGACTTTTTACTAGAGTTTGCCAACCTACAAACAGACCCAGGGCATCCCTCGGTGCAAGATGCCATGTTCTGTTTATGGATTTCATATCTGGCAGCCATATTTTATGTTTTATGCTAATGGTTTAAATGAAGCGCCAAGTTGAGTTTTGTTATCTACATACAGAAGCCCTGTGGGACATGTGTTAGATGATACCAGTGTAATGTTTTGTCTAAATATACATGACATTGTACAGTATTGCCGTTTTCTTCAGAAAACAAACTGTGGCATTTAGATATATCTTCTATACATTTATCGATACACATTATTTGTATATACTTAAAAGACAGAGGATAAGGTACTGTCACAATGAAGTTTTACTGTTTTTAATTTATAGATATGTCTGAAATATGTAAGGCTCCGCCTCAT
  3   1   2       bld Ga12 5g3  in                         XL216a24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTAATNCATAATGCGAATATATAAAAATGTAAAAAAAAAACTTCTGCAAATTACTGTGATAAGGCAAACGAAGATATTGTGAAACCTCAGGTATCTTGCTGTAAGCAGTCCGTTGTGCTGGAGATGGAATGAAATCTTGGTTTAATTCCTCTATGGAAAGTTATCAGATGCCTCGGCCTTCTTTCCTCAAGCCGCTGTGAGCTCCCAGCATGCCCAGCAGTTGAAGCCTATGAATGGTGGGAGATGCAAATCACAACAGCTGGAGGGACGTGGGCTGACATTCCAATTTTACAGTTGACTTTTTACTAGAGTTTGCCAACCTACAAACAGACCCAGGGCATCCCTAGGTGCAAGATGCCATGTTCTGTTTATGGATTTCATATCTGGCAGCCATATTTTATGTTTTATGCTAATGGTTTAAATGAAGCGCCAAGTTGAGTTTTGTTATCTACATACAGAAGCCCTGTGGGACATGTGTTAGATGATACCAGTGTAATGTTTTGTCTAAATATACATGACATTGTACAGTATTGCCGTTTTCTTCAGAAAACAAACTGTGGCATTTAGATATATCTTCTATACATTTATCGATACACATTATTTGTATATACTTAAAAGACAGAGGATAAGGTACTGTCACAATGAAGTTTTACTGTTTTTAATTTATAGATA
  3   1   2       bld Ga18 5g3  in                        xlk3n01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTAANCATAATGNNNNNATATNAAAAATGTAAAAAAAAANCTTCTGCAAATTACTGTGATAAGGCAAACGAAGATATTGTGAAACCTCAGGTATCTNGCTGTAAGCAGTCCGTTGTGCTGGAGATGGAATGAAATCTTGGTTTAATTCCTCTATGGAAAGTTATCAGATNCCTCGNCCTTCTTTCCTCAAGCCGCTGTGAGCTCCCAGCATNNCCAGCAGTTGAAGCCTATGAATGGTGGGAGATGCAAATCACAACAGCTGGAGGGACGTGGGCTGACATTCCAATTTTACAGTTGACTTTTTACTAGAGTTTGCCAACCTACAAACAGACCCAGGGCATCCCTAGGTGCAAGATGCCATGTTCTGTTTATGGATTTCATATCTGGCAGCCATATTTTATGTTTTATGCTAATGGTTTAAATGAAGCGCCAAGTTGAGTTTTGTTATCTACATACAGAANCCTGTGGGACATGTGTTAGATGATACCAGTGTAATGTTTTGTCTAAATATACATGACATTGTACAGTATTGCCGTTTTCTTCAGAAAACAAACTGTGGCATTTAGATATATCTTCTATACATTTATCGATACACATTATTTGTATATACTTAAAAGACAGAGGATAAGGTACTGTCACAATGAAGTTTTACTGTTTTTAATTTATAGATATGTCTGAAATAT
  3   1   2       bld DMZ                                 rxl339f12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGCAAATTACTGTGATAAGGCAAACGAAGATATTGTGAANCCTCAGGTATCNTGCTGTAAGCAGTCCGTTGTGNTGGAGATGGAATGAAATCTNGGTTTAATTCCTCTATGGAAAGTT
  3   1   2       bld DMZ       in                         xl270c18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACGAAGATATTGTGAAACCTCAGGTATCTTGCTGTAAGCAGTCCGTTGTGCTGGAGATGGAATGAAATCTTGGTTTAATTCCTCTATGGAAAGTTATCAGATGCCTCGGCCTTCTTTCCTCAAGCCGCTGTGAGCTCCCAGCATGCCCCAGCAGTTGAAGCCTATGAATGGTGGGAGATGCAAATCACAACAGCTGGAGGGACGTGGGCTGACATTCCAATTTTACAGTTGACTTTTTACTAGAGTTTGCCAACCTACAAACAGACCCAGGGCATCCCTCGGTGCAAGATGCCATGTTCTGTTTATGGATTTCATATCTGGCAGCCATATTTTATGTTTTATGCTAATGGTTTAAATGAAGCGCCAAGTTGAGTTTTGTTATCTACATACAGAAGCCCTGTGGGACATGTGTTAGATGATACCAGTGTAATGTTTTGTCTAAATATACATGACATTGTACAGTATTGCCGTTTTCTTCAGAAAACAAACTGTGGCATTTAGATATATCTTCTATACATTTATCGATACACATTATTTGTATATACTTAAAAGACAGAGGATAAGGTACTGTCACAATGAAGTTTTACTGTTTTTAATTTATAGATATGTCTGAAATATGTAAGG
  3   1   2       bld Tbd7 5g3  in                         XL098o07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGTAAGCAGTCCGTTGTGCTGNAGATGGAATGAAATCTTGGTTTAATTCCTCTATGGAAAGTTATCAGATGCCTCGGCCTTCTTTCCTCAAGCCGCTGTGAGCTCCCAGCATGCCCAGCAGTTGAAGCCTATGAATGGTGGGAGATGCAAATCACAACAGCTGGAGGGACGTGGGCTGACATTCCAATTTTACAGTTGACTTTTTACTAGAGTTTGCCAACCTACAAACAGACCCAGGGCATCCCTAGGTGCAAGATGCCATGTTCTGTTTATGGATTTCATATCTGGCAGCCATATTTTATGTTTTATGCTAATGGTTTAAATGAAGCGCCAAGTTGAGTTTTGTTATCTACATACAGAAGCCCTGTGGGACATGTGTTAGATGATACCAGTGTAATGTTTTGTCTAAATATACATGACATTGTACAGTATTGCCGTTTTCTTCAGAAAACAAACTGTGGCATTTAGATATATCTTCTATACATTTATCGATACACATTATTTGTATATACTTAAAAGACAGAGGATAAGGTACTGTCACAATGAAGTTTTACTGTTTTTAATTTATAGATATGTCTGAAATATGTAAGGCTCCGCCTCATCACNGGATAAGTTATAGAATATTATAACACAATAC
  3   1   2       bld Gas5 5g3  in                    IMAGE:3749806.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AACGTGGGCTGACATTCCAATTTTACAGTTGACTTTTTACTAGAGTTTGCCAACCTACAAACAGACCCAGGGCATCCCTAGGTGCAAGATAGCCATGTTCTGTTTATGGATTTCATATCTGGCAGCCATATTTTATGTAGTATAGTAATGGTTTAAATGAAGCGCCAAGTTGAGTTTTGTTATCTACATAAAGAAGCCCTGTGGGACATGTGTTAGATGATACATGTGTAATGTTTTGTCTAAATATACATGACATTATACAGTATTGCCGTTTTCTTCAGAAAACAAACTGTGGCATTTAGATATATCTTCTATACATTTATCGATACACATTATTTGTATATACTTAAAAGACAGAGGATAAGGTACTGTCACAATGAAGTTTTACTGTTTTTAATTTATAGATATGTCTGAAATATGTAAGGCTCCGCCTCATCACTGGGATAAGTTATGAGAATATTATAACACAATACCAAAA
  5   1   2       bld Tad2      out                   IMAGE:6875315.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACGTGGGCTGACATTCCAATTTTACAGTTGACTTTTTACTAGAGTTTGCCAACCTACAAACAGACCCAGGGCATCCCTAGGTGCAAGATGCCATGTTCTGTTTATGGATTTCATATCTGGCAGCCATATTTTATGTTTTATGCTAATGGTTTAAATGAAGCGCCAAGTTGAGTTTTGTTATCTACATACAGAAGCCCTGTGGGACATGTGTTAGATGATACCAGTGTAATGTTTTGTCTAAATATACATGACATTGTACAGTATTGCCGTTTTCTTCAGAAAACAAACTGTGGCATTTAGATATATCTTCTATACATTTATCGATACACATTATTTGTATATACTTAAAAGACAGAGGATAAGGTACTGTCACAATGAAGTTTTACTGTTTTTAATTTATAGATATGTCTGAAATATGTAAGGCTCCGCCTCATCACTGGGATAAGTTATGAGAATATTATAACACAATACGTACAGCAGTGTGTGCAGTTATTCTATACGTGTCTCTGTTTGTCTGTGCAGCCAGTGGAGCAGTGTCAGTAGCAGTATCTCTGGGAATATACTGTGAGTGTGAATGGTGAGCTGAAATGATTGTAACACAGTGCTGGCCCCCCAGCTGGCTGAACTACACCCTTCCAGGCACCCCACAAACAGACACCCAGGTGGCTGGTTTTTCCCCTGAATAAACATTTCCCCCTAGGTTAAATTAACCAAACCAAAATGGGGGAACA
  5   1   2       bld Sp1       out                   IMAGE:4173350.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAGATATGTCTGAAATATGTAAGGCTCCGCCTCATCACTGGGATAAGTTATGAGAATATTATAACACAATACGTACAGCAGTGTGTGCAGTTATTCTATACGTGTCTCTGTTTGTCTGTGCAGCCAGTGGAGCAGTGTCAGTAGCAGTATCTCTGGGAATATACTGTGAGTGTGAATGGTGAGCTGAAATGATTGTAACACAGTGCTGCCCCCCAGCTGCTGAACTACACCTTCCAGCACCCACAACAGACACCAGGTGCTGTTTTCCCTGATAACATTCCCTAGTNAATAACAAACAAATGGGAGCGATGCTCAACTATAACTCACCACTTGTTGTAGCGTNGGGCTTCACTTTTTTAATTATTATAGGGATTATAAAGCAATACAAAGGGACAGCTCTCAGCACAAGTGATGGAACACTATCGCTTATACTGTATATTGTCACTTCTCTCTCTAAGGTTCTCTCTGAAATGATATAGTACTCACCATTACTGCTTAGATTTATG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)