Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6317824.5                      16 END     7          28       43                (no blast hit)
     2   2.0    0Xl3.1-IMAGE:8328294.5                      12 END     1           4        8                (no blast hit)
     3   2.0    0Xl3.1-xlk150i09ex.3                         4 END     1           4       25                PREDICTED: similar to ankyrin 2,3/unc44 [Strongylocentrotus purpuratus]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     4   0.0    0Xl3.1-xl227h11.3.5                         15 PI      88         73     1306                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012838140 Xl3.1-XL412m12ex.5.5 - 25 ESTs
                                                                       .......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xl3.1-XL412m12ex.5.5                                                                                                                                                                                                                                                                                                                                                  GACTGTCTCTCCATATGGAACACCACATTCCAGACATTGCAGACTGCTTGTAACTTCCCACAGAAGACAAGCGCACAGCTATGGTGCAGTGACAATAAACTATATGTGCCCCATGGGAAGGCCCTGGTAGTGGTTCCATATATTTGTGAAGTGTCCTGCTTGGCATCTGTTCTGGGAAAAAGCAGAAATATCGAGACATCAGAAAATGTTCCTTTTGTTAATTGGGGCAAACTTGTAGGAAAGAACCTGGAAGTCAAACAGTCAAATTCTGGTGCTCGGAAAAAAACCAGGGATATAAAAACAAATGGAAATCCAGGAAACGGCACAGAATGCACATTGTACCCCTTGGATGTTCAGAATATGTCTCAAGCACAGACTGAAGTTCTTGTGCAGCAACTACTCCTGGGCAAAGAAGACACAGATTTTCAGGTCACTGTTGGCAAAATAACCCAGAGTTTGGTAAAGCATTGTATGGCTGATCCCAAGTACTACCCACAGAGTTCTCTTGTGCAGCTTGTTCAGACAAAAACACTGTCCTACAGTCTGTGTCCTGAATTATTGTCACTCTGTCTGGAGAAGAGGGATGTGCACCTACTTCAGCTCTGCTTGCATTCTTTCCCTGATGTCCCAGAAGCTGTTCTCTGCTCATGCCTTAAGGCCTTTTTAAGTATCAGTGAGAAATGGTTGAATGCTGCACAAATTGACACGGAGTCAGTCACCTTATATATTGATGTGAGAGATAAGGCCAAAGGACACTATATGGAGCACCAAGAAGAACCGACTGTGGTACAGAATGGCTTTAGCCCAACTGCTCTGGACGAAGACAGCTGTGGTGAACTTATAGCAGAGAGTTTGCCACAAACCGTTCAAATGGCAACTTGCCCAATGAGCAATAAAAGAGCTGTACTAGTAAACTCCGTTCTGATGTCTCCTTACAGTGAGAGCTTTCTTCTGCCACATCTCAAGGATATGTCAGGTGACCAAGTGATGTTTTTTCTCAGGTATTTGCAGTACTTGTATCAGATATGCAATGAAAATATAACAGTAAGCCTTCCAGGAAAGCAAGTACCCACAGTCAGCCAGATCATGGACTGGATGAACCTGTTATTGGATGCACATTTTGCCACTGTGGTGATGCTGTCAGAGGCCAAGTCACTGCTTAATAAAATTCAAAAGACTGTGAAAAGCCAGCTGAAGTTTTATTCAGAACTGAACAAGATCGAGGGCTGTTTAGCAGAGCTGAAAGAACTGAAGTGCCCGGCAAGTGTCTCCGCCAGATATTCTATAGAAGTTCTCAAACTCTACTAATAACATGGACAGCTCTGTACAGATTTGTTTTTATTTCTTTGTAAGAAACTGAAATATATTTCCTACTATTTTCGCATATCTTTCCATTTCCAACTACTCTGTTATTGCTTTCAGTTGCCCTGATTCGGTGGCCTTCCTGCAGCACACATGTAAATGTCACCATGAACTCCTGTCCGGCTCTTTGTGTCATGTTCACTTGATAAAGAGTTATTTGCTGCACATGTGTTTTTGTGTTGTACTGGTTGAAGTCATAGCAAGAATCCTAGTTATAAAGCCTTTATTGGTATCTCATGGCTCAGATCTCTGACAACAAATACGTCTCAGGGCCAAACACACCTTTTTTCAAGTTACTCATATACACATAGTCATGCAACTTTATACGTTTACAGCTCCACCTACAGGCATATCCAAAACCAGTTCGAAATGAAAAAA
                                                  Xl3.1-CHK-1012722839                                                                                                                                                                                                                                                                                                                                                        CTCTCCATATGGAACACCACATTCCAGACATTGCAGACTGCTTGTAACTTCCCACAGAAGACAAGCGCACAGCTATGGTGCAGTGACAATAAACTATATGTGCCCCATGGGAAGGCCCTGGTAGTGGTTCCATATATTTGTGAAGTGTCCTGCTTGGCATCTGTTCTGGGAAAAAGCAGAAATATCGAGACATCAGAAAATGTTCCTTTTGTTAATTGGGGCAAACTTGTAGGAAAGAACCTGGAAGTCAAACAGTCAAATTCTGGTGCTCGGAAAAAAACCAGGGATATAAAAACAAATGGAAATCCAGGAAACGGCACAGAATGCACATTGTACCCCTTGGATGTTCAGAATATGTCTCAAGCACAGACTGAAGTTCTTGTGCAGCAACTACTCCTGGGCAAAGAAGACACAGATTTTCAGGTCACTGTTGGCAAAATAACCCAGAGTTTGGTAAAGCATTGTATGGCTGATCCCAAGTACTACCCACAGAGTTCTCTTGTGCAGCTTGTTCAGACAAAAACACTGTCCTACAGTCTGTGTCCTGAATTATTGTCACTCTGTCTGGAGAAGAGGGATGTGCACCTACTTCAGCTCTGCTTGCATTCTTTCCCTGATGTCCCAGAAGCTGTTCTCTGCTCATGCCTTAAGGCCTTTTTAAGTATCAGTGAGAAATGGTTGAATGCTGCACAAATTGACACGGAGTCAGTCACCTTATATATTGATGTGAGAGATAAGGCCAAAxxxxAxTATATGGAGCACCAAGAAGAACCGACTGTGGTACAGAATGGCTTTAGCCCAACTGCTCTGGACGAAGACAGCTGTGGTGAACTTATAGCAGAGAGTTTGCCACAAACCGTTCAAATGGCAACTTGCCCAATGAGCAATAAAAGAGCTGTACTAGTAAACTCCGTTCTGATGTCTCCTTACAGTGAGAGCTTTCTTCTGCCACATCTCAAGGATATGTCAGGTGACCAAGTGATGTTTTTTCTCAGGTATTTGCAGTACTTGTATCAGATATGCAATGAAAATATAACAGTAAGCCTTCCAGGAAAGCAAGTACCCACAGTCAGCCAGATCATGGACTGGATGAACCTGTTATTGGATGCACATTTTGCCACTGTGGTGATGCTGTCAGAGGCCAAGTCACTGCTTAATAAAATTCAAAAGACTGTGAAAAGCCAGCTGAAGTTTTATTCAGAACTGAACAAGATCGAGGGCTGTTTAGCAGAGCTGAAAGAACTGAAGTGCCCGGCAAGTGTCTCCGCCAGATATTCTATAGAAGTTCTCAAACTCTACTAATAACATGGACAGCTCTGTACAGATTTGTTTTTATTTCTTTGTAAGAAACTGAAATATATTTCCTACTATTTTCGCATATCTTTCCATTTCCAACTACTCTGTTATTGCTTTCAGTTGCCCTGATTCGGTGGCCTTCCTGCAGCACACATGTAAATGTCACCATGAACTCCTGTCCGGCTCTTTGTGTCATGTTCACTTGATAAAGAGTTATTTGCTGCACATGTGTTTTTGTGTTGTACTGGTTGAAGTCATAGCAAGAATCCTAGTTATAAAGCCTTTATTGGTATCTCATGGCTCAGATCTCTGACAACAAATACGTCTCAGGGCCAAACACACCTTTTTTCAAGTTACTCATATACACATAGTCATGCAACTTTATACGTTTACAGCTCCACCTACAGGCATATCCAAAACCAGTTCGAAATGAAAAAAAAAAGA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                       2     2     2     3     2     3     3     3     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     5     6     5     6     5     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     5     6     5     6     5     6     5     6     5     6     5     5     4     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     5     4     5     5     5     4     5     3     5     3     5     3     5     3     5     3     5     3     6     2     7     2     7     2     6     3     7     3     7     3     7     3     7     4     7     4     7     4     7     4     7     5     8     5     8     5     9     5     9     5     9     5     9     5     9     5    10     7    11     7    11     8    13    10    14    10    14    10    14    10    14     9    14    10    14     9    14    10    14    10    13    11    15    12    16    12    16    13    16    13    16    14    16    13    15    12    15    12    15    12    15    12    15    13    16    13    16    12    16    14    16    14    16    14    16    14    16    14    16    14    16    14    16    14    16    13    16    13    16    13    16    13    16    13    16    11    16    13    16    12    16    10    16    10    15     7    10     7     9     7     9     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     9     6     7     5     5     3     3     2     2
  5   1   2      ests                              Xl3.1-xlk166e24ex.5                                                                                                                                                                                                                                                                                                                                                  GACTGTCTCTCCATATGGAACACCACATTCCAGACATTGCAGACTGCTTGTAACTTCCCACAGAAGACAAGCGCACAGCTATGGTGCAGTGACAATAAACTATATGTGCCCCATGGGAAGGCCCTGGTAGTGGTTCCATATATTTGTGAAGTGTCCTGCTTGGCATCTGTTCTGGGAAAAAGCAGAAATATCGAGACATCAGAAAATGTTCCTTTTGTTAATTGGGGCAAACTTGTAGGAAAGAACCTGGAAGTCAAACAGTCAAATTCTGGTGCTCGGAAAAAAACCAGGGATATAAAAACAAATGGAAATCCAGGAAACGGCACAGAATGCACATTGTACCCCTTGGATGTTCAGAATATGTCTCAAGCACAGACTGAAGTTCTTGTGCAGCAACTACTCCTGGGCAAAGAAGACACAGATTTTCAGGTCACTGTTGGCAAAATAACCCAGAGTTTGGTAAAGCATTGTATGGCTGATCCCAAGTACTACCCACAGAGTTCTCTTGTGCAGCTTGTTCAGACAAAAACACTGTCCTACAGTCTGTGTCCTGAATTATTGTCACTCTGTCTGGAGAAGAGGGATGTGCACCTACTTCAGCTCTGCTTGCATTCTTTCCCTGATGTCCCAGAAGCTGTTCTCTGCTCATGCCTTAAGGCCTTTTTAAGTATCAGTGAGAAATGGTTGAATGCTGCACAAATTGACACGGAGTCAGTCACCTTATATATTGATGTGAGAGATAAGGCCAAAGGACAC
  5   1   2      ests                               Xl3.1-XL412m12ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACAAATATATGGAGCACCAAGAAGAACCGACTGTGGTACAGAATGGCTTTAGCCCAACTGCTCTGGACGAAGACAGCTGTGGTGAACTTATAGCAGAGAGTTTGCCACAAACCGTTCAAATGGCAACTTGCCCAATGAGCAATAAAAGAGCTGTACTAGTAAACTCCGTTCTGATGTCTCCTTACAGTGAGAGCTTTCTTCTGCCACATCTCAAGGATATGTCAGGTGACCAAGTGATGTTTTTTCTCAGGTATTTGCAGTACTTGTATCAGATATGCAATGAAAATATAACAGTAAGCCTTCCAGGAAAGCAAGTACCCACAGTCAGCCAGATCATGGACTGGATGAACCTGTTATTGGATGCACATTTTGCCACTGTGGTGATGCTGTCAGAGGCCAAGTCACTGCTTAATAAAATTCAAAAGACTGTGAAAAGCCAGCTGAAGTTTTATTCAGAACTGAACAAGATCGAGGGCTGTTTAGCAGAGCTGAAAGAACTGAAGTGCCCGGCAAGTGTCTCCGCCAGATATTCTATAGAAGTTCTCAAACTCTACTAATAACATGGACAGCTCTGTACAGATTTGTTTTTATTTCTTTGTAAGAAACTGAAATATATTTCCTACTATTTTCGCATATCTTTCCATTTCCAACTACTCTGTTATTGCTTTCAGTTGCCCTGATTCGGTGGCCTTCCTGCAGCACACATGTAAATGTCACCATGAACTCCTGTCCGGCTCTTTGTGTCATGTTCACTTGATAAAGAGTTATTTGCTGCACATGTGTTTTTGTGTTGTACTGGTTGAAGTCATAGCAAGAATCCTAGTTATAAAGCCTTTATTGGTATCTCATGGCTCAGATCTCTGACAACAAATACGTCTCAGGGCCAAACACACCTTTTTTCAAGTTACTCATATACACATAGTCATGCAACTTTATACGTTTACAGCTCCACCTACAGGCATATCCAAAACCAGTTCGAAATG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------T----
  5   1   2      ests                              Xl3.1-xlk166e24ex.5                                                                                                                                                                                                                                                                                                                                                  GACTGTCTCTCCATATGGAACACCACATTCCAGACATTGCAGACTGCTTGTAACTTCCCACAGAAGACAAGCGCACAGCTATGGTGCAGTGACAATAAACTATATGTGCCCCATGGGAAGGCCCTGGTAGTGGTTCCATATATTTGTGAAGTGTCCTGCTTGGCATCTGTTCTGGGAAAAAGCAGAAATATCGAGACATCAGAAAATGTTCCTTTTGTTAATTGGGGCAAACTTGTAGGAAAGAACCTGGAAGTCAAACAGTCAAATTCTGGTGCTCGGAAAAAAACCAGGGATATAAAAACAAATGGAAATCCAGGAAACGGCACAGAATGCACATTGTACCCCTTGGATGTTCAGAATATGTCTCAAGCACAGACTGAAGTTCTTGTGCAGCAACTACTCCTGGGCAAAGAAGACACAGATTTTCAGGTCACTGTTGGCAAAATAACCCAGAGTTTGGTAAAGCATTGTATGGCTGATCCCAAGTACTACCCACAGAGTTCTCTTGTGCAGCTTGTTCAGACAAAAACACTGTCCTACAGTCTGTGTCCTGAATTATTGTCACTCTGTCTGGAGAAGAGGGATGTGCACCTACTTCAGCTCTGCTTGCATTCTTTCCCTGATGTCCCAGAAGCTGTTCTCTGCTCATGCCTTAAGGCCTTTTTAAGTATCAGTGAGAAATGGTTGAATGCTGCACAAATTGACACGGAGTCAGTCACCTTATATATTGATGTGAGAGATAAGGCCAAAGGACAC
                                                  Xl3.1-CHK-1012699312                                                                                                                                                                                                                                                                                                                                                        CTCTCCATATGGAACACCACATTCCAGACATTGCAGACTGCTTGTAACTTCCCACAGAAGACAAGCGCACAGCTATGGTGCAGTGACAATAAACTATATGTGCCCCATGGGAAGGCCCTGGTAGTGGTTCCATATATTTGTGAAGTGTCCTGCTTGGCATCTGTTCTGGGAAAAAGCAGAAATATCGAGACATCAGAAAATGTTCCTTTTGTTAATTGGGGCAAACTTGTAGGAAAGAACCTGGAAGTCAAACAGTCAAATTCTGGTGCTCGGAAAAAAACCAGGGATATAAAAACAAATGGAAATCCAGGAAACGGCACAGAATGCACATTGTACCCCTTGGATGTTCAGAATATGTCTCAAGCACAGACTGAAGTTCTTGTGCAGCAACTACTCCTGGGCAAAGAAGACACAGATTTTCAGGTCACTGTTGGCAAAATAACCCAGAGTTTGGTAAAGCATTGTATGGCTGATCCCAAGTACTACCCACAGAGTTCTCTTGTGCAGCTTGTTCAGACAAAAACACTGTCCTACAGTCTGTGTCCTGAATTATTGTCACTCTGTCTGGAGAAGAGGGATGTGCACCTACTTCAGCTCTGCTTGCATTCTTTCCCTGATGTCCCAGAAGCTGTTCTCTGCTCATGCCTTAAGGCCTTTTTAAGTATCAGTGAGAAATGGTTGAATGCTGCACAAATTGACACGGAGTCAGTCACCTTATATATTGATGTGAGAGATAAGGCCAAA
  5   1   2       bld Emb4                            IMAGE:5514591.5p CAGGCAGGAGTTGTGGTTCTGCACATTTTGGGACCCAGGGTTAAGAAATAGAGATTTAAGAACACATGTCAGGAGATATGCTGGTCTAAAAATGGCTTTGTGCTGCCCTTTAGAGTGCAATTTTCTAGAGACTGTCATAATTCAGAGTATTACTAGTATTACAAGTATTAAGTCATATATTGTGTCACCAGTCATCGCCTCATAGTTTTATCATAACATTATATTTCTCTGTGCAATTTTTATACATTTGGGAATGGTAGAGCATGTGGGGTAAAGTCCGTGGGTATAACGCAGTGTAAGACCATGCCTTTTTACTGTGATGACGCTGTTCTTTGCAGACTGTCTCTCCATATGGAACACCACATTCCAGACATTGCAGACTGCTTGTAACTTCCCACAGAAGACAAGCGCACAGCTATGGTGCAGTGACAATAAACTATATGTGCCCCATGGGAAGGCCCTGGTAGTGGTTCCATATATTTGTGAAGTGTCCTGCTTGGCATCTGTTCTGGGAAAAAGCAGAAATATCGAGACATCAGAAAATGTTCCTTTTGTTAATTGGGGCAAACTTGTAGGAAAGAACCTGGAAGTCAAACAGTCAAATTCTGGTGCTCGGAAAAAAACCAGGGATATAAAAACAAATGGAAATCCAGGAAACGGCACAGAATGCACATTGTACCCCTTGGATGTTCANGTAACGCCAGAGCACACATGCACTTTCTATTTCTTGTGGCTAAAGTTTCTCAGTGGAGATTGGACAGTGGATTTTCTG
  5   1   2       bld Egg1                               PBX0089A12.5p                                                                                                                                                                                                                                                                                                  CACGAGGCCCATGTAGCAGTGCTTATGCAATCTCCATCCACACAAAAAGACTGTCTCTCCATATGGAACACCACATTCCAGACATTGCAGACTGCTTGTAACTTCCCACAGAAGACAAGCGCACAGCTATGGTGCAGTGACAATAAACTATATGTGCCCCATGGGAAGGCCCTGGTAGTGGTTCCATATATTTGTGAAGTGTCCTGCTTGGCATCTGTTCTGGGAAAAAGCAGAAATATCGAGACATCAGAAAATGTTCCTTTTGTTAATTGGGGCAAACTTGTAGGAAAGAACCTGGAAGTCAAACAGTCAAATTCTGGTGCTCGGAAAAAAACCAGGGATATAAAAACAAATGGAAATCCAGGAAACGGCACAGAATGCACATTGTACCCCTTGGATGTTCAGAATATGTCTCAAGCACAGACTGAAGTTCTTGTGCAGCAACTACTCCTGGGCAAAGAAGACACAGATTTTCAGGTCACTGTTGGCAAAATAACCCAGAGTTTGGTAAAGCATTGTATGGCTGATCCCAAGTACTACCCACAGAGTTCTCTTGTGC
  5   1   2      seed Int2                            IMAGE:8527371.5p                                                                                                                                                                                                                                                                                                                                                              GAGATCCATAAATATGATTCGTCCCTGCAGACTGCTTGTAACTTCCCACAGAAGACAAGCGCACAGCTATGGTGCAGTGACAATAAACTATATGTGCCCCATGGGAAGGCCCTGGTAGTGGTTCCATATATTTGTGAAGTGTCCTGCTTGGCATCTGTTCTGGGAAAAAGCAGAAATATCGAGACATCAGAAAATGTTCCTTTTGTTAATTGGGGCAAACTTGTAGGAAAGAACCTGGAAGTCAAACAGTCAAATTCTGGTGCTCGGAAAAAAACCAGGGATATAAAAACAAATGGAAATCCAGGAAACGGCACAGAATGCACATTGTACCCCTTGGATGTTCAGAATATGTCTCAAGCACAGACTGAAGTTCTTGTGCAGCAACTACTCCTGGGCAAAGAAGACACAGATTTTCAGGTCACTGTTGGCAAAATAACCCAGAGTTTGGTAAAGCATTGTATGGCTGATCCCAAGTACTACCCACAGAGTTCTCTTGTGCAGCTTGTTCAGACAAAAACACTGTCCTACAGTCTGTGTCCTGAATTATTGTCACTCTGTCTGGAGAAGAGGGATGTGCACCTACTTCAGCTCTGCTTGCATTCTTTCCCTGATGTCCCAGAAGCCGTTCTCTGCTCATGCCTTAAGGCCTTTTTAAGTATCAGTGAGAAATGGTTGAATGCTGCACAAATTGACACGGAGTCAGTCACCTTATATATTGATGTGAGAGATAAGGCCAAAGGACACAA
  5   1   2       add Ga12      in                         XL171g12.5p                                                                                                                                                                                                                                                                                                                                                                                        GCAGACTGCTTGTAACTTCCCACAGAAGACAAGCGCACAGCTATGGTGCAGTGACAATAAACTATATGTGCCCCATGGGAAGGCCCTGGTAGTGGTTCCATATATTTGTGAAGTGTCCTGCTTGGCATCTGTTCTGGGAAAAAGCAGAAATATCGAGACATCAGAAAATGTTCCTTTTGTTAATTGGGGCAAACTTGTAGGAAAGAACCTGGAAGTCAAACAGTCAAATTCTGGTGCTCGGaaaaaaaaaaaCCAGGGATNTAAAAACAAATGGAAATCCAGGAAACGGCNCANAATGCACATTGTNCCCCTTGGATGTTCANAATATGTCTCAAGCNCANACTGAAGTTNTTGNGCAGCAACTACTCCTGGGCAAANAANACACANATTTTCAGGTCACTGTTGGCAAAATAACCCAAAGTTTGGTAAAGCATTGTNTGGCTGATCCCAAGTNCTACCCACAG
  5   1   2       bld Emb1                            IMAGE:6864209.5p                                                                                                                                                                                                                                                                                                                                                                                                       CCACGCGTCCGAGACAAGCGCACAGCTATGGTGCAGTGACAATAAACTATATGTGCCCCATGGGAAGGCCCTGGTAGTGGTTCCATATATTTGTGAAGTGTCCTGCTTGGCATCTGTTCTGGGAAAAAGCAGAAATATCGAGACATCAGAAAATGTTCCTTTTGTTAATTGGGGCAAACTTGTAGGAAAGAACCTGGAAGTCAAACAGTCAAATTCTGGTGCTCGGAAAAAAACCAGGGATATAAAAACAAATGGAAATCCAGGAAACGGCACAGAATGCACATTGTACCCCTTGGATGTTCAGAATATGTCTCAAGCACAGACTGAAGTTCTTGTGCAGCAACTACTCCTGGGCAAAGAAGACACAGATTTTCAGGTCACTGTTGGCAAAATAACCCAGAGTTTGGTAAAGCATTGTATGGCTGATCCCAAGTACTACCCACAGAGTTCTCTTGTGCAGCTTGTTCAGACAAAAACACTGTCCTACAGTCTGTGTCCTGAATTATTGTCACTCTGTCTGGAGAAGAGGGATGTGCACCTACTTCAGCTCTGCTTGCATTCTTTCCCTGATGTCCCAGAAGCTGTTCTCTGCTCATGCCTTAAGGCCTTTTTAAGTATCAGTGAGAAATGGTTGAATGCTGCACAAATTGACACGGAGTCAGTCACCTTATATATTGATGTGAGAGATAAGGCCAAAGGACACAAATATATGGAGCACCAAAAAGAACCGACTGTGGGTACAGAATGGCTTTAACCCAACTGCTCTGGACCAAAACAGCTTGTGTGAACTTATAGCCGAGAGTTTGCACCAACCGTTCAATGGCAACTGCCCAATGAGCATAAAGACTGTCTAGTAAACTCCTCTGAGGCTCCTACGGGGACTTCTCTGCCCATTCAGAATTCCGGG
  5   1   2       bld Ov1       in                    IMAGE:5074402.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATATCGTCGACCCACGCGTCCGGTGAAGTGTCCTGCTTGGCATCTGTTCTGGGAAAAAGCAGAAATATCGAGACATCAGAAAATGTTCCTTTTGTTAATTGGGGCAAACTTGTAGGAAAGAACCTGGAAGTCAAACAGTCAAATTCTGGTGCTCGGAAAAAAACCAGGGATATAAAAACAAATGGAAATCCAGGAAACGGCACAGAATGCACATTGTACCCCTTGGATGTTCAGAATATGTCTCAAGCACAGACTGAAGTTCTTGTGCAGCAACTACTCCTGGGCAAAGAAGACACAGATTTTCAGGTCACTGTTGGCAAAATAACCCAGAGTTTGGTAAAGCATTGTATGGCTGATCCCAAGTACTACCCACAGAGTTCTCTTGTGCAGCTTGTTCAGACAAAAACACTGTCCTACAGTCTGTGTCCTGAATTATTGTCACTCTGTCTGGAGAAGAGGGATGTGCACCTACTTCAGCTCTGCTTGCATTCTTTCCCTGATGTCCCAGAAGCTGTTCTCTGCTCATGCCTTAAGGCCTTTTTAAGTATCAGTGAGAAATGGTTGAATGCTGCACAAATTGACACGGAGTCAGTCACCTTATATATTGATGTGAGAGAT
  5   1   2       bld Ga18      in                      xlk166e24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCACTGTTGGCAAAATAACCCAGAGTTTGGTAAAGCATTGTATGGCTGATCCCAAGTACTACCCACAGAGTTCTCTTGTGCAGCTTGTTCAGACAAAAACACTGTCCTACAGTCTGTGTCCTGAATTATTGTCACTCTGTCTGGAGAAGAGGGATGTGCACCTACTTCAGCTCTGCTTGCATTCTTTCCCTGATGTCCCAGAAGCCGTTCTCTGCTCATGCCTTAAGNCNTTTTAAGTATCAGTGAGAAATGGTTGAATGCTGCACAAATTGACACNNNTNNGTCACCTTATATATTGATGTGAGAGATAAGGCCAAAGGACACAAATATATGGAGCACCAAGAAGAACCGACTGTGGTACAGAATGGCTTTAGNNAACTGCTCTGGACGAAGACAGCTGTGGTGAACTTATAGCAGAGAGTTTGCCACAAACCGTTCAAATGGCAACTTGCCCAATGAGCAATAAAAGAGCTGTACTAGTAAACTCCGTTCTGATGTCTCCTTACAGTGAGAGCTTTCTNCTGCCACATCTCAAGGATATGTCAGGTGACCAAGTGATGTTTTTTCTCAGGTATTTGCAGTACTTGTATCAGATATGCAATGAAAATATAACAGTNAGCCTNNCAGGAAAGCAAGTACCCACAGNCAGCCAGATCATGGACTGGNTGAACCTGTTATTGGATGCACATTTTGCCACTGTGGTGATGCTGTCAGAGGNCAAGNCACTGCTTNATAAAATTCAAANGACTGTGAAA
  5   1   2      ests                               Xl3.1-XL412m12ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACAAATATATGGAGCACCAAGAAGAACCGACTGTGGTACAGAATGGCTTTAGCCCAACTGCTCTGGACGAAGACAGCTGTGGTGAACTTATAGCAGAGAGTTTGCCACAAACCGTTCAAATGGCAACTTGCCCAATGAGCAATAAAAGAGCTGTACTAGTAAACTCCGTTCTGATGTCTCCTTACAGTGAGAGCTTTCTTCTGCCACATCTCAAGGATATGTCAGGTGACCAAGTGATGTTTTTTCTCAGGTATTTGCAGTACTTGTATCAGATATGCAATGAAAATATAACAGTAAGCCTTCCAGGAAAGCAAGTACCCACAGTCAGCCAGATCATGGACTGGATGAACCTGTTATTGGATGCACATTTTGCCACTGTGGTGATGCTGTCAGAGGCCAAGTCACTGCTTAATAAAATTCAAAAGACTGTGAAAAGCCAGCTGAAGTTTTATTCAGAACTGAACAAGATCGAGGGCTGTTTAGCAGAGCTGAAAGAACTGAAGTGCCCGGCAAGTGTCTCCGCCAGATATTCTATAGAAGTTCTCAAACTCTACTAATAACATGGACAGCTCTGTACAGATTTGTTTTTATTTCTTTGTAAGAAACTGAAATATATTTCCTACTATTTTCGCATATCTTTCCATTTCCAACTACTCTGTTATTGCTTTCAGTTGCCCTGATTCGGTGGCCTTCCTGCAGCACACATGTAAATGTCACCATGAACTCCTGTCCGGCTCTTTGTGTCATGTTCACTTGATAAAGAGTTATTTGCTGCACATGTGTTTTTGTGTTGTACTGGTTGAAGTCATAGCAAGAATCCTAGTTATAAAGCCTTTATTGGTATCTCATGGCTCAGATCTCTGACAACAAATACGTCTCAGGGCCAAACACACCTTTTTTCAAGTTACTCATATACACATAGTCATGCAACTTTATACGTTTACAGCTCCACCTACAGGCATATCCAAAACCAGTTCGAAATG
                                                  Xl3.1-CHK-1012690631                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TATATGGAGCACCAAGAAGAACCGACTGTGGTACAGAATGGCTTTAGCCCAACTGCTCTGGACGAAGACAGCTGTGGTGAACTTATAGCAGAGAGTTTGCCACAAACCGTTCAAATGGCAACTTGCCCAATGAGCAATAAAAGAGCTGTACTAGTAAACTCCGTTCTGATGTCTCCTTACAGTGAGAGCTTTCTTCTGCCACATCTCAAGGATATGTCAGGTGACCAAGTGATGTTTTTTCTCAGGTATTTGCAGTACTTGTATCAGATATGCAATGAAAATATAACAGTAAGCCTTCCAGGAAAGCAAGTACCCACAGTCAGCCAGATCATGGACTGGATGAACCTGTTATTGGATGCACATTTTGCCACTGTGGTGATGCTGTCAGAGGCCAAGTCACTGCTTAATAAAATTCAAAAGACTGTGAAAAGCCAGCTGAAGTTTTATTCAGAACTGAACAAGATCGAGGGCTGTTTAGCAGAGCTGAAAGAACTGAAGTGCCCGGCAAGTGTCTCCGCCAGATATTCTATAGAAGTTCTCAAACTCTACTAATAACATGGACAGCTCTGTACAGATTTGTTTTTATTTCTTTGTAAGAAACTGAAATATATTTCCTACTATTTTCGCATATCTTTCCATTTCCAACTACTCTGTTATTGCTTTCAGTTGCCCTGATTCGGTGGCCTTCCTGCAGCACACATGTAAATGTCACCATGAACTCCTGTCCGGCTCTTTGTGTCATGTTCACTTGATAAAGAGTTATTTGCTGCACATGTGTTTTTGTGTTGTACTGGTTGAAGTCATAGCAAGAATCCTAGTTATAAAGCCTTTATTGGTATCTCATGGCTCAGATCTCTGACAACAAATACGTCTCAGGGCCAAACACACCTTTTTTCAAGTTACTCATATACACATAGTCATGCAACTTTATACGTTTACAGCTCCACCTACAGGCATATCCAAAACCAGTTCGAAATGAAAAAA
  3   1   2       bld Ga18      out                     xlk116k13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCAGCNNTCAGNCAAAAACACTNNCCTACAGTCNNNNNCCTGAATTNTNTCNCTCTGTCTGNGNAGNGGGATGNNNNCCTNCTTNNNNCTGCTTNNATCTTTCCCTGATNNCCCAGAAGCTGNTCTCTGCTCATGCCTTAAGNCCTTTTAAGTATCAGTGAGAAATGGTTGAATGCTGCACAAATTGACACGGAGTCAGTCACCTTATATATTGATGTGAGAGATAAGGCCAAAGGACACAAATATATGGAGCACCAAGAAGANCCGACTGTGGTACAGAATGNCTTTAGNCCAACTGCTCTGGACGAAGACAGCTGTGGTGAACTTATAGCAGAGAGTTTGCCACAAACCGTTCAAATGGCAACTTGCCCAATGAGCAATAAAAGAGCTGTACTAGTNNNNNNGTTCTGATGTCTCCTTACAGTGAGAGCTTTCTTCTGCCACATCTCAAGGATATGTCAGGTGACCAAGTGATGTTTTTTCTCAGGTATTTGCAGTACTTGTATCAGATATGCAATGAAAATATAACAGTAAGCCTTCCAGGAAAGCAAGTACCCACGGTCAGCCAGATCATGGACTGGATGAACCTGTTATTGGATGCACATTTTGCCACTGTGGTGATGCTGTCAGAGGCCAAGTCACTGCTTAATAAAATTCAAAAGACTGTGAAAAGCCAGCTGAAGTTTTATTCAGAACTGAACAAGATCGAGGGCTGTTTAGCAGAGCTGAAAGAACTGAAGTGCCCGGCAANNNNNCCGCCAGATATTCTATAGAAGTTCTCAAACTCTACTAATAACATGGACAGCTCTGTACAGATTTGTTTTTATTTCTTTGTAAGAAACTGAAATATATTTCCTACTATTTTCGCATATCTTTCCATTTCCAACTACTCTGTTATTGCTTTCAGTTGCCCTGATTCGGTGNNCTTCCTGCAGCACACATGTAAATGTCACCATGANCNCCTGTCCGNCTCTTTGTNTCA
  3   1   2       bld DMZ  5g3  out                        xl221i15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACCTTATATATTGATGTGAGAGATAAGGCCAANGGACACAAATATATGGAGCACCAAGAAGAACCGACTGTGGTACAGAATGGCTTTAGCCCAACTGCTCTGGACGAAGACAGCTGTGGTGAACTTATAGCAGAGAGTTTGCCACAAACCGTTCAAATGGCAACTTGCCCAATGAGCAATAAAAGAGCTGTACTAGTAAACTCCGTTCTGATGTCTCCTTACAGTGAGAGCTTTCTTCTGCCACATCTCAAGGATATGTCAGGTGACCAAGTGATGTTTTTTCTCAGGTATTTGCAGTACTTGTATCAGATATGCAATGAAAATATAACAGTAAGCCTTCCAGGAAAGCAAGTACCCACAGTCAGCCAGATCATGGACTGGATGAACCTGTTATTGGATGCACATTTTGCCACTGTGGTGATGCTGTCAGAGGCCAAGTCACTGCTTAATAAAATTCAAAAGACTGTGAAAAGCCAGCTGAAGTTTTATTCAGAACTGAACAAGATCGAGGGCTGTTTAGCAGAGCTGAAAGAACTGAAGTGCCCGGCAAGTGTCTCCGCCAGATATTCTATAGAAGTTCTCAAACTCTACTAATAACATGGACAGCTCTGTACAGATTTGTTTTTATTTCTTTGTAAGAAACTGAAATATATTTCCTACTATTTTCGCATATCTTTCCATTTCCAACTACTCTGTTATTGCTTTCAGTTGCCCTGATTCGTTGGCCTTCCTGCAGCACACCATGTAAATGTCACCATGAAACTCCTGTTCCCGGCTCT
  3   1   2       add Ga18      in                      xlk166e24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTGATNTNAGAGNTAAGGCNAAAGGACACAAATATANGNNNACCAAGANGAACCGACTGTNGTACAGAATGCTTTAGCCCAACTGCTCTGGACGAAGACAGCTGTGGTGAACNNATAGCAGAGANTTTGCCACAAACCGTTCAAATGCAACTTGCCCAATGAGCAATAAAAGAGCTGTACTAGTNNNNCCGTTCTGATGTCTCCTTACAGTGAGAGCTTTCTTCTGCCACATCTCAAGGATATGTCAGGTGACCAAGTGATGTTTTTTCTCAGGTATTTGCAGTACTTGTATCAGATATGCAATGAAAATATAACAGTAANCTTCCAGGAAAGCAAGTACCCACAGTCAGCCAGATCATGGACTGGATGAACCTGTTATTGGATGCACATTTTGCCACTGTGGTGATGCTGTCAGAGGCCAAGTCACTGCTTAATAAAATTCAAAAGACTGTGAAAAGCCAGCTGAAGTTTTATTCAGAACTGAACAAGATCGAGGGCTGTTTAGNAGAGCTGAAAGAACTGAAGTGCCCGGCAANNNCNCCGCCAGATATTCTATAGAAGTTCTCAAACTCTACTAATAACATGGACAGCTCTGTACAGATTTGTTTTTATTTCTTTGTAAGAAACTGAAATATATTTCCTACTATTTTCGCATATCTTTCCATTTCCAACTACTCTGTTATTGCTTTCAGTTGCCCTGATTCGTNNNCTTCCTGCAGCACACATGTAAATGNCACCATGANCNNTNNCNNNNNNNGTNNC
  3   1   2       bld DMZ       out                        xl240e05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGTGAGAGATAAGGCCAAAGGACACAAATATATGGAGCACCAAGAAGAACCGACTGTGGTACAGAATGGCTTTAGCCCAACTGCTCTGGACGAAGACAGCTGTGGTGAACTTATAGCAGAGAGTTTGCCACAAACCGTTCAAATGGCAACTTGCCCAATGAGCAATAAAAGAGCTGTACTAGTAAACTCCGTTCTGATGTCTCCTTACAGTGAGAGCTTTCTTCTGCCACATCTCAAGGATATGTCAGGTGACCAAGTGATGTTTTTTCTCAGGTATTTGCAGTACTTGTATCAGATATGCAATGAAAATATAACAGTAAGCCTTCCAGGAAAGCAAGTACCCACGGTCAGCCAGATCATGGACTGGATGAACCTGTTATTGGATGCACATTTTGCCACTGTGGTGATGCTGTCAGAGGCCAAGTCACTGCTTAATAAAATTCAAAAGACTGTGAAAAGCCAGCTGAAGTTTTATTCAGAACTGAACAAGATCGAGGGCTGTTTAGCAGAGCTGAAAGAACTGAAGTGCCCGGCAAGTGTCTCCGCCAGATATTCTATAGAAGTTCTCAAACTCTACTAATAACATGGACAGCTCTGTACAGATTTGTTTTTATTTCTTTGTAAGAAACTGAAATATATTTCCTACTATTTTCGCATATCTTTCCATTTCCAACTACTCTGTTATTGCTTTCAGTTGCCCTGATTCGGTGGCCTTCCTGCAGCACACATGTAAATGTCACCATGAACTCCCTGTCCGGCTCTT
  3   1   2       bld Ga12      out                        XL200a12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGCACCAAGAAGAACCGACTGTGGTACAGAATGGCTTTAGCCCAACTGCTCTGGACGAAGACAGCTGTGGTGAACTTATAGCAGAGAGTTTGCCACAAACCGTTCAAATGGCAACTTGCCCAATGAGCAATAAAAGAGCTGTACTAGTAAACTCCGTTCTGATGTCTCCTTACAGTGAGAGCTTTCTTCTGCCACATCTCAAGGATATGTCAGGTGACCAAGTGATGTTTTTTCTCAGGTATTTGCAGTACTTGTATCAGATATGCAATGAAAATATAACAGTAAGCCTTCCAGGAAAGCAAGTACCCACAGTCAGCCAGATCATGGACTGGATGAACCTGTTATTGGATGCACATTTTGCCACTGTGGTGATGCTGTCAGAGGCCAAGTCACTGCTTAATAAAATTCAAAAGACTGTGAAAAGCCAGCTGAAGTTTTATTCAGAACTGAACAAGATCGAGGGCTGTTTAGCAGAGCTGAAAGAACTGAAGTGCCCGGCAAGTGTCTCCGCCAGATATTCTATAGAAGTTCTCAAACTCTACTAATAACATGGACAGCTCTGTACAGATTTGTTTTTATTTCTTTGTAAGAAACTGAAATATATTTCCTACTATTTTCGCATATCTTTCCATTTCCAACTACTCTGTTATTGCTTTCAGTTGCCCTGATTCGTTGGCCTTCCTGCAGCACACATGTAAATGTCACCATGAACTCCTGTCCGGCTCTTTGTGTCAT
  3   1   2       bld Ga12 5g3  out                        XL143k07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGCCACAAACCGTTCAAATGGCAACTTGCCCAATGAGCAATAAAAGAGCTGTACTAGTAAACTCCGTTCTGATGTCTCCTTACAGTGAGAGCTTTCTTCTGCCACATCTCAAGGATATGTCAGGTGACCAAGTGATGTTTTTTCTCAGGTATTTGCAGTACTTGTATCAGATATGCAATGAAAATATAACAGTAAGCCTTCCAGGAAAGCAAGTACCCACAGTCAGCCAGATCATGGACTGGATGAACCTGTTATTGGATGCACATTTTGCCACTGTGGTGATGCTGTCAGAGGCCAAGTCACTGCTTAATAAAATTCAAAAGACTGTGAAAAGCCAGCTGAAGTTTTATTCAGAACTGAACAAGATCGAGGGCTGTTTAGCAGAGCTGAAAGAACTGAAGTGCCCGGCAAGTGTCTCCGCCAGATATTCTATAGAAGTTCTCAAACTCTACTAATAACATGGACAGCTCTGTACAGATTTGTTTTTATTTCTTTGTAAGAAACTGAAATATATTTCCTACTATTTTCGCATATCTTTCCATTTCCAACTACTCTGTTATTGCTTTCAGTTGCCCTGATTCGTTGGCCTTCCTGCAGCACACATGTAAATGTCACCATNAACTCCTGTCCGGCTCTTTNGTCATGTTCACTTA
  3   1   2       bld Ga18      in                      xlk126i12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCTGTNNTATAGTGANCNTCTGACTAAANNNTTTNCCTAGCAATTGTTGNAAAATACAGCNCCTCTTGTCAGTGCAGCTTCAGAAGCTCAGAGAANNACTTNCNTCGTGTCNNTACTCAAAACTGGTGNATACTTATCCTGAGAATTAGTGGGATATCTTGGGNCCCCCNNCCTACACAAAGACACTAGATATAATGCCCCTCCACAGTTGCATGTGCTGGAAGGGTAGGTATGGACACACAAGGGCACTTAGCCATACAGAAAAACACCTCTGTTGTACTAACAAACTAATGATTGTTTTTCTATTAAAGCTGAAGTTTTATTCAGAACTGAACAAGATCGAGGGCTGTTTAGCAGAGCTGAAAGAACTGAAGTGCCCGGCAANNNNNNCGCCAGATATTCTATAGAAGTTCTCAAACTCTACTAATAACATGGACAGCTCTGTACAGATTTGTTTTTATTTCTTTGTAAGAAACTGAAATATATTTCCTACTATTTTCGCATATCTTTCCATTTCCAACTACTCTGTTATTGCTTTCAGTTGCCCTGATTCGGTGGCCTTCCTGCAGCACACATGTAAATGTCACCATGAACTCCTGTCCGGCTCTTTGTGTCATGTTCACTTGATAAAGAGTTATTTGCTGCACATGTGTTTTTGTGTTGTACTGGTTGAAGTCATAGCAAGAATCCTAGTTATAAAGCCTTTATTGGTATCTCATGGCTCAGATCTCTGACAACAAATACGTCTCAGGGCCAAACACNCCTTTTTTCAAGTTACTCATATACACATAGTCATGCANCTTTATNCGTTTA
  5   1   2      seed Ga15      in                       XL412m12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGGACGCGCTGGGTGCCACATCTCAAGGATATGTCAGGTGACCAAGTGATGTTTTTTCTCAGGTATTTGCAGTACTTGTATCAGATATGCAATGAAAATATAACAGTAAGCCTTCCAGGAAAGCAAGTACCCACGGTCAGCCAGATCATGGACTGGATGAACCTGTTATTGGATGCACATTTTGCCACTGTGGTGATGCTGTCAGAGGCCAAGTCACTGCTTAATAAAATTCAAAAGACTGTGAAAAGCCAGCTGAAGTTTTATTCAGAACTGAACAAGATCGAGGGCTGTTTAGCAGAGCTGAAAGAACTGAAGTGCCCGGCAAGTGTCTCCGCCAGATATTCTATAGAAGTTCTCAAACTCTACTAATAACATGGACAGCTCTGTACAGATTTGTTTTTATTTCTTTGTAAGAAACTGAAATATATTTCCTACTATTTTCGCATATCTTTCCATTTCCAACTACTCTGTTATTGCTTTCAGTTGCCCTGATTCGGTGGCCTTCCTGCAGCACACATGTAAATGTCACCATGAACTCCTGTCCGGCTCTTTGTGTCATGTTCACTTGATAAAGAGTTATTTGCTGCACATGTGTTTTTGTGTTGTACTGGTTGAAGTCATAGCAAGAATCCTAGTTATAAAGCCTTTATTGGTATCTCATGGCTCAGATCTCTGACAACAAATACGTCTCAGGGCCAAACACACCTTTTTTCAAGTTACTCATATACACATAGTCATGCAACTTTATACGTTTACAGCTCCACCTAC
  3   1   2       bld Ov1       in                    IMAGE:5074402.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCCACATCTCAAGGATATGTCAGGTGACCAAGTGATGTTTTTTCTCAGGTATTTGCAGTACTTGTATCAGATATGCAATGAAAATATAACAGTAAGCCTTCCAGGAAAGCAAGTACCCACGGTCAGCCAGATCATGGACTGGATGAACCTGTTATTGGATGCACATTTTGCCACTGTGGTGATGCTGTCAGAGGCCAAGTCACTGTTTAATAAAATTCAAAAGACTGTGAAAAGCCAGCTGAAGTTTTATTCAGAACTGAACAAGATCGAGGGCTGTTTAGCAGAGCTGAAAGAACTGAAGTGCCCGGCAAGTGTCTCCGCCAGATATTCTATAGAAGTTCTCAAACTCTACTAATAACATGGACAGCTCTGTACAGATTTGTTTTTATTTCTTTGTAAGAAACTGAAATATATTTTCCTACTATTTTCGCATATCTTTCCATTTCCAACTACTCTGTTATTGCTTTCAGTTGCCCTGATTCGTTGGCCTTCCTGCAGCACACATGTAAATGTCACCATGAACTCCTGTTCGGCTCTTTGTGTCATGTTCACTTGATAAAGAGTTATTTGCTGC
  3   1   2       bld Ga15      in                       XL412m12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAGGATATGGTCAGGTGACCAAGNGATGTTTTTTTCTCAGGGTATTTGCAGTNCTTGTATCAGATATGCAATGAAAATATAACAGTAAGCCTTCCAGGAAAGCAAGTACCCACGGTCAGCCAGATCATGGACTGGATGGAGCCTGTTATTGGATGCACATTTTGCCACTGTGGTGATGCTGTCAGAGGCCAAGTCACTGCTTAATAAAATTCAAAAGACTGTGAAAAGCCAGCTGAAGTTTTATTCAGAACTGAACAAGATCGAGGGCTGTTTAGCAGAGCTGAAAGAACTGAAGTGCCCGGCAAGTGTCTCCGCCAGATATTCTATAGAAGTTCTCAAACTCTACTAATAACATGGACAGCTCTGTACAGATTTGTTTTTATTTCTTTGTAAGAAACTGAAATATATTTCCTACTATTTTCGCATATCTTTCCATTTCCAACTACTCTGTTATTGCTTTCAGTTGCCCTGATTCGGTGGCCTTCCTGCAGCACACATGTAAATGTCACCATGAACTCCTGTCCGGCTCTTTGTGTCATGTTCACTTGATAAAGAGTTATTTGCTGCACATGTGTTTTTGTGTTGTACTGGTTGAAGTCATAGCAAGAATCCTAGTTATAAAGCCTTTATTGGTATCTCATGGCTCAGATCTCTGACAACAAATACGTCTCAGGGCCAAACACACCTTTTTTCAAGTTACTCATATACACATAGTCATGCAACTTTATACGTTACAG
  5   1   2       chi Ga18      in                      xlk126i12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTTCTGCAGTTTTTTTCTCAGGTATTTGCAGTACTTGTATCAGATATGCAATGAAAATATAACAGTAAGCCTTCCAGGAAAGCAAGTACCCACGGTCAGCCAGATCATGGACTGGATGAACCTGTTATTGGATGCACATTTTGCCACTGTGGTGATGCTGTCAGAGGCCAAGTCACTGCTTAATAAAATTCAAAAGACTGTGAAAAGCCAGGTGTGTATGTTGCTCCTGTTATTGTACTGTCCTGCTACTGCTGAATATTAAGTGAGATACTGTCCGGTTCAAAATTTCCTAAACTGACCCAAGCAAGGTGGCAAAGTTCTACAGGAGCTGCTGTTACAGTGAGTAGTTTGGGGCACTCTATTCCCATACAAAGTACATGGGCTGGCACTGGTAATTGAGCtttttttttttACAAGCAGGCTCTAAGCTCCTCAGCACACATGAGATACATTCATTTAGGTTCAGGCTTCTCAACAGAGGGGTTTCTAGTAGAAGTGCAATTTGTGAGCATGTTAAGAGTGAGTGAGGTGCGACCGGAGCACATAAGAGGNATATTTGGAGTTAATAAGGTGTGGNCAGATACAAATTATTTAGATTTTTTGTAAACAAGGGTCCCTATTCTACTTAAGGGGGCAGTTGGACATAAGANTACAAAACTAGGCAANCTTNGNGTAGGAGTCCTGCCAGTAGACGTATGGGGCTCCNTGATTNCTCATGGCAGCCCNT
  3   1   2       bld Ga12      in                         XL171g12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTGATGTTTTTTCTCAGGTAATTGCAGTACTTGTATCAGATATGCAATGAAAATATAACAGTAAGCCTTCCAGGAAAGCAAGTACCCACAGTCAGCCAGATCATGGACTGGATGAACCTGTTATTGGATGCACATTTTGCCACTGTGGTGATGCTGTCAGAGGCCAAGTCACTGCTTAATAAAATTCAAAAGACTGTGAAAAGCCAGCTGAAGTTTTATTCAGAACTGAACAAGATCGAGGGCTGTTTAGCAGAGCTGAAAGAACTGAAGTGCCCGGCAAGTGTCTCCGCCAGATATTCTATAGAAGTTCTCAAACTCTACTAATAACATGGACAGCTCTGTACAGATTTGTTTTTATTTCTTTGTAAGAAACTGAAATATATTTCCTACTATTTTCGCATATCTTTCCATTTCCAACTACTCTGTTATTGCTTTCAGTTGCCCTGATTCGTTGGCCTTCCTGCAGCACACATGTAAATGTCACCATGAACTCCTGTCCGGCTCTTTGTGTCATGTTCACTTGATAAAGAGTTATTTGCTGCACATGTGTTTTTGTGTTGTACTGGTTGAAGTCATAGCAAGAATCCTAGTTATAAAGCCTTTATTGGTATCTCATGGCTCAGATCTCTGACAACAAATACGTCTCAGGGCCAAACACACCTTTTTTCAAGATACTGATATACACATAGTCATGCAACTTTATACGTTTACAGCTCCACCTACAGGCATANCCAAAACCA
  3   1   2       add Ga15      out                      XL467p22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTTTTTCTCAGGTATTTGCAGTACTGGTATCAGATATGCAATGAAAATATAACAGTAAGCCTTCCAGGGAAAGACAAGTACCCACGGTCANCCAGATCATGG
  5   1   2       chi Tbd2                   IMAGE:3201619-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GATGGCCGCTCTCAGTGAACACTTCACGTTGTGCGGACTTCTTACCGAGGCCAAGTCACTGCTTAATAAAATTCAAAAGACTGTGAAAAGCCAGCTGAAGTTTTATTCAGAACTGAACAAGATCGAGGGCTGTTTAGCAGAGCTGAAAGAACTGAAGTGCCCGGCAAGTGTCTCCGCCAGATATTCTATAGAAGTTCTCAAACTCTACTAATAACATGGACAGCTCTGTACAGATTTGTTTTTATTTCTTTGTAAGAAACTGAAATATATTTCCTACTATTTTCGCATATCTTTCCATTTCCAACTACTCTGTTATTGCTTTCAGTTGCCCTGATTCGGTGGCCTTCCTGCAGCACACATGTAAATGTCACCATGAACTCCTGTCCGGCTCTTTGTGTCATGTTCACTTGATAAAGAGTTATTTGCTGCACATGTGTTTTTGTGTTGTACTGGTTGAAGTCATAGCAAGAATCCTAGTTATAAAGCCTTTATTGGTATCTCATGGCTCAGATCTCTGACAACAAATACGTCTCAGGGCCAAACACACCTTTTTTCAAGTTACTCATATACACATAGTCATGCAACTTTATACGTTTACAGCTCCACCTACAGGCATATCCAAAACCAGTTCGAAATGaaaaaaaaaagaaataaaaTTAGATACAATATTACTTTTCAACAAAATATCCTTATGTTTTTATCTTTCGCTTGTTA
  5   1   2       bld Tbd2                            IMAGE:3201619.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATGGCCGCTCTCAGTGAACACTTCACGTTGTGCGGACTTCTTACCGAGGCCAAGTCACTGCTTAATAAAATTCAAAAGACTGTGAAAAGCCAGCTGAAGTTTTATTCAGAACTGAACAAGATCGAGGGCTGTTTAGCAGAGCTGAAAGAACTGAAGTGCCCGGCAAGTGTCTCCGCCAGATATTCTATAGAAGTTCTCAAACTCTACTAATAACATGGACAGCTCTGTACAGATTTGTTTTTATTTCTTTGTAAGAAACTGAAATATATTTCCTACTATTTTCACATATCTTTCCATTTCCAACTACTCTGTTATTGCTTTCANTTGCCCTGATTCAGTGGCCTTCCTGCAGCACACATGTAAATATCACCATAAACTCCTATCC
  3   1   2       bld Ga12      out                        XL190h23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGGATGCACATTTTGCCACTGTGGTGATGCTGTCAGAGGCCAAGTCACTGCTTAATAAAATTCAAAAGACTGTGAAAAGCCAGCTGAAGTTTTATTCAGAACTGAACAAGATCGAGGGCTGTTTAGCAGAGCTGAAAGAACTGAAGTGCCCGGCAAGTGTCTCCGCCAGATATTCTATAGAAGTTCTCAAACTCTACTAATAACATGGACAGCTCTGTACAGATTTGTTTTTATTTCTTTGTAAGAAACTGAAATATATTTCCTACTATTTTCGCATATCTTTCCATTTCCAACTACTCTGTTATTGCTTTCAGTTGCCCTGATTCGGTGGCCTTCCTGCAGCACACATGTAAATGTCACCATGAACTCCTGTCCGGCTCTTTGTGTCATGTTCACTTGATAAAGAGTTATTTGCTGCACATGTGTTTTTGTGTTGTACTGGTTGAAGTCATAGCAAGAATCCTAGTTATAAAGCCTTTATTGGTATCTCATGGCTCAGATCTCTGACAACAAATACGTCTCAGGGCCAAACACACCTTTTTTCAAGTTACTCATATACACATAGTCATGCAACTTTATACGTTTACAGCTCCACCTACAGGCATATCCAAAAC
  3   1   2       bld Emb4      out                   IMAGE:4957112.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTAGCAGAGCTGAAAGAACTGAAGTGCCCGGCAAGTGTCTCCGCCAGATATTCTATAGAAGTTCTCAAACTCTACTAATAACATGGACAGCTCTGTACAGATTTGTTTTTATTTCTTTGTAAGAAACTGAAATATATTTCCTACTATTTTCGCATATCTTTCCATTTCCAACTACTCTGTTATTGCTTTCAGTTGCCCTGATTCGGTGGCCTTCCTGCAGCACACATGTAAATGTCACCATGAACTCCTGTCCGGCTCTTTGTGTCATGTTCACTTGATAAAGAGTTATTTGCTGCACATGTGTTTTTGTGTTGTACTGGTTGAAGTCATAGCAAGAATCCTAGTTATAAAGCCTTTATTGGTATCTCATGGCTCAGATCTCTGACAACAAATACGTCTCAGGGCCAAACACACCTTTTTTCAAGTTACTCATATACACATAGTCATGCAACTTTATACGTTTACAGCTCCACCTACAGGCATATCCAAAACCAGTTCGAAATAA
  5   1   2       bld Ga18      out                     xlk150i09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCATGCAACTTTATACGTTTACAGCTCCACCTACAGGCATATCCAAAACCAGTTCGAAATGaaaaaaaaaaagaaataaaaTTAGATACAATATTACTTTTCAACAAAATATCCTTATGTTTTTATCTTTCGCTTGTTACATTTGTCCAAATATAATCTTTAATTCCGTAACAGAAATCATATTCCCAATTAAGAGCATAGGGATCCCATCCCTTAGCAGTCCCCGATGTTTACGGATGATTTTAGAAACTTCATGGCTAACCGTGCTGTATTTATATGCAAAACGTATTCACTTCAAATCGTTTCCTGGACTGAGAAGAGAACTCAACACCGAAACCCTCAATGACTGACTTTTGTTGTTTTAGGAGGGTCACCGTGTACCCCCTCTATAAAATATTTTCATTTCATCTAGCCATTTAGTTAGTACCATCACAACTGACACAATCCTCTTTACCCGGACAAATTGGTATTTGGGTAGTGATTTCCTTGTGTGAANCGAAGCAATGTTTTCTTATCAGTTGATTTTAAAAGATCGGTAATTAGCCCTCCATCCCTTTTAATCACAAAGGTATCCAAATAGCAAACAGTATCGATATAGCGGAACCATATTGTATAATATTGTTGAAACCACTTGTTTGAGTNTAGAAATTTAAGCTCAAAATAGTTCATGAAAATATTCGCATAGGATGGGGCCACAGTGGACCCCATCGCTATACCTCNNNCTGCATNTAAAATGTTCTTGAAGNATGAAATAATTNTTNTAAAGGACTAATT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)