Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL142n01.5                            9 END     1           4       11                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:8641180.3                       4 PI      92       1343     1957                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:5511336.5                       4 PI      89         55      750                MGC80387 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 98%

 1012838136 Xl3.1-IMAGE:4055441-IMAGp.5.5 - 25 ESTs
                                                                       ........-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                         Xl3.1-IMAGE:4055441-IMAGp.5.5                                       CAGCTGCTCTTCGCCTGGAATAGAGGTTCCTTAGGGCCTAAGTGAGTTCTATAGACGAGCAGTTGGTCCGTGTGGAAGCGACACCATGGCAGGCAGAGGCAGGATGGCGGAGGACGTAGCCACAGCTTCCAGTTACCGAGAGGTCCAGCCCCAGCACATGCACCTGGAGCTCACAGTAGACACAGAGGCTCGTATGCTGCGGGGTTCCCAGCGGCTGGATTTGCAGGTGCTACGGGAGACCGAGGAACTTCGACTGGACACACATCGCTGCTTGCGGGTGCGGGGGGTTCGGCTGGAGAAGAACCAGGGGAAACACGAGACGCTGTCGTGGGAGGAGAAGCCTTTCACAGGTTATGGCACTATGGTTGTTCTGCGGCTGCCCAGCCTTCTGCCCTCGGGAGCCAGGATTCGGGTGATCATCGATTACGAGGCTGCAGACAGCCCAGGGGTTTGTTGGTTGGACCCACAACAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCAGTTCTTAACCGCTCCTTCTTCCCATGCTTTGATAGCCCTGCTGTTAAATGCACCTATTCTGCCAATATCAAGGTACCTGAGGGTTTTACAGCTGTTATGAGTGCAAATAACTCAGACCGCCAAGGTGATACTTTTATCTTCAAAATGACACAACCCATTCCAGCATATCTGGTAGCTCTGGTGGTTGGTGACATTGTATCCGCCGAGGTAGGGCCAAGGAGCCGTGTCTGGGCTGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTGATCGAGGACTTCCTAAAAGTGGGGGAGAAGCTATTTGGTCCTTATGTATGGGGAAGGTATGATGTACTGTTCATGCCACCATCTTTCCCATTTGGTGGAATGGAAAACCCCTGCATCACATTTGTCACCCCATGTCTGCTGGCTGGCGATCGCTCATTGGCTGATGTTATCATACATGAGATTTCACACAGCTGGTTCGGGAACCTGGTCACCAATGCCAACTGGGGAGAATTTTGGCTGAATGAGGGCTTCACAATGTATGCCCAACGTAGAATTACAACTGAATTATATGGTCCTGCGTACACTTGTCTGGAAGCAGCTGCTGGAAGAGCCCTGCTACGGCAGCACATGGACACTTCTGGGGAAGACCATCCTTTGAACAAATTGCGAGTAAAGATAGAGCCTGGGGTGGATCCAGATGATACGTATAATGAGACTCCCTACGAAAAAGGATTCTGCTTTGTTTCATACCTAGCCCACCTCACTGGGGACCAGACAAAATTTGATGACTTTTTAAAGGCCTATGTAAATAAGTTCAAATTCCAAAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCACGGGGAGTGGATAAGATAGCTGGTCTGGAATTTGACCATTGGTTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCGGCAGAACTAGCAAACCTCTGGTCTTCTACACCACTTGATACTGAAACGATTTCAAAAGTCGATCCCACCAAATGGAGAACCTATCAACTTGTTTACTTTTTGGATAGGGTACTGGAATTGTCACCATTACCTAATGGAAATATTGAACAACTGGAAAAGTTTTATCCAAAGATTTCCAATGCCACAAATGCTGAGCTGCGCATGCGCTGGGCCCAGATTGTGTTGAGGAATGACTACCAGCCCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAACAGAAGTATACTTTACCTTTGTATCGTACCATGCAAGCTGGCTCAGAGGCAGCGCAGGCCCTTGCTAGGGAGACCTTTATCCAAACTTGCCCACAGCTTCATGCCAATGTTCAGAACTACGTGAAGAGGATCCTAGGCACATAGAGCCACACTTCTGCTATTGAAGCTCAACTAAAGATGGACATGTCACCTAG
                                                  Xl3.1-CHK-1012722383                                             CTCTTCGCCTGGAATAGAGGTTCCTTAGGGCCTAAGTGAGTTCTATAGACGAGCAGTTGGTCCGTGTGGAAGCGACACCATGGCAGGCAGAGGCAGGATGGCGGAGGACGTAGCCACAGCTTCCAGTTACCGAGAGGTCCAGCCCCAGCACATGCACCTGGAGCTCACAGTAGACACAGAGGCTCGTATGCTGCGGGGTTCCCAGCGGCTGGATTTGCAGGTGCTACGGGAGACCGAGGAACTTCGACTGGACACACATCGCTGCTTGCGGGTGCGGGGGGTTCGGCTGGAGAAGAACCAGGGGAAACACGAGACGCTGTCGTGGGAGGAGAAGCCTTTCACAGGTTATGGCACTATGGTTGTTCTGCGGCTGCCCAGCCTTCTGCCCTCGGGAGCCAGGATTCGGGTGATCATCGATTACGAGGCTGCAGACAGCCCAGGGGTTTGTTGGTTGGACCCACAACAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCAGTTCTTAACCGCTCCTTCTTCCCATGCTTTGATAGCCCTGCTGTTAAATGCACCTATTCTGCCAATATCAAGGTACCTGAGGGTTTTACAGCTGTTATGAGTGCAAATAACTCAGACCGCCAAGGTGATACTTTTATCTTCAAAATGACACAACCCATTCCAGCATATCTGGTAGCTCTGGTGGTTGGTGACATTGTATCCGCCGAGGTAGGGCCAAGGAGCCGTGTCTGGGCTGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTGATCGAGGACTTCCTAAAAGTGGGGGAGAAGCTATTTGGTCCTTATGTATGGGGAAGGTATGATGTACTGTTCATGCCACCATCTTTCCCATTTGGTGGAATGGAAAACCCCTGCATCACATTTGTCACCCCATGTCTGCTGGCTGGCGATCGCTCATTGGCTGATGTTATCATACATGAGATTTCACACAGCTGGTTCGGGAACCTGGTCACCAATGCCAACTGGGGAGAATTTTGGCTGAATGAGGGCTTCACAATGTATGCCCAACGTAGAATTACAACTGAATTATATGGTCCTGCGTACACTTGTCTGGAAGCAGCTGCTGGAAGAGCCCTGCTACGGCAGCACATGGACACTTCTGGGGAAGACCATCCTTTGAACAAATTGCGAGTAAAGATAGAGCCTGGGGTGGATCCAGATGATACGTATAATGAGACTCCCTACGAAAAAGGATTCTGCTTTGTTTCATACCTAGCCCACCTCACTGGGGACCAGACAAAATTTGATGACTTTTTAAAGGCCTATGTAAATAAGTTCAAATTCCAAAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCACGGGGAGTGGATAAGATAGCTGGTCTGGAATTTGACCATTGGTTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCGGCAGAACTAGCAAACCTCTGGTCTTCTACACCACTTGATACTGAAACGATTTCAAAAGTCGATCCCACCAAATGGAGAACCTATCAACTTGTTTACTTTTTGGATAGGGTACTGGAATTGTCACCATTACCTAATGGAAATATTGAACAACTGGAAAAGTTTTATCCAAAGATTTCCAATGCCACAAATGCTGAGCTGCGCATGCGCTGGGCCCAGATTGTGTTGAGGAATGACTACCAGCCCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAACAGAAGTATACTTTACCTTTGTATCGTACCATGCAAGCTGGCTCAGAGGCAGCGCAGGCCCTTGCTAGGGAGACCTTTATCCAAACTTGCCCACAGCTTCATGCCAATGTTCAGAACTACGTGAAGAGGATCCTAGGCACATAGAGCCACACTTCTGCTATTGAAGCTCAACTxAAGxxGxxxxTxxCACCTAGGCACAA
                                                      consensus depths                                            3     3     4     5     7     7     9    10     9    10    10    10    10    10    10    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    13    13    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    13    13    13    13    12    13    12    13    11    14    13    14    12    14    12    14    11    14    11    14    11    14    11    14    10    14    10    14     9    14     8    13     9    13     7    13     9    14     8    14     8    13     7    11     7    11     7    11     7    11     6    11     6    11     7    11     5     9     5     8     5     8     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     6     5     6     4     6     4     6     4     6     3     6     3     6     2     6     2     6     3     8     3     9     4    10     5    11     5    10     6    10     6    10     5    10     5    10     6     9     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     7     6     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     7     5     7     5     7     5     6     5     6     3     6     2     6     2     5
  5   1   2       e50                      Xl3.1-IMAGE:4055441-IMAGp.5                                       CAGCTGCTCTTCGCCTGGAATAGAGGTTCCTTAGGGCCTAAGTGAGTTCTATAGACGAGCAGTTGGTCCGTGTGGAAGCGACACCATGGCAGGCAGAGGCAGGATGGCGGAGGACGTAGCCACAGCTTCCAGTTACCGAGAGGTCCAGCCCCAGCACATGCACCTGGAGCTCACAGTAGACACAGAGGCTCGTATGCTGCGGGGTTCCCAGCGGCTGGATTTGCAGGTGCTACGGGAGACCGAGGAACTTCGACTGGACACACATCGCTGCTTGCGGGTGCGGGGGGTTCGGCTGGAGAAGAACCAGGGGAAACACGAGACGCTGTCGTGGGAGGAGAAGCCTTTCACAGGTTATGGCACTATGGTTGTTCTGCGGCTGCCCAGCCTTCTGCCCTCGGGAGCCAGGATTCGGGTGATCATCGATTACGAGGCTGCAGACAGCCCAGGGGTTTGTTGGTTGGACCCACAACAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCAGTTCTTAACCGCTCCTTCTTCCCATGCTTTGATAGCCCTGCTGTTAAATGCACCTATTCTGCCAATATCAAGGTACCTGAGGGTTTTACAGCTGTTATGAGTGCAAATAACTCAGACCGCCAAGGTGATACTTTTATCTTCAAAATGACACAACCCATTCCAGCATATCTGGTAGCTCTGGTGGTTGGTGACATTGTATCCGCCGAGGTAGGGCCAAGGAGCCGTGTCTGGGCTGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTGATCGAGGACTTCCTAAAAGTGGGGGAGAAGCTATTTGGTCCTTATGTATGGGGAAGGTATGATGTACTGTTCATGCCACCATCTTTCCCATTTGGTGGAATGGAAAACCCCTGCATCACATTTGTCACCCCATGTCTGCTGGCTGGCGATCGCTCATTGGCTGATGTTATCATACATGAGATTTCACACAGCTGGTTCGGGAACCTGGTCACCAATGCCAACTGGGGAGAATTTTGGCTGAATGAGGGCTTCACAATGTATGCCCAACGTAGAATTACAACTGAATTATATGGTCCTGCGTACACTTGTCTGGAAGCAGCTGCTGGAAGAGCCCTGCTACGGCAGCACATGGACACTTCTGGGGAAGACCATCCTTTGAACAAATTGCGAGTAAAGATAGAGCCTGGGGTGGATCCAGATGATACGTATAATGAGACTCCCTACGAAAAAGGATTCTGCTTTGTTTCATACCTAGCCCACCTCACTGGGGACCAGACAAAATTTGATGACTT
  5   1   2       e50                            Xl3.1-IMAGE:7976273.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCTTTGTTTCATACCTAGCCCACCTCACTGGGGACCAGACAAAATTTGATGACTTTTTAAAGGCCTATGTAAATAAGTTCAAATTCCAAAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCACGGGGAGTGGATAAGATAGCTGGTCTGGAATTTGACCATTGGTTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCGGCAGAACTAGCAAACCTCTGGTCTTCTACACCACTTGATACTGAAACGATTTCAAAAGTCGATCCCACCAAATGGAGAACCTATCAACTTGTTTACTTTTTGGATAGGGTACTGGAATTGTCACCATTACCTAATGGAAATATTGAACAACTGGAAAAGTTTTATCCAAAGATTTCCAATGCCACAAATGCTGAGCTGCGCATGCGCTGGGCCCAGATTGTGTTGAGGAATGACTACCAGCCCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAACAGAAGTATACTTTACCTTTGTATCGTACCATGCAAGCTGGCTCAGAGGCAGCGCAGGCCCTTGCTAGGGAGACCTTTATCCAAACTTGCCCACAGCTTCATGCCAATGTTCAGAACTACGTGAAGAGGATCCTAGGCACATAGAGCCACACTTCTGCTATTGAAGCTCAACT
                                               BLH MIN      58     326                                       
                                               BLH OVR      85     434                                       
                                               EST CLI      12       7                                       
                                               ORF LNG      85     160                                       
  5   1   2       e50                      Xl3.1-IMAGE:4055441-IMAGp.5                                       CAGCTGCTCTTCGCCTGGAATAGAGGTTCCTTAGGGCCTAAGTGAGTTCTATAGACGAGCAGTTGGTCCGTGTGGAAGCGACACCATGGCAGGCAGAGGCAGGATGGCGGAGGACGTAGCCACAGCTTCCAGTTACCGAGAGGTCCAGCCCCAGCACATGCACCTGGAGCTCACAGTAGACACAGAGGCTCGTATGCTGCGGGGTTCCCAGCGGCTGGATTTGCAGGTGCTACGGGAGACCGAGGAACTTCGACTGGACACACATCGCTGCTTGCGGGTGCGGGGGGTTCGGCTGGAGAAGAACCAGGGGAAACACGAGACGCTGTCGTGGGAGGAGAAGCCTTTCACAGGTTATGGCACTATGGTTGTTCTGCGGCTGCCCAGCCTTCTGCCCTCGGGAGCCAGGATTCGGGTGATCATCGATTACGAGGCTGCAGACAGCCCAGGGGTTTGTTGGTTGGACCCACAACAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCAGTTCTTAACCGCTCCTTCTTCCCATGCTTTGATAGCCCTGCTGTTAAATGCACCTATTCTGCCAATATCAAGGTACCTGAGGGTTTTACAGCTGTTATGAGTGCAAATAACTCAGACCGCCAAGGTGATACTTTTATCTTCAAAATGACACAACCCATTCCAGCATATCTGGTAGCTCTGGTGGTTGGTGACATTGTATCCGCCGAGGTAGGGCCAAGGAGCCGTGTCTGGGCTGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTGATCGAGGACTTCCTAAAAGTGGGGGAGAAGCTATTTGGTCCTTATGTATGGGGAAGGTATGATGTACTGTTCATGCCACCATCTTTCCCATTTGGTGGAATGGAAAACCCCTGCATCACATTTGTCACCCCATGTCTGCTGGCTGGCGATCGCTCATTGGCTGATGTTATCATACATGAGATTTCACACAGCTGGTTCGGGAACCTGGTCACCAATGCCAACTGGGGAGAATTTTGGCTGAATGAGGGCTTCACAATGTATGCCCAACGTAGAATTACAACTGAATTATATGGTCCTGCGTACACTTGTCTGGAAGCAGCTGCTGGAAGAGCCCTGCTACGGCAGCACATGGACACTTCTGGGGAAGACCATCCTTTGAACAAATTGCGAGTAAAGATAGAGCCTGGGGTGGATCCAGATGATACGTATAATGAGACTCCCTACGAAAAAGGATTCTGCTTTGTTTCATACCTAGCCCACCTCACTGGGGACCAGACAAAATTTGATGACTT
                                                  Xl3.1-CHK-1012690430                                             CTCTTCGCCTGGAATAGAGGTTCCTTAGGGCCTAAGTGAGTTCTATAGACGAGCAGTTGGTCCGTGTGGAAGCGACACCATGGCAGGCAGAGGCAGGATGGCGGAGGACGTAGCCACAGCTTCCAGTTACCGAGAGGTCCAGCCCCAGCACATGCACCTGGAGCTCACAGTAGACACAGAGGCTCGTATGCTGCGGGGTTCCCAGCGGCTGGATTTGCAGGTGCTACGGGAGACCGAGGAACTTCGACTGGACACACATCGCTGCTTGCGGGTGCGGGGGGTTCGGCTGGAGAAGAACCAGGGGAAACACGAGACGCTGTCGTGGGAGGAGAAGCCTTTCACAGGTTATGGCACTATGGTTGTTCTGCGGCTGCCCAGCCTTCTGCCCTCGGGAGCCAGGATTCGGGTGATCATCGATTACGAGGCTGCAGACAGCCCAGGGGTTTGTTGGTTGGACCCACAACAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCAGTTCTTAACCGCTCCTTCTTCCCATGCTTTGATAGCCCTGCTGTTAAATGCACCTATTCTGCCAATATCAAGGTACCTGAGGGTTTTACAGCTGTTATGAGTGCAAATAACTCAGACCGCCAAGGTGATACTTTTATCTTCAAAATGACACAACCCATTCCAGCATATCTGGTAGCTCTGGTGGTTGGTGACATTGTATCCGCCGAGGTAGGGCCAAGGAGCCGTGTCTGGGCTGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTGATCGAGGACTTCCTAAAAGTGGGGGAGAAGCTATTTGGTCCTTATGTATGGGGAAGGTATGATGTACTGTTCATGCCACCATCTTTCCCATTTGGTGGAATGGAAAACCCCTGCATCACATTTGTCACCCCATGTCTGCTGGCTGGCGATCGCTCATTGGCTGATGTTATCATACATGAGATTTCACACAGCTGGTTCGGGAACCTGGTCACCAATGCCAACTGGGGAGAATTTTGGCTGAATGAGGGCTTCACAATGTATGCCCAACGTAGAATTACAACTGAATTATATGGTCCTGCGTACACTTGTCTGGAAGCAGCTGCTGGAAGAGCCCTGCTACGGCAGCACATGGACACTTCTGGGGAAGACCATCCTTTGAACAAATTGCGAGTAAAGATAGAGCCTGGGGTGGATCCAGATGATACGTATAATGAGACTCCCTACGAAAAAGGATTCTGCTTTGTTTCATACCTAGCCCACCTCACTGGGGACCAGACAAAATTTGATGACTTTTTAAA
  5   1   2       bld Brn2 5g                          Brn2-za99c07.5p GAATAAGAAGCAAGAACTAAACGGCTTGCAGGAAGCTGCAGCTGCTCTTCGCCTGGAATAGAGGTTCCTTAGGGCCTAAGTGAGTTCTATAGACGAGCAGTTGGTCCGTGTGGAAGCGACACCATGGCAGGCAGAGGCAGGATGGCGGAGGACGTAGCCACAGCTTCCAGTTACCGAGAGGTCCAGCCCCAGCACATGCACCTGGAGCTCACAGTAGACACAGAGGCTCGTATGCTGCGGGGTTCCCAGCGGCTGGATTTGCAGGTGCTACGGGAGACCGAGGAACTTCGACTGGACACACATCGCTGCTTGCGGGTGCGGGGGGTTCGGCTGGAGAAGAACCAGGGGAAACACGAGACGCTGTCGTGGGAGGAGAAGCCTTTCACAGGTTATGGCACTATGGTTGTTCTGCGGCTGCCCAGCCTTCTGCCCTCG
  5   1   2       bld Tbd3 5g                IMAGE:3550122-IMAGp.IMAGp                           CCAGGAAGCTTGCAGCTGCTCTTCGCCTGGAATAGAGGTTCCTTAGGGCCTAAGTGAGTTCTATAGACGAGCAGTTGGTCCGTGTGGAAGCGACACCATGGCAGGCAGAGGCAGGATGGCGGAGGACGTAGCCACAGCTTCCAGTTACCGAGAGGTCCAGCCCCAGCACATGCACCTGGAGCTCACAGTAGACACAGAGGCTCGTATGCTGCGGGGTTCCCAGCGGCTGGATTTGCAGGTGCTACGGGAGACCGAGGAACTTCGACTGGACACACATCGCTGCTTGCGGGTGCGGGGGGTTCGGCTGGAGAAGAACCAGGGGAAACACGAGACGCTGTCGTGGGAGGAGAAGCCTTTCACAGGTTATGGCACTATGGTTGTTCTGCGGCTGCCCAGCCTTCTGCCCTCGGGAGCCAGCATTCGGGTGATCATCGATTACGAGGGTGCAGACAGCCCAGGGGTTTGTTGGTTGGACCCACAACAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCAGTTCTTAACCGCTCCTTCTTCCCATGCTTTGATAGCCCTGCTGTTAAATGCACCTATTCTGTCAATATCAAGGTACCTGAAGGGTTTTACAGCTGTTATGAGTGCAAATAACTCAGACCGCCAAGGTGATACTTTTATCTTCAAAATGACACAACCCATTCCAGCATATCTGGTACCTCTGGTGGTTT
  5   1   2       bld Eye1 5g                         IMAGE:6947439.5p                                GAAGCTGCAGCTGCTCTTCGCCTGGAATAGAGGTTCCTTAGGGCCTAAGTGAGTTCTATAGACGAGCAGTTGGTCCGTGTGGAAGCGACACCATGGCAGGCAGAGGCAGGATGGCGGAGGACGTAGCCACAGCTTCCAGTTACCGAGAGGTCCAGCCCCAGCACATGCACCTGGAGCTCACAGTAGACACAGAGGCTCGTATGCTGCGGGGTTCCCAGCGGCTGGATTTGCAGGTGCTACGGGAGACCGAGGAACTTCGACTGGACACACATCGCTGCTTGCGGGTGCGGGGGGTTCGGCTGGAGAAGAACCAGGGGAAACACGAGACGCTGTCGTGGGAGGAGAAGCCTTTCACAGGTTATGGCACTATGGTTGTTCTGCGGCTGCCCAGCCTTCTGCCCTCGGGAGCCAGGATTCGGGTGATCATCGATTACGAGGCTGCAGACAGCCCAGGGGTTTGTTGGTTGGACCCACAACAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCAGTTCTTAACCGCTCCTTCTTCCCATGCTTTGATAGCCCTGCTGTTAAATGCACCTATTCTGCCAATATCAAGGTACCTGAGGGTTTTACAGCTGTTATGAGTGCAAATAACTCAGACCGCCAAGGTGATACTTTTATCTTCAAAATGACACAACCCATTTCCGGCATATCCTGGTAGCCTCTGGGTGGGTGGGGGAACATTGGTATccccccccGAGGTTTAGGGGCCCAAGGGAAGCCCGCTGTTCTTGGGGGCTGGAACCCCTTTGTCCTTTTATAAGGAAAAGCCAGCCTTAAAATAATAGGGGAGGTTAATGAAATCGGCGGAACTGGTAATTCCCAAAAGGGAAACCTTTCCCCTTTaaaaaaaaagtgggggggggggggAAAA
  5   1   2       bld Sp1  5g                         IMAGE:5435370.5p                                                 CCCACGCGTCCGGAGGTTCCTTAGGGCCTAAGTGAGTTCTATAGACGAGCAGTTGGTCCGTGTGGAAGCGACACCATGGCAGGCAGAGGCAGGATGGCGGAGGACGTAGCCACAGCTTCCAGTTACCGAGAGGTCCAGCCCCAGCACATGCACCTGGAGCTCACAGTAGACACAGAGGCTCGTATGCTGCGGGGTTCCCAGCGGCTGGATTTGCAGGTGCTACGGGAGACCGAGGAACTTCGACTGGACACACATCGCTGCTTGCGGGTGCGGGGGGTTCGGCTGGAGAAGAACCAGGGGAAACACGAGACGCTGTCGTGGGAGGAGAAGCCTTTCACAGGTTATGGCACTATGGTTGTTCTGCGGCTGCCCAGCCTTCTGCCCTCGGGAGCCAGGATTCGGGTGATCATCGATTACGAGGCTGCAGACAGCCCAGGGGTTTGTTGGTTGGACCCACAACAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCAGTTCTTAACCGCTCCTTCTTCCCATGCTTTGATAGCCCTGCTGTTAAATGCACCTATTCTGCCAATATCAAGGTACCTGAGGGTTTTACAGCTGTTATGAGTGCAAATACTCAGACCGCCAGGTGATACTTTTATCTCAAATGACACACCCATTCAGCATACTGGTACTCTGGTGTTGTGACATGTATCGCCAAGTAGGCCAAGAGCCTGCTGGCTGACCTGTCTTAAACGCTAAAGGATTGATGATGTCAGGCTCTAAATGGG
  5   1   2       bld Emb4 5g                IMAGE:5571899-IMAGp.IMAGp                                                   GCCTGGAATAGAGGTTCCTTAGGGCCTAAGTGAGTTCTATAGACGAGCAGTTGGTCCGTGTGGAAGCGACACCATGGCAGGCAGAGGCAGGATGGCGGAGGACGTAGCCACAGCTTCCAGTTACCGAGAGGTCCAGCCCCAGCACATGCACCTGGAGCTCACAGTATACACAGAGGCTCGTATGCTGCGGGGTTCCCAGCGGCTGGATTTGCAGGTGCTACGGGAGACCGAGGAACTTCGACTGGACACACATCGCTGCTTGCGGGTGCGGGGGGTTCGGCTGGAGAAGAACCAGGGGAAACACGAGACGCTGTCGTGGGAGGAGAAGCCTTTCACAGGTTATGGCACTATGGTTGTTCTGCGGCTGCCCAGCCTTCTGCCCTCGGGAGCCAGGATTCGGGTGATCATCGATTACGAGGCTGCAGACAGCCCAGGGGTTTGTTGGTTGGACCCACAACAGACTGCAGGCAAGAAGAACCCTTACCTGTACACGCAAGGCCAGGCAGTACTTAACCGCTCCTTCTTCCCATGCTTTGATAGCCCTGCTGTTAAATGCACCTATTCTGCCAATATCCAGGTACCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCATACCGCCAAGGTGATACTTTTATCTTCAAACTGACACAACCCATTCCAGCATATCTGGAAGCTCTGAAGTGTGGTGACATTGTATCCCCCCGAGGTAGGGCC
  5   1   2       bld Ov1  5g                         IMAGE:6317210.5p                                                     CTGGAATAGAGGTTCCTTAGGGCCTAAGTGAGTTCTATAGACGAGCAGTTGGTCCGTGTGGAAGCGACACCATGGCAGGCAGAGGCAGGATGGCGGAGGACGTAGCCACAGCTTCCAGTTACCGAGAGGTCCAGCCCCAGCACATGCACCTGGAGCTCACAGTAGACACAGAGGCTCGTATGCTGCGGGGTTCCCAGCGGCTGGATTTGCAGGTGCTACGGGAGACCGAGGAACTTCGACTGGACACACATCGCTGCTTGCGGGTGCGGGGGGTTCGGCTGGAGAAGAACCAGGGGAAACACGAGACGCTGTCGTGGGAGGAGAAGCCTTTCACAGGTTATGGCACTATGGTTGTTCTGCGGCTGCCCAGCCTTCTGCCCTCGGGAGCCAGGATTCGGGTGATCATCGATTACGAGGCTGCAGACAGCCCAGGGGTTTGTTGGTTGGACCCACCACAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCAGTTCTTAACCGCTCCTTCTTCCCCTGCTTTGATAGCCCTGGCTGTTACATGCACCTATTCTGCCAATATCAAGGTACCTGAGGGGTTTACCGCTGTTATGAGTGCCACTAACTCAAACCGCCAAGGGGGATACTTTTTATCTTTCAGAATGACACAACCCCCTTCCCAGCATAATCTGGGTAGCCTCCTgggggggttggggggCATTGGCATTCCGCCCGAAGTTAGGGACCACAGGAAGCCGTCGTCCTGGGCTTGGGCCCCTTGTCCTTTACCAAAGCCGCCTTAACCCCGCGGAGACGACGGGCACGGGGCCCCAGGGACATCCCCCAACAAGCGGGGGGTACAAAACCCACCTTGGGGCCCCTTCCGGACATGGGGGCAAGCGGTATGGGTCGGCAGCCTGTTCTCCTCGACCACCGCCACCTGTTCCCCGATTGTGGCGGGCGAAGGGGGAACAAAGACCCTCTCGGCCACCCGCCCTTTTGTTCCCACCCACCGCGCCCTGCTATTCGACCTCCCCC
  5   1   2       bld Kid  5g                         IMAGE:7011689.5p                                                        GAATAGAGGTTCCTTAGGGCCTAAGTGAGTTCTATAGACGAGCAGTTGGTCCGTGTGGAAGCGACACCATGGCAGGCAGAGGCAGGATGGCGGAGGACGTAGCCACAGCTTCCAGTTACCGAGAGGTCCAGCCCCAGCACATGCACCTGGAGCTCACAGTAGACACAGAGGCTCGTATGCTGCGGGGTTCCCAGCGGCTGGATTTGCAGGTGCTACGGGAGACCGAGGAACTTCGACTGGACACACATCGCTGCTTGCGGGTGCGGGGGGTTCGGCTGGAGAAGAACCAGGGGAAACACGAGACGCTGTCGTGGGAGGAGAAGCCTTTCACAGGTTATGGCACTATGGTTGTTCTGCGGCTGCCCAGCCTTCTGCCCTCGGGAGCCAGGATTCGGGTGATCATCGATTACGAGGCTGCAGACAGCCCAGGGGTTTGTTGGTTGGACCCACAACAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCAGTTCTTAACCGCTCCTTCTTCCCATGCTTTGATAGCCCTGCTGTTAAATGCACCTATTCTGCCAATATCAAGGTACCTGAGGGTTTTACAGCTGTTATGAGTGCAAATAACTCAGACCGCCAAGGTGATACTTTTATCTTCAAAATGACACAACCCATTCCAGCATATCTGGTAGCTCTGGTGGTTGGTGACATTGTATCCGCCGAGGTAGGGCCAAGGAGCCGTGTCTGGGCTGAGCCTTTGTCTATAGAAGCAN
  5   1   2       bld Ov1  5g                IMAGE:6317210-IMAGp.IMAGp                                                                 GTTCCTTAGGGCCTAAGTGAGTTCTATTACGAGCAGTTGGTCCGTGTGGAAGCGACACCATGGCAGGCAGAGGCAGGATGGCGGAGGACGTAGCCACAGCTTCCAGTTACCGAGAGGTCCAGCCCCAGCACATGCACCTGGAGCTCACAGTAGACACAGAGGCTCGTATGCTGCGGGGTTCCCAGCGGCTGGATTTGCAGGTGCTACGGGAGACCGAGGAACTTCGACTGGACACACATCGCTGCTTGCGGGTGCGGGGGGTTCGGCTGGAGAAGAACCAGGGGAAACACGAGACGCTGTCGTGGGAGGAGAAGCCTTTCACAGGTTATGGCACTATGGTTGTTCTGCGGCTGCCCAGCCTTCTGCCCTCGGGAGCCAGGATTCGGGTGATCATCGATTACGAGGCTGCAGACAGCCCAGGGGTTTGTTGGTTGGACCCACAACAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCAGTTCTTAACCGCTCCTTCTTCCCATGCTTTGATAGCCCTGCTGTTAAATGCACCTATTCTGCCAATATCAAGGTACCTGAGGGTTTTACAGCTGTTATGAGTGCAAATAACTCAGACCGCCAAGGTGATACTTTTATCTTCAAAATGACACAACCCATTCCAGCATATCTGGTAGCTCTGGTGGTTGGTGACATTGTATC
  5   1   2       bld FaB  5g3  in                    IMAGE:8070907.5p                                                                  TCCTTAGGGCCTAAGTGAGTTCTATAGACGAGCAGTTGGTCCGTGTGGAAGCGACACCATGGCAGGCAGAGGCAGGATGGCGGAGGACGTAGCCACAGCTTCCAGTTACCGAGAGGTCCAGCCCCAGCACATGCACCTGGAGCTCACAGTAGACACAGAGGCTCGTATGCTGCGGGGTTCCCAGCGGCTGGATTTGCAGGTGCTACGGGAGACCGAGGAACTTCGACTGGACACACATCGCTGCTTGCGGGTGCGGGGGGTTCGGCTGGAGAAGAACCAGGGGAAACACGAGACGCTGTCGTGGGAGGAGAAGCCTTTCACAGGTTATGGCACTATGGTTGTTCTGCGGCTGCCCAGCCTTCTGCCCTCGGGAGCCAGGATTCGGGTGATCATCGATTACGAGGCTGCAGACAGCCCAGGGGTTTGTTGGTTGGACCCACAACAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCAGTTCTTAACCGCTCCTTCTTCCCATGCTTTGATAGCCCTGCTGTTAAATGCACCTATTCTGCCAATATCAAGGTACCTGAGGGTTTTACAGCTGTTATGAGTGCAAATAACTCAGACCGCCAAGGTGATACTTTTATCTTCAAAATGACACAACCCATTCCAGCATATCTGGTAGCTCTGGTGGTTGGGTGACATGTATCCGCCGAGGTAGGGCCAANGGAGCGTGTCTGGGCTGAGCCTTGTNCTATAGAAGCAGCTAAAAGGAGTATGATG
  5   1   2      seed Ov1  5g                IMAGE:4055441-IMAGp.IMAGp                                                                   CCTTAGGGCCTAAGTGAGTTCTATAGACGAGCAGTTGGTCCGTGTGGAAGCGACACCATGGCAGGCAGAGGCAGGATGGCGGAGGACGTAGCCACAGCTTCCAGTTACCGAGAGGTCCAGCCCCAGCACATGCACCTGGAGCTCACAGTAGACACAGAGGCTCGTATGCTGCGGGGTTCCCAGCGGCTGGATTTGCAGGTGCTACGGGAGACCGAGGAACTTCGACTGGACACACATCGCTGCTTGCGGGTGCGGGGGGTTCGGCTGGAGAAGAACCAGGGGAAACACGAGACGCTGTCGTGGGAGGAGAAGCCTTTCACAGGTTATGGCACTATGGTTGTTCTGCGGCTGCCCAGCCTTCTGCCCTCGGGAGCCAGGATTCGGGTGATCATCGATTACGAGGCTGCAGACAGCCCAGGGGTTTGTTGGTTGGACCCACAACAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCAGTTCTTAACCGCTCCTTCTTCCCATGCTTTGATAGCCCTGCTGTTAAATGCACCTATTCTGCCAATATCAAGGTACCTGAGGGTTTTACAGCTGTTATGAGTGCAAATAACTCAGACCGCCAAGGTGATACTTTTATCTTCAAAATGACACAACCCATTCCAGCATATCTGGTAGCTCTGGTGGTTGGTGACATTGTATCCGCCGAGGTAGGGCCAAGGAGCCGTGTCTGGGCTGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTGATCGAGGACTTCCTAAAAGTGGGGGAGAAGCTATTTGGGTCCTTATGTATGGGGAAGGTATGATGTACTGTTCATGCCACCATCT
  5   1   2       bld Emb9      in                    IMAGE:7976273.5p                                                                                                                                  GGCAGAGGCAGGATGGCGGAGGACGTAGCCACAGCTTCCAGTTACCGAGAGGTCCAGCCCCAGCACATGCACCTGGAGCTCACAGTAGACACAGAGGCTCGTATGCTGCGGGGTTCCCAGCGGCTGGATTTGCAGGTGCTACGGGAGACCGAGGAACTTCGACTGGACACACATCGCTGCTTGCGGGTGCGGGGGGTTCGGCTGGAGAAGAACCAGGGGAAACACGAGACGCTGTCGTGGGAGGAGAAGCCTTTCACAGGTTATGGCACTATGGTTGTTCTGCGGCTGCCCAGCCTTCTGCCCTCGGGAGCCAGGATTCGGGTGATCATCGATTACGAGGCTGCAGACAGCCCAGGGGTTTGTTGGTTGGACCCACAACAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCAGTTCTTAACCGCTCCTTCTTCCCATGCTTTGATAGCCCTGCTGTTAAATGCACCTATTCTGCCAATATCAAGGTACCTGAGGGTTTTACAGCTGTTATGAGTGCAAATAACTCAGACCGCCAAGGTGATACTTTTATCTTCAAAATGACACAACCCATTCCAGCATATCTGGTAGCTCTGGTGGTTGGTGACATTGTATCCGCCGAGGTAGGGCAAAGGAGCGTGTCTGGGCTGACCTTGTCTATAGAGCAGCTAAAAGGAGTTGATGAGTGTCGAGACCTCTAAAGTGGGGAGAGCTATTGTCTTAGTTGGGAAGTTGAGACTGTCAGCACACTTTCATTGGGATGAAACCTGCTCATTTGCCCCAGTGCGGTGCATCCATGGGAGT
  5   1   2       bld Emb4                            IMAGE:4957160.5p                                                                                                                                                                                                                                                                                                                                      CACGCGTCCGGAAGAACCAGGGGAAACACGAGACGCTGTCGTGGGAGGAGAAGCCTTTCACAGGTTATGGCACTATGGTTGTTCTGCGGCTGCCCAGCCTTCTGCCCTCGGGAGCCAGGATTCGGGTGATCATCGATTACGAGGCTGCAGACAGCCCAGGGGTTTGTTGGTTGGACCCACAACAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCAGTTCTTAACCGCTCCTTCTTCCCATGCTTTGATAGCCCTGCTGTTAAATGCACCTATTCTGCCAATATCAAGGTACCTGAGGGTTTTACAGCTGTTATGAGTGCAAATAACTCAGACCGCCAAGGTGATACTTTTATCTTCAAAATGACACAACCCATTCCAGCATATCTGGTAGCTCTGGTGGTTGGTGACATTGTATCCGCCGAGGTAGGGCCAAGGAGCCGTGTCTGGGCTGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTGATCGAGGACTTCCTAAAAGTGGGGGAGAAGCTATTTGGTCCTTATGTATGGGGGAAGTATGATGTACTGTTC
  5   1   2       bld Tbd7      out                        XL054l10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                TGCCCAGCCTTCTGCCCTCGGGAGCCAGGATTCGGGTGATCATCGATTACGAGGCTGCAGACAGCCCAGGGGTTTGTTGGTTGGACCCACAACAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCAGTTCTTAACCGCTCCTTCTTCCCATGCTTTGATAGCCCTGCTGTTAAATGCACCTATTCTGCCAATATCAAGGTACCTGAGGGTTTTACAGCTGTTATGAGTGCAAATAACTCAGACCGCCAAGGTGATACTTTTATCTTCAAAATGACACAACCCATTCCAGCATATCTGGTAGCTCTGGTGGTTGGTGACATTGTATCCGCCGAGGTAGGGCCAAGGAGCCGTGTCTGGGCTGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTGATCGAGGACTTCCTAAAAGTGGGGGAGAAGCTATTTGGTCCTTATGTATGGGGAAGGTATGATGTACTGTTC
  5   1   2       bld FaBN      in                    IMAGE:8074758.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTAACCGCTCCTTCTTCCCATGCTTTGATAGCCCTGCTGTTAAATGCACCTATTCTGCCAATATCAAGGTACCTGAGGGTTTTACAGCTGTTATGAGTGCAAATAACTCAGACCGCCAAGGTGATACTTTTATCTTCAAAATGACACAACCCATTCCAGCATATCTGGTAGCTCTGGTGGTTGGTGACATTGTATCCGCCGAGGTAGGGCCAAGGAGCCGTGTCTGGGCTGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTGATCGAGGACTTCCTAAAAGTGGGGGAGAAGCTATTTGGTCCTTATGTATGGGGAAGGTATGATGTACTGTTCATGCCACCATCTTTCCCATTTGGTGGAATGGAAAACCCCTGCATCACATTTGTCACCCCATGTCTGCTGGCTGGCGATCGCTCATTGGCTGATGTTATCATACATGAGATTTCACACAGCTGGTTCGGGAACCTGGTCACCAATGCCAACTGGGGAGAATTTTGGCTGAATGAGGGCTTCACAATGTATGCCCAACGTAGAATTACAACTGAATTATATGGTCCTGCGTACACTTGTCTGGAAGCAGCTGCTGGAAGAGCCCTGCTACGGCAGCACATGGACACTTCTGGGGAAGACCATCCTTTGACAAATTGCGAGTAAAGATAGAGCCTGGGGTGGATCAGATGATACGTATAATGAGACTCCCTACGAAAAAGGATCTGCTTTGTTTCATACTAGCCCACTCACGG
  5   1   2       bld FaBN                            IMAGE:8078150.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGCACCTATTCTGCCATATCAAGGTACCTGAGGGTTTTACAGCTGTTATGAGTGCAAATAACTCAGACCGCCAAGGTGATACTTTTATCTTCAAAATGACACAACCCATTCCAGCATATCTGGTAGCTCTGGTGGTTGGTGACATTGTATCCGCCGAGGTAGGGCCAAGGAGCCGTGTCTGGGCTGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTGATCGAGGACTTCCTAAAAGTGGGGGAGAAGCTATTTGGTCCTTATGTATGGGGAAGGTATGATGTACTGTTCATGCCACCATCTTTCCCATTTGGTGGAATGGAAAACCCCTGCATCACATTTGTCACCCCATGTCTGCTGGCTGGCGATCGCTCATTGGCTGATGTTATCATACATGAGATTTCACACAGCTGGTTCGGGAACCTGGTCACCAATGCCAACTGGGGAGAATTTTGGCTGAATGAGGGCTTCACAATGTATGCCCAACGTAGAATTACAACTGAATTATATGGTCCTGCGTACACTTGTCTGGAAGCAGCTGCTGGAAAAGCCCTGCTACGGCAACACATGGACACTTCTGGGAAGACCATCCTTGAAACAATTGCTAGTAAGATAAAGCCTGGGGTGGATCCAGATGATACTTAAATGAGACTCCTACGAAAAAGATTCTGCTTGTTTATACCTAACCACCTCCCTGGGACCAACAAAATTTAGACTTTTAAAGGCTTATGAAATAATTAATTCCAACATTCTGGTGAAAACCCTGA
  5   1   2       bld Skin                            IMAGE:8642496.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GNGGGCGCTCGATAGAATTCGTCCGGCCGCCGAGGTAGGGCCAAGGAGCCGTGTCTGGGCTGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTGATCGAGGACTTCCTAAAAGTGGGGGAGAAGCTATTTGGTCCTTATGTATGGGGAAGGTATGATGTACTGTTCATGCCACCATCTTTCCCATTTGGTGGAATGGAAAACCCCTGCATCACATTTGTCACCCCATGTCTGCTGGCTGGCGATCGCTCATTGGCTGATGTTATCATACATGAGATTTCACACAGCTGGTTCGGGAACCTGGTCACCAATGCCAACTGGGGAGAATTTTGGCTGAATGAGGGCTTCACAATGTATGCCCAACGTAGAATTACAACTGAATTATATGGTCCTGCGTACACTTGTCTGGAAGCAGCTGCTGGAAGAGCCCTGCTACGGCAGCACATGGACACTTCTGGGGAAGACCATCCTTTGAACAAATTGCGAGTAAAGATAGAGCCTGGGGTGGATCCAGATGATACGTATAATGAGACTCCCTACGAAAAAGGATTCTGCTTTGTTTCATACCTAGCCCACCTCACTGGGGACCAGACAAAATTTGATGACTTTTTAAAGGCTATGTAAATAAGTTCAATTCCAGAGCATTCTTGCTGATGAAGCCTTGAGTTTATCTAGAATTTTTCAGAACTGAAGCACGGGAGTGGATAGATAGCTGTCTGGATTGACCATTGTAACCTCCAGATGGCTCCTTCTCAGACTGTCCCGAGAGCCTATGAACGCGCGACTACAACTCGTCTCCCCCTGAACGACGATCAATCATCCC
  5   1   2       bld Int2                            IMAGE:8526950.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAANNCCATACTTCGNNGNAATACATCGATAGAATTCGTCCCCATCCATCTAGTTCAGAAATTTGTACAAAACCAAGTTGCTTAGTTTAGGAGTTATTTAGAGGAATGTGTTGATTCTCCAGGTATGATGTACTGTTCATGCCACCTTCTTTCCCATTCGGTGGAATGGAAAACCCCTGCATCACATTTGTCACCCCATGTCTGCTGGCTGGGGATCGCTCATTGGCTGATGTTATCATACACGAGATTTCACACAGCTGGTTCGGGAACCTGGTCACCAATGCCAATTGGGGAGAATTTTGGCTGAATGAGGGCTTCACAATGTATGCCCAACGAAGAATTACAACTGAAATATATGGACTTGCGTTTACCTGTCTGGAAGCAGCTACTGGAAGAGCTCTGCTACGACAGCACATGGATGCTTCCGGGGAAGACCATCCTTTGAACAAATTGAGAGTAAAGATAGAGCCTGGTGTGTATTTTGTTAATACGCATGCATACATAACATAAAATGTTGCATAGTGACATGttctttctcttttttcttttGGCAGGGGTGGATCCAGATGATACTTATAATGAGACTCCCTACGAGAAAGGGTTCTGCTTTGTTTCATACCTAGCCCACCTCACTGGGGACCAGACCAAATTTGATAAATTTTTAAAGGCCTATGTAAATAAATTCAAGTTTCAGAGCATACTTGCAGATGAAGCCCTTGAGTTTTATCTAGAGTATTTTCCAGAACTGAAAGCACAGGGAGTGGATAAA
  5   1   2       bld Tbd7      out                        XL091f10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGCCGTGTCTGGGCTGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTGATCGAGGACTTCCTAAAAGTGGGGGAGAAGCTATTTGGTCCTTATGTATGGGGAAGGTATGATGTACTGTTCATGCCACCATCTTTCCCATTTGGTGGAATGGAAAACCCCTGCATCACATTTGTCACCCCATGTCTGCTGGCTGGCGATCGCTCATTGGCTGATGTTATCATACATGAGATTTCACACAGCTGGTTCGGGAACCTGGTCACCAATGCCAACTGGGGAGAATTTTGGCTGAATGAGGGCTTCACAATGTATGCCCAACGTAGAATTACAACTGAATTATATGGTCCTGCGTACACTTGTCTGGAAGCAGCTGCTGGAAGAGCCCTGCTACGGCAGCACATGGACACTTCTGGGGAAGACCATCCTTTGAACAAATTGCGAGTAAAGATAGAGCCTGGGGTGGATCCAGATGATACGTATAATGAGACTCCCTACGAAAAAGGATTCTGCTTTGTTTCATACCTAGCCCACCTCACTGGGGACCAGACAAAATTTGATGACTTTTTAAAGGCCTATGTAAATAAGTTCA
  5   1   2       e50                            Xl3.1-IMAGE:7976273.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCTTTGTTTCATACCTAGCCCACCTCACTGGGGACCAGACAAAATTTGATGACTTTTTAAAGGCCTATGTAAATAAGTTCAAATTCCAAAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCACGGGGAGTGGATAAGATAGCTGGTCTGGAATTTGACCATTGGTTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCGGCAGAACTAGCAAACCTCTGGTCTTCTACACCACTTGATACTGAAACGATTTCAAAAGTCGATCCCACCAAATGGAGAACCTATCAACTTGTTTACTTTTTGGATAGGGTACTGGAATTGTCACCATTACCTAATGGAAATATTGAACAACTGGAAAAGTTTTATCCAAAGATTTCCAATGCCACAAATGCTGAGCTGCGCATGCGCTGGGCCCAGATTGTGTTGAGGAATGACTACCAGCCCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAACAGAAGTATACTTTACCTTTGTATCGTACCATGCAAGCTGGCTCAGAGGCAGCGCAGGCCCTTGCTAGGGAGACCTTTATCCAAACTTGCCCACAGCTTCATGCCAATGTTCAGAACTACGTGAAGAGGATCCTAGGCACATAGAGCCACACTTCTGCTATTGAAGCTCAACT
                                                  Xl3.1-CHK-1012700756                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTTTCATACCTAGCCCACCTCACTGGGGACCAGACAAAATTTGATGACTTTTTAAAGGCCTATGTAAATAAGTTCAAATTCCAAAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCACGGGGAGTGGATAAGATAGCTGGTCTGGAATTTGACCATTGGTTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCGGCAGAACTAGCAAACCTCTGGTCTTCTACACCACTTGATACTGAAACGATTTCAAAAGTCGATCCCACCAAATGGAGAACCTATCAACTTGTTTACTTTTTGGATAGGGTACTGGAATTGTCACCATTACCTAATGGAAATATTGAACAACTGGAAAAGTTTTATCCAAAGATTTCCAATGCCACAAATGCTGAGCTGCGCATGCGCTGGGCCCAGATTGTGTTGAGGAATGACTACCAGCCCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAACAGAAGTATACTTTACCTTTGTATCGTACCATGCAAGCTGGCTCAGAGGCAGCGCAGGCCCTTGCTAGGGAGACCTTTATCCAAACTTGCCCACAGCTTCATGCCAATGTTCAGAACTACGTGAAGAGGATCCTAGGCACATAGAGCCACACTTCTGCTATTGAAGCTCAACTAAAGAT
  3   1   2      seed Emb9      in                    IMAGE:7976273.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCTGAAAGACAGGCTGCTGGAAGAGTCTTGCTACCGCAGCACATGACACTTCTGGGAGACATCTTGAACAAATGCGAGTAAAGATAGAGCTGGGGTGGATCCAGATGATACGTATAATGAGACTCCCTACGAAAAAGGATTCTGCTTTGTTTCATACCTAGCCCACTCACTGGGGACCAGACAAAATTTGATGACTTTTTAAAGGCCTATGTAAATAAGTTCAAATTCCAAAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCACGGGGAGTGGATAAGATAGCTGGTCTGGAATTTGACCATTGGTTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCGGCAGAACTAGCAAACCTCTGGTCTTCTACACCACTTGATACTGAAACGATTTCAAAAGTCGATCCCACCAAATGGAGAACCTATCAACTTGTTTACTTTTTGGATAGGGTACTGGAATTGTCACCATTACCTAATGGAAATATTGAACAACTGGAAAAGTTTTATCCAAAGATTTCCAATGCCACAAATGCTGAGCTGCGCATGCGCTGGGCCCAGATTGTGTTGAGGAATGACTACCAGCCCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAACAGAAGTATACTTTACCTTTGTATCGTACCATGCAAGCTGGCTCAGAGGCAGCGCAGGCCCTTGCTAGGGAGACCTTTATCCAAACTTGCCCACAGCTTCATGCCAATGTTCAGAACTACGTGAAGAGGATCCTAGGCACATAGAGCCACACTTCTGCTATTGAAGCTCAACTTAAAGTGGACATGTCACCTAGACACAAAAAGCTTTATAAAAAAAGTTCCC
  5   1   2       bld Skin                            IMAGE:8643166.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGATACGTATAATGAGACTCCCTACGAAAAAGGATTCTGCTTTGTTTCATACCTAGCCCACCTCACTGGGGACCAGACAAAATTTGATGACTTTTTAAAGGCCTATGTAAATAAGTTCAAATTCCAAAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCACGGGGAGTGGATAAGATAGCTGGTCTGGAATTTGACCATTGGTTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCGGCAGAACTAGCAAACCTCTGGTCTTCTACACCACTTGATACTGAAACGATTTCAAAAGTCGATCCCACCAAATGGAGAACCTATCAACTTGTTTACTTTTTGGATAGGGTACTGGAATTGTCACCATTACCTAATGGAAATATTGAACAACTGGAAAAGTTTTATCCAAAGATTTCCAATGCCACAAATGCTGAGCTGCGCATGCGCTGGGCCCAGATTGTGTTGAGGAATGACTACCAGCCCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAACAGAAGTATACTTTACCTTTGTATCGTACCATGCAAGCTGGCTCAGAGGCAGCGCAGGCCCTTGCTAGGGAGACCTTTATCCAACTTGCCCACAGCTTCATGCCAATGTTCAGAACTACGTGAAGAGGATCCTAG
  3   1   2       bld FaB  5g3  in                    IMAGE:8070907.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTGATCAGTGATAGTATATGGACTCCNTCGAAAAAGATTCTGCTTGTTCATACCTAGCCACCTCACTGGGACCAGACAAAATTGATGACTTTTAAAGGCCTATGTAAATAAGTCAAATTCCAAAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCACGGGGAGTGGATAAGATAGCTGGTCTGGAATTTGACCATTGGTTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCGGCAGAACTAGCAAACCTCTGGTCTTCTACACCACTTGATACTGAAACGATTTCAAAAGTCGATCCCACCAAATGGAGAACCTATCAACTTGTTTACTTTTTGGATAGGGTACTGGAATTGTCACCATTACCTAATGGAAATATTGAACAACTGGAAAAGTTTTATCCAAAGATTTCCAATGCCACAAATGCTGAGCTGCGCATGCGCTGGGCCCAGATTGTGTTGAGGAATGACTACCAGCCCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAACAGAAGTATACTTTACCTTTGTATCGTACCATGCAAGCTGGCTCAGAGGCAGCGCAGGCCCTTGCTAGGGAGACCTTTATCCAAACTTGCCCACAGCTTCATGCCAATGTTCAGAACTACGTGAAGAGGATCCTAGGCACATAGAGCCACACTTCTGCTATGAAGCTCAACTAAAAGGGACA
  3   1   2       bld Skin      in                    IMAGE:8640246.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGTCTTTTGCAGATCCATCGATCGATTCGTCCCTTGTTTCATACTAGCCACCTCACTGGGACCAGACAAAATTGATGACTTTTAAAGGCCTATGTAATAAGTCAAATTCCAAAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCACGGGGAGTGGATAAGATAGCTGGTCTGGAATTTGACCATTGGTTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCGGCAGAACTAGCAAACCTCTGGTCTTCTACACCACTTGATACTGAAACGATTTCAAAAGTCGATCCCACCAAATGGAGAACCTATCAACTTGTTTACTTTTTGGATAGGGTACTGGAATTGTCACCATTACCTAATGGAAATATTGAACAACTGGAAAAGTTTTATCCAAAGATTTCCAATGCCACAAATGCTGAGCTGCGCATGCGCTGGGCCCAGATTGTGTTGAGGAATGACTACCAGCCCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAACAGAAGTATACTTTACCTTTGTATCGTACCATGCAAGCTGGCTCAGAGGCAGCGCAGGCCCTTGCTAGGGAGACCTTTATCCAAACTTGCCCACAGCTTCATGCCAATGTTCAGAACTACGTGAAGAGGATCCTAGGCACATAGAGCCACACTTCTGCTATTGAAGCTCAACTTAAGTGGACAGTCACCTGACACAAAAAGCGGANNCCCCAAAANNNNNNNTTTCGG
  3   1   2       bld FaBN      in                    IMAGE:8074758.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TACGAAAAGGATTCTGCTTTGTTTCATACCTAGCCCACTNCACTGGGGACCAGACAAAATTTGATGACTTTTAAAGGGCCTATGTAAATAAGTTCAAATTCCAAAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCACGGGGAGTGGATAAGATAGCTGGTCTGGAATTTGACCATTGGTTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCGGCAGAACTAGCAAACCTCTGGTCTTCTACACCACTTGATACTGAAACGATTTCAAAAGTCGATCCCACCAAATGGAGAACCTATCAACTTGTTTACTTTTTGGATAGGGTACTGGAATTGTCACCATTACCTAATGGAAATATTGAACAACTGGAAAAGTTTTATCCAAAGATTTCCAATGCCACAAATGCTGAGCTGCGCATGCGCTGGGCCCAGATTGTGTTGAGGAATGACTACCAGCCCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAACAGAAGTATACTTTACCTTTGTATCGTACCATGCAAGCTGGCTCAGAGGCAGCGCAGGCCCTTGCTAGGGAGACCTTTATCCAAACTTGCCCACAGCTTCATGCCAATGTTCAGAACTACGTGAAGAGGATCCTAGGCACATAGAGCCACACTTCTGCTATGAAGCTCAACTTAAAGTGGACAGTCACCAGCNAC
  5   1   2       bld Skin      in                    IMAGE:8640246.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTTGTTTCATACCTAGCCCACCTCACTGGGGACCAGACAAAATTTGATGACTTTTTAAAGGCCTATGTAAATAAGTTCAAATTCCAAAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCACGGGGAGTGGATAAGATAGCTGGTCTGGAATTTGACCATTGGTTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCGGCAGAACTAGCAAACCTCTGGTCTTCTACACCACTTGATACTGAAACGATTTCAAAAGTCGATCCCACCAAATGGAGAACCTATCAACTTGTTTACTTTTTGGATAGGGTACTGGAATTGTCACCATTACCTAATGGAAATATTGAACAACTGGAAAAGTTTTATCCAAAGATTTCCAATGCCACAAATGCTGAGCTGCGCATGCGCTGGGCCCAGATTGTGTTGAGGAATGACTACCAGCCCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAACAGAAGTATACTTTACCTTTGTATCGTACCATGCAAGCTGGCTCAGAGGCAGCGCAGGCCCTTGCTAGGGAGACCTTTATCCAAACTTGCCCACAGCTTCATGCCATGTTCAGAACTACGTGAGAGGATCTAGGCACTAGAGCACACTCTGCTATGAGCTCACTTAAGTGACTGTCACTAGACCAAAGCTGTATATAAAGTCTTTGCATANNAAnnnnnnnnnnnnnnnnnnnnnnaaaaaaaaaaGCGCGCAGCTGATCTGACGGCCGCTCGCTATGAGCATCAACGACGAGACTGTGTG
  3   1   2       bld Tbd3                            IMAGE:3550122.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGGTACTGGAATTGTCACCATTACCTAATGGAAATATTGAACAACTGGAAAAGTTTTATCCAAAGATTTCCAATGCCACAAATGCTGAGCTGCGCATGCGCTGGGCCCAGATTGTGTTGAGGAATGACTACCAGCCCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAACAGAAGTATACTTTACCTTTGTATCGTACCATGCAAGCTGGCTCAGAGGCAGCGCAGGCCCTTGCTAGGGAGACCTTTATCCAAACTTGCCCACAGCTTCATGCCAATGTTCAGAACTACGTGAAGAGGATCCTAGGCACATAGAGCCACACTNCTGCTATTGAAGCTCAACTAAAGATGGACATGTCACCTAGGCACAAAAAGCTGTATAATAAAAGTAAATTGCAATT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)