Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6638390.5                       8 END     5          12       62                vitellogenin receptor [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012838292 Xl3.1-IMAGE:8329589.3.5 - 39 ESTs
                                                                       .......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:8329589.3.5                                                                                                                                                                                                                                              AAGAGTGATGAGATCAATTGCCCATCTCGCACTTGCCAACCAGACCAATTTAAATGTGAGGATGGAAATTGTATTCATGGCAGTAGACAATGCGATGGTGTGAGAGACTGCCTTGATGGCACTGATGAAATACGCTGTAAAAATGTCATTCAGTGCTCAGGACCTGGTAAATTCAAGTGCAAATCTGGAGAGTGCATCGAAAGTAACAAGGTTTGCAACAAGCATAAAGACTGCAAGGACTGGAGTGATGAGCCAGTAAAGGATTGTGAGGTTGATGAATGTCTGGAGAATAATGGTGGCTGTTCTCATATATGCCATGACCTGCCTATTGGCTATGAATGTGAATGCACTGCTGGCTTTAAGCTAATTGACCGGAAAACATGTGGAGATATTGACGAATGCCAAAATCCAGAAATCTGCAGCCAGATCTGTGTGAACCTGAAAGGAGGCTACAAATGTGAATGCAGTAAAGGATATCAGATGGATCCATCCACTGGTGTATGCAAGGCAGTAGGAAGGGAGCCATGTCTGATCTTCACCAACCGCAGGGATATCCGGAAGGTTGGACTTGAAAGGAAAGAATACATCCAGCTGGTGGAGCAGTTGAGGAATACAGTAGCACTGGACGCTGATATAAAAGAACAAAGCTTATTCTGGGCAGACACTATCCAGAAAGCCATTTTTCGTGCCCCATTTGACACCCGGGAAAAAGTAGGCTCCCATGTCAAGGTTGTGGAAGATGTGCACAGTCCATCAGCAATTGCAATTGACTGGATCTACAAAAATATATATTGGATAGATACTATTTTAAAGACCATTTCTGTGTCTAATTTTGATGGCTCCAAAAGGAAAACCTTGTTCAGTTCAGAGCTGCAAGATCTAACCTCCATTGCGGTTGATCCAATATCTGGGTTTATTTACTGGTCTGACTGTGGAGAGCCTGCCAAAATTGAAAAAGCTGGAATGAATGGAATAGACAGACAACAGTTGATAACAGCAGATGTGCAAAGACCTAGTGGCATTGCAATTGATGTGGTAAAAAGCCGTTTATATTGGGTTGATTCCAAACTGCATACACTCTCTAGTGTGGACCTCAATGGTCAGGATCGCAGAGTCATTCTGAAATCTCATGAATTCCTTGCTCATCCTCTTGCACTTACTATATTTGAGGATCGTGTCTACTGGATTGATGGTGAGAATGAAGCAATCTATGGGGCCAACAAATTTTCTGGGCAAGAGCTTGAAACTTTAGTCAATAATTTAAATGATGCCCAAGATATAATAGTCTACCATGAACTCATCCAACCCCTAGGTATAAACTGGTGCAATGAACAGATAGAAAATGGCGGCTGTAAATATCTGTGTTTACCGGCTCCGCAGATAAGTGATCGTTCACCCAAGTATACTTGTGCTTGTCCTGATGGCTTTGAAGTACATGAAGGAAGGAGCTGCAGAGCAGGTAGTAAAGCTACTATGGACCACCCTGTCAAACCTACAGGAATAATGCCTAATAAACCACTTCCAAGTGGTAATAATGACACTGCTTCTGTGTATGAAGTAAATCAGTCTGCCAAAGGGACCTCTGCTGCATGGGCAATCCTTCCCCTTTTGTTAATAGCAATGGCGGCTTCTGGGGGTTACCTGATGTGGCGCAACTGGCAACGGAAAAATATGAAAAGCATGAACTTCGATAATCCAGTGTACTTAAAAACAACAGAGGAGGACTTGGCAATAGATATTGGAAGGCATAGTGGGAATATAGGCCACACATATCCAGCAATCTCTGTTGTAAACACAGATGACGACTTGTCCTGAGTTTGGTTATTCTTGATTGGCATTCACCATCCTCCTTTAGACTACACTGCTTCAACAGGGATTTTGTTGTATTCTGGATGGTAACCACACCAGTGGCTGAACTACTTGTCTTTGTCCACAACCATCCATGAGAGCATGTGCACAGAAGAGTCGTGTGAAGATGTGAACAGACACACTCCCTACATGGGAGACCTCTTGTAAATATTCATCAACTGTGTTCAGCGCTTGATATCGTTACCTCTAAACTATTTGCTCCCAAACTTTTTGTTTCTTCTTACCATCTACCTTTTTTCCCCCCTCAGTATTAAAACCAATACTTTAATAGGTCAAGTACTGTACAAAGCACTTTCCATAGAAAGCCATATTCCAGAAATTGTGCTGTATGTAGTAAGTTATCCTGTACATATGTGTAAAGGCAGTTTGTACATATCCTTAAAGAACACAATCACAATTCTGAAGCACTTTGAAATATTTCAACTGTAAATATGTATCTGTAAACATTTTTGGGTTTTTCATTTATTTTTCCAATGGTTGGGGCAAATGGCAATAGACAAAATTACAAACGGGTTATACATAACAAATTGCCAAATAATTTCTAAACTTAAAGAATTTTGTATGTGTGAATGCAACTGTAAATCTGTCTTGACTGACCTTTTTTATAGAGGTATGCAGAGGGTTTACTCCCTATTAAAACCACTGGAGAATCTTTTCAGAATTAAAATGAACTATGTATTTACAAAAAAAAAAAAAAAG
                                                  Xl3.1-CHK-1012721511                                                                                                                                                                                                                                                    GATGAGATCAATTGCCCATCTCGCACTTGCCAACCAGACCAATTTAAATGTGAGGATGGAAATTGTATTCATGGCAGTAGACAATGCGATGGTGTGAGAGACTGCCTTGATGGCACTGATGAAATACGCTGTAAAAATGTCATTCAGTGCTCAGGACCTGGTAAATTCAAGTGCAAATCTGGAGAGTGCATCGAAAGTAACAAGGTTTGCAACAAGCATAAAGACTGCAAGGACTGGAGTGATGAGCCAGTAAAGGATTGTGAGGTTGATGAATGTCTGGAGAATAATGGTGGCTGTTCTCATATATGCCATGACCTGCCTATTGGCTATGAATGTGAATGCACTGCTGGCTTTAAGCTAATTGACCGGAAAACATGTGGAGATATTGACGAATGCCAAAATCCAGAAATCTGCAGCCAGATCTGTGTGAACCTGAAAGGAGGCTACAAATGTGAATGCAGTAAAGGATATCAGATGGATCCATCCACTGGTGTATGCAAGGCAGTAGGAAGGGAGCCATGTCTGATCTTCACCAACCGCAGGGATATCCGGAAGGTTGGACTTGAAAGGAAAGAATACATCCAGCTGGTGGAGCAGTTGAGGAATACAGTAGCACTGGACGCTGATATAAAAGAACAAAGCTTATTCTGGGCAGACACTATCCAGAAAGCCATTTTTCGTGCCCCATTTGACACCCGGGAAAAAGTAGGCTCCCATGTCAAGGTTGTGGAAGATGTGCACAGTCCATCAGCAATTGCAATTGACTGGATCTACAAAAATATATATTGGATAGATACTATTTTAAAGACCATTTCTGTGTCTAATTTTGATGGCTCCAAAAGGAAAACCTTGTTCAGTTCAGAGCTGCAAGATCTAACCTCCATTGCGGTTGATCCAATATCTGGGTTTATTTACTGGTCTGACTGTGGAGAGCCTGCCAAAATTGAAAAAGCTGGAATGAATGGAATAGACAGACAACAGTTGATAACAGCAGATGTGCAAAGACCTAGTGGCATTGCAATTGATGTGGTAAAAAGCCGTTTATATTGGGTTGATTCCAAACTGCATACACTCTCTAGTGTGGACCTCAATGGTCAGGATCGCAGAGTCATTCTGAAATCTCATGAATTCCTTGCTCATCCTCTTGCACTTACTATATTTGAGGATCGTGTCTACTGGATTGATGGTGAGAATGAAGCAATCTATGGGGCCAACAAATTTTCTGGGCAAGAGCTTGAAACTTTAGTCAATAATTTAAATGATGCCCAAGATATAATAGTCTACCATGAACTCATCCAACCCCTAGGTATAAACTGGTGCAATGAACAGATAGAAAATGGCGGCTGTAAATATCTGTGTTTACCGGCTCCGCAGATAAGTGATCGTTCACCCAAGTATACTTGTGCTTGTCCTGATGGCTTTGAAGTACATGAAGGAAGGAGCTGCAGAGCAGGTAGTAAAGCTACTATGGACCACCCTGTCAAACCTACAGGAATAATGCCTAATAAACCACTTCCAAGTGGTAATAATGACACTGCTTCTGTGTATGAAGTAAATCAGTCTGCCAAAGGGACCTCTGCTGCATGGGCAATCCTTCCCCTTTTGTTAATAGCAATGGCGGCTTCTGGGGGTTACCTGATGTGGCGCAACTGGCAACGGAAAAATATGAAAAGCATGAACTTCGATAATCCAGTGTACTTAAAAACAACAGAGGAGGACTTGGCAATAGATATTGGAAGGCATAGTGGGAATATAGGCCACACATATCCAGCAATCTCTGTTGTAAACACAGATGACGACTTGTCCTGAGTTTGGTTATTCTTGATTGGCATTCACCATCCTCCTTTAGACTACACTGCTTCAACAGGGATTTTGTTGTATTCTGGATGGTAACCACACCAGTGGCTGAACTACTTGTCTTTGTCCACAACCATCCATGAGAGCATGTGCACAGAAGAGTCGTGTGAAGATGTGAACAGAxxxxxxxCCxxxATGGGAGACCTCTTGTAAATATTCATCAACTGTGTTCAGCGCTTGATATCGTTACCTCTAAACTATTTGCTCCCAAACTTTTTGTTTCTTCTTACCATCTACCTTTTTTCCCCCCTCAGTATTAAAACCAATACTTTAATAGGTCAAGTACTGTACAAAGCACTTTCCATAGAAAGCCATATTCCAGAAATTGTGCTGTATGTAGTAAGTTATCCTGTACATATGTGTAAAGGCAGTTTGTACATATCCTTAAAGAACACAATCACAATTCTGAAGCACTTTGAAATATTTCAACTGTAAATATGTATCTGTAAACATTTTTGGGTTTTTCATTTATTTTTCCAATGGTTGGGGCAAATGGCAATAGACAAAATTACAAACGGGTTATACATAACAAATTGCCAAATAATTTCTAAACTTAAAGAATTTTGTATGTGTGAATGCAACTGTAAATCTGTCTTGACTGACCTTTTTTATAGAGGTATGCAGAGGGTTTACTCCCTATTAAAACCACTGGAGAATCTTTTCAGAATTAAAATGAACTATGTATTTACAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                   2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     5     5     6     6     6     6     6     8     6     9     6     9     6     9     7    10     7    10     7    10     7    10     7    10     7    10     7    10     6     9     6     9     6     9     6     9     6     9     6     9     6     9     6     9     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     4     6     4     8     4     8     5     9     6     9     6     9     6     9     6     9     6     9     6     9     6     9     6     9     6     9     6     9     6     8     6     8     5     8     5     8     4     7     5     7     5     7     5     7     5     7     5     7     4     6     4     6     4     6     3     5     3     5     3     5     3     5     4     5     2     5     3     5     3     5     3     6     3     6     3     6     3     6     3     6     3     6     3     7     3     7     3     7     3     7     3     7     3     7     5     6     4     6     4     7     3     8     4     7     3     8     4     8     4     8     5     8     5     8     5     8     4     7     5     7     5     8     4     9     4     9     4     9     6    11     4    10     6    11     5    12     4    11     5    11     5    11     5    12     6    13     6    13     6    13     7    13     7    13     8    14     8    14    11    15    11    16    10    16    11    17    12    18    12    18    12    18    12    18    12    18    13    19    11    19    15    19    15    19    15    20    16    20    16    20    17    20    18    20    17    19    17    19    15    19    17    19    16    18    17    18    17    17    15    17    15    17    15    17    15    17    15    17    15    17    15    17    15    17    14    16    11    15     5     7     5     5
  5   1   2      3-95                            Xl3.1-IMAGE:4031288.5 GTTTTACAAAGTCGAGCATTAACGGATTCCGGGATTCGTCGACCCCGCGTCCGCTTGTGGCTCTGGAGAATGCATTCACAAGGCATTTCATTGGCACTGCACCTCTGGGGAGCAATGGGCTGGCGACCGCACTGCTCCAGTGACTCGTCCGAGTGGTCTGCCAATGAAATGCCTTGTGGCTCTGGAGAATGCATTCACAAAAAGTGGCGCTGTGATGGAGACGCAGATTGCAAGGACAAGAGTGATGAGATCAATTGCCCATCTCGCACTTGCCAACCAGACCAATTTAAATGTGAGGATGGAAATTGTATTCATGGCAGTAGACAATGCGATGGTGTGAGAGACTGCCTTGATGGCACTGATGAAATACGCTGTAAAAATGTCATTCAGTGCTCAGGACCTGGTAAATTCAAGTGCAAATCTGGAGAGTGCATCGAAAGTAACAAGGTTTGCAACAAGCATAAAGACTGCAAGGACTGGAGTGATGAGCCAGTAAAGGATTGTGAGGTTGATGAATGTCTGGAGAATAATGGTGGCTGTTCTCATATATGCCATGACCTGCCTATTGGCTATGAATGTGAATGCACTGCTGGCTTTAAGCTAATTGACCGGAAAACATGTGGAGATATTGACGAATGCCAAAATCCAGAAATCTGCAGCCAGATCTGTGTGAACCTGAAAGGAGGCTACAAATGTGAATGCAGTAAAGGATATCAGATGGATCCATCCACTGGTGTATGCAAGGCAGTAGGAAGGGAGCCATGTCTGATCTTCACCAACCGCAGGGATATCCGGAAGGTTGGACTTGAAAGGAAAGAATACATCCAGCTGGTGGAGCAGTTGAGGAATACAGTAGCACTGGACGCTGATATAAAAGAACAAAGCTTATTCTGGGCAGACACTATCCAGAAAGCCATTTTTCGTGCCCCATTTGACACCCGGGAAAAAGTAGGCTCCCATGTCAAGGTTGTGGAAGATGTGCACAGTCCATCAGCAATTGCAATTGACTGGATCTACAAAAATATATATGGGATAGATACTATTTTAAAGAACATTTCCTGTGTCTAATTTTGGAGGGTTCCAAAAGGAAAAACCATGTTTCATTTCCAAGCTGCAAAAACCCTACCCTCCCATTGGCGGGTTGATCCACATAATCTGGGGGTTAATTTAACTGGGGCCTGGACCTGGGGAAGAAACCCTTGCCCAAAATTGTGAAAAAACCTTGGAAAAGGAAGT
  5   1   2      ests                      Xl3.1-IMAGE:6317980-IMAGp.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCATCCACTGGTGTATGCAAGGCAGTAGGAAGGGAGCCATGTCTGATCTTCACCAACCGCAGGGATATCCGGAAGGTTGGACTTGAAAGGAAAGAATACATCCAGCTGGTGGAGCAGTTGAGGAATACAGTAGCACTGGACGCTGATATAAAAGAACAAAGCTTATTCTGGGCAGACACTATCCAGAAAGCCATTTTTCGTGCCCCATTTGACACCCGGGAAAAAGTAGGCTCCCATGTCAAGGTTGTGGAAGATGTGCACAGTCCATCAGCAATTGCAATTGACTGGATCTACAAAAATATATATTGGATAGATACTATTTTAAAGACCATTTCTGTGTCTAATTTTGATGGCTCCAAAAGGAAAACCTTGTTCAGTTCAGAGCTGCAAGATCTAACCTCCATTGCGGTTGATCCAATATCTGGGTTTATTTACTGGTCTGACTGTGGAGAGCCTGCCAAAATTGAAAAAGCTGGAATGAATGGAATAGACAGACAACAGTTGATAACAGCAGATGTGCAAAGACCTAGTGGCATTGCAATTGATGTGGTAAAAAGCCGTTTATATTGGGTTGATTCCAAACTGCATACACTCTCTAGTGTGGACCTCAATGGTCAGGATCGCAGAGTCATTCTGAAATCTCATGAATTCCTTGCTCATCCTCTTGCACTTACTATATTTGAGGATCGTGTCTACTGGATTGATGGTGAGAATGAAGCAATCTATGGGGCCAACAAATTTTCTGGGCAAGAGCTTGAAACTTTAGTCAATAATTTAAATGATGCCCAAGATATAATAGTCTACCATGAACTCATCCAACCCCTAGGTATAAACTGGTGCAATGAACAGATAGAAAATGGCGGCTGTAAATATCTGTGTTTACCGGCTCCGCAGATAAGTGATCGTTCACCCAAGTATACTTGTGCTTGTCCTGATGGCTTTGAAGTACATGAAGGAAGGAGCTGCAGAGCAGGTAGTAAAGCTACTATGGACCACCCTGTCAAACCTACAGGAATAATGCCTAATAAACCACTTCCAAGTGGTAATAATGACACTGCTTCTGTGTATGAAGTAAATCAGTCTGCCAAAGGGACCTCTGCTGCATGGGCAATCCTTCCCCTTTTGTTAATAGCAATGGCGGCTTCTGGGGGTTACCTGATGTGGCGCAACTGGCAA
  5  -1   2      3-95                            Xl3.1-IMAGE:7202810.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCATTTCAAGCACTTTTGTCTGCAATAGCCAGAATGACTGCAGTGATGGAAGTGACGAAGAGAACTGTGTTGCTTCCACTTGTGGAGCTCATGAGTTTCAGTGCAAGAATTCCTCCTGCATCCCTCTTAGCTGGGTTTGTGATAAGGATTTTGATTGTACAGACCGCTCCGATGAGTCACTGGAGCAGTGCGGTCACCAGCCCATTGCTCCCCAGAGGTGCAGCCCCAATGAAATGCCTTGTGGCTCTGGAGAATGCATACACAAAAAGTGGCGCTGTGATGGAGACCCAGATTGCAAGGACAAGAGTGATGAGATGAATTGCCCATCTCGCACTTGCCAACCAGACCAATTTAAATGTGAGGATGGAAATTGTATTCATGGCAGTAGACAATGCGATGGTGTGAGAGACTGCCTTGATGGCACTGATGAAATACGCTGTAAAAATGTCAATCAGTGCTCAGGACCTGGCAAATTCAAGTGCATATCTGGAGAGTGCATTGATAGTAACAAGGTTTGCAACAAGCATAAAGACTGCAAGGACTGGAGTGATGAGCCAGTAAAGGATTGTGCGATTGATGAATGTTTGGTGAATAACGGTGGTTGTTCCCATACATGCCTTGACCTGCCAATTGGCTATGAATGTGAATGCACTGCTGGCTTTAAGCTAATTGACCGGAAAACATGTGGAGATATTGACGAATGCCAAAATCCAGAAATCTGCAGCCAGATCTGTGTGAACCTGAAAGGAGGCTACAAATGTGAATGCAGTAAAGGATATCAGATGGATCCATCTACTGGTGTATGCAAGGCAATAGGAAGGGAGCCATGTCTGATATTCGCCAACCGCAGAGATATCCGGAAGGTTGGACTTGAAAGGAAAGAATACATCCAGTTGGTGGAGCAGTTGAGGAATACAGTAGCTCTGGACGCTGATATAAAAGAACAAAGCTTGTTCTGGGCAGATACTATTCAGAAAGCCATCTTCCGTGCCCCATTTGACACCCGGGAAAAAGTAGGCACCCATGTCAAGGTTGTGGAGAACGTGCACAGTCCATCAGCAATAGCAATTGACTGGATCTACAAAAATAAT
  5   1   2      ests                            Xl3.1-IMAGE:8329589.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAAATATGAAAAGCATGAACTTCGATAATCCAGTGTACTTAAAAACAACAGAGGAGGACTTGGCAATAGATATTGGAAGGCATAGTGGGAATATAGGCCACACATATCCAGCAATCTCTGTTGTAAACACAGATGACGACTTGTCCTGAGTTTGGTTATTCTTGATTGGCATTCACCATCCTCCTTTAGACTACACTGCTTCAACAGGGATTTTGTTGTATTCTGGATGGTAACCACACCAGTGGCTGAACTACTTGTCTTTGTCCACAACCATCCATGAGAGCATGTGCACAGAAGAGTCGTGTGAAGATGTGAACAGACACACTCCCTACATGGGAGACCTCTTGTAAATATTCATCAACTGTGTTCAGCGCTTGATATCGTTACCTCTAAACTATTTGCTCCCAAACTTTTTGTTTCTTCTTACCATCTACCTTTTTTCCCCCCTCAGTATTAAAACCAATACTTTAATAGGTCAAGTACTGTACAAAGCACTTTCCATAGAAAGCCATATTCCAGAAATTGTGCTGTATGTAGTAAGTTATCCTGTACATATGTGTAAAGGCAGTTTGTACATATCCTTAAAGAACACAATCACAATTCTGAAGCACTTTGAAATATTTCAACTGTAAATATGTATCTGTAAACATTTTTGGGTTTTTCATTTATTTTTCCAATGGTTGGGGCAAATGGCAATAGACAAAATTACAAACGGGTTATACATAACAAATTGCCAAATAATTTCTAAACTTAAAGAATTTTGTATGTGTGAATGCAACTGTAAATCTGTCTTGACTGACCTTTTTTATAGAGGTATGCAGAGGGTTTACTCCCTATTAAAACCACTGGAGAATCTTTTCAGAATTAAAATGAACTATGTATTTACAAAAAAAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTGTGAGAGACTGCCTTGATGGCACTGATGAAATACGCTGTAAAAATGTCAATCAGTGCTCAGGACCTGGCAAATTCAAGTGCATATCTGGAGAGTGCATTGATAGTAACAAGGTTTGCAACAAGCATAAAGACTGCAAGGACTGGAGTGATGAGC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -C----------
  5   1   2      3-95                            Xl3.1-IMAGE:4031288.5 GTTTTACAAAGTCGAGCATTAACGGATTCCGGGATTCGTCGACCCCGCGTCCGCTTGTGGCTCTGGAGAATGCATTCACAAGGCATTTCATTGGCACTGCACCTCTGGGGAGCAATGGGCTGGCGACCGCACTGCTCCAGTGACTCGTCCGAGTGGTCTGCCAATGAAATGCCTTGTGGCTCTGGAGAATGCATTCACAAAAAGTGGCGCTGTGATGGAGACGCAGATTGCAAGGACAAGAGTGATGAGATCAATTGCCCATCTCGCACTTGCCAACCAGACCAATTTAAATGTGAGGATGGAAATTGTATTCATGGCAGTAGACAATGCGATGGTGTGAGAGACTGCCTTGATGGCACTGATGAAATACGCTGTAAAAATGTCATTCAGTGCTCAGGACCTGGTAAATTCAAGTGCAAATCTGGAGAGTGCATCGAAAGTAACAAGGTTTGCAACAAGCATAAAGACTGCAAGGACTGGAGTGATGAGCCAGTAAAGGATTGTGAGGTTGATGAATGTCTGGAGAATAATGGTGGCTGTTCTCATATATGCCATGACCTGCCTATTGGCTATGAATGTGAATGCACTGCTGGCTTTAAGCTAATTGACCGGAAAACATGTGGAGATATTGACGAATGCCAAAATCCAGAAATCTGCAGCCAGATCTGTGTGAACCTGAAAGGAGGCTACAAATGTGAATGCAGTAAAGGATATCAGATGGATCCATCCACTGGTGTATGCAAGGCAGTAGGAAGGGAGCCATGTCTGATCTTCACCAACCGCAGGGATATCCGGAAGGTTGGACTTGAAAGGAAAGAATACATCCAGCTGGTGGAGCAGTTGAGGAATACAGTAGCACTGGACGCTGATATAAAAGAACAAAGCTTATTCTGGGCAGACACTATCCAGAAAGCCATTTTTCGTGCCCCATTTGACACCCGGGAAAAAGTAGGCTCCCATGTCAAGGTTGTGGAAGATGTGCACAGTCCATCAGCAATTGCAATTGACTGGATCTACAAAAATATATATGGGATAGATACTATTTTAAAGAACATTTCCTGTGTCTAATTTTGGAGGGTTCCAAAAGGAAAAACCATGTTTCATTTCCAAGCTGCAAAAACCCTACCCTCCCATTGGCGGGTTGATCCACATAATCTGGGGGTTAATTTAACTGGGGCCTGGACCTGGGGAAGAAACCCTTGCCCAAAATTGTGAAAAAACCTTGGAAAAGGAAGT
                                                  Xl3.1-CHK-1012714306       CAAAGTCGAGCATTAACGGATTCCGGGATTCGTCGACCCCGCGTCCGCTTGTGGCTCTGGAGAATGCATTCACAAGGCATTTCATTGGCACTGCACCTCTGGGGAGCAATGGGCTGGCGACCGCACTGCTCCAGTGACTCGTCCGAGTGGTCTGCCAATGAAATGCCTTGTGGCTCTGGAGAATGCATTCACAAAAAGTGGCGCTGTGATGGAGACGCAGATTGCAAGGACAAGAGTGATGAGATCAATTGCCCATCTCGCACTTGCCAACCAGACCAATTTAAATGTGAGGATGGAAATTGTATTCATGGCAGTAGACAATGCGATGGTGTGAGAGACTGCCTTGATGGCACTGATGAAATACGCTGTAAAAATGTCATTCAGTGCTCAGGACCTGGTAAATTCAAGTGCAAATCTGGAGAGTGCATCGAAAGTAACAAGGTTTGCAACAAGCATAAAGACTGCAAGGACTGGAGTGATGAGCCAGTAAAGGATTGTGAGGTTGATGAATGTCTGGAGAATAATGGTGGCTGTTCTCATATATGCCATGACCTGCCTATTGGCTATGAATGTGAATGCACTGCTGGCTTTAAGCTAATTGACCGGAAAACATGTGGAGATATTGACGAATGCCAAAATCCAGAAATCTGCAGCCAGATCTGTGTGAACCTGAAAGGAGGCTACAAATGTGAATGCAGTAAAGGATATCAGATGGATCCATCCACTGGTGTATGCAAGGCAGTAGGAAGGGAGCCATGTCTGATCTTCACCAACCGCAGGGATATCCGGAAGGTTGGACTTGAAAGGAAAGAATACATCCAGCTGGTGGAGCAGTTGAGGAATACAGTAGCACTGGACGCTGATATAAAAGAACAAAGCTTATTCTGGGCAGACACTATCCAGAAAGCCATTTTTCGTGCCCCATTTGACACCCGGGAAAAAGTAGGCTCCCATGTCAAGGTTGTGGAAGATGTGCACAGTCCATCAGCAATTGCAATTGACTGGATCTACAAAAATATATATGGGATAGATACTATTTTAAAGAACATTTCCTGTGTCTAATTTTGGAGGGTTCCAAAAGGAAAAACCATGTTTCATTTCCAAGCTGCAAAAACCCTACCCTCCCATTGGCGGGTTGATCCACATAATCTGGGGGTTAATTTAACTGGGGCCTGGACCTGGGGAAGAAACCCTTGCCCAAAATTGTGAAAAAACCTTGGAAAAGGAAGTGGAAAT
  5   1   2       bld Ov1                             IMAGE:8330095.5p                                                      CTTGTGGCTCTGGAGAATGCATTCACAAGGCATTTCATTGGCACTGCACCTCTGGGGAGCAATGGGCTGGCGACCGCACTGCTCCAGTGACTCGTCCGAGTGGTCTGCCAATGAAATGCCTTGTGGCTCTGGAGAATGCATTCACAAAAAGTGGCGCTGTGATGGAGACGCAGATTGCAAGGACAAGAGTGATGAGATCAATTGCCCATCTCGCACTTGCCAACCAGACCAATTTAAATGTGAGGATGGAAATTGTATTCATGGCAGTAGACAATGCGATGGTGTGAGAGACTGCCTTGATGGCACTGATGAAATACGCTGTAAAAATGTCATTCAGTGCTCAGGACCTGGTAAATTCAAGTGCAAATCTGGAGAGTGCATCGAAAGTAACAAGGTTTGCAACAAGCATAAAGACTGCAAGGACTGGAGTGATGAGCCAGTAAAGGATTGTGAGGTTGATGAATGTCTGGAGAATAATGGTGGCTGTTCTCATATATGCCATGACCTGCCTATTGGCTATGAATGTGAATGCACTGCTGGCTTTAAGCTAATTGACCGGAAAACATGTGGAGATATTGACGAATGCCAAAATCCAGAAATCTGCAGCCAGATCTGTGTGAACCTGAGAAGAGGCTACAAATGTGAATGCAGTAAAGGATATCAGATGGATCCATCCACTGGTGTATGCAAAGCAATATGAAAGAAGCCATGTCTGATCTTCACCAACCGCAGGAA
  5   1   2       bld Bla1      in                    IMAGE:3379533.5p                                                                                                                                                                                                                                  CCGGGCAAGGACAAGAGTGATGAGATCAATTGCCCATCTCGCACTTGCCAACCAGACCAATTTAAATGTGAGGATGGAAATTGTATTCATGGCAGTAGACAATGCGATGGTGTGAGAGACTGCCTTGATGGCACTGATGAAATACGCTGTAAAAATGTTATTCAGTGCTCAGGACCTGNTAAATTCAAGTGCAAATCTGGAGAGTGCATCGAAAGTAACAAGGTTTGCAACAAGCATAAAGACTGCAAGGACTGGAGTGATGA
  5   1   2      seed Kid                             IMAGE:4031288.5p                                                                                                                                                                                                                                                                                                       GAGGATGGAAATTGTATTCATGGCAGTAGACAATGCGATGGTGTGAGAGACTGCCTTGATGGCACTGATGAAATACGCTGTAAAAATGTCATTCAGTGCTCAGGACCTGGTAAATTCAAGTGCAAATCTGGAGAGTGCATCGAAAGTAACAAGGTTTGCAACAAGCATAAAGACTGCAAGGACTGGAGTGATGAGCCAGTAAAGGATTGTGAGGTTGATGAATGTCTGGAGAATAATGGTGGCTGTTCTCATATATGCCATGACCTGCCTATTGGCTATGAATGTGAATGCACTGCTGGCTTTAAGCTAATTGACCGGAAAACATGTGGAGATATTGACGAATGCCAAAATCCAGAAATCTGCAGCCAGATCTGTGTGAACCTGAAAGGAGGCTACAAATGTGAATGCAGTAAAGGATATCAGATGGATCCATCCACTGGTGTATGCAAGGCAGTAGGAAGGGAGCCATGTCTGATCTTCACCAACCGCAGGGATATCCGGAAGGTTGGACTTGAAAGGAAAGAATACATCCAGCTGGTGGAGCAGTTGAGGAATACAGTAGCACTGGACGCTGATATAAAAGAACAAAGCTTATTCTGGGCAGACACTATCCAGAAAGCCATTTTTCGTGCCCCATTTGACACCCGGGAAAAAGTAGGCTCCCATGTCAAGGTTGTGGAAGATGTGCACAGTCCATCAGCAATTGCAATTGACTGGATCTACAAAAATATATATGGGATAGATACTATTTTAAAGAACATTTCCTGTGTCTAATTTTGGAGGGTTCCAAAAGGAAAAACCATGTTTCATTTCCAAGCTGCAAAAACCCTACCCTCCCATTGGCGGGTTGATCCACATAATCTGGGGGTTAATTTAACTGGGGCCTGGACCTGGGGAAGAAACCCTTGCCCAAAATTGTGAAAAAACCTTGGAAAAGGAAGTGGAAATTAAA
  5   1   2      ests                      Xl3.1-IMAGE:6317980-IMAGp.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCATCCACTGGTGTATGCAAGGCAGTAGGAAGGGAGCCATGTCTGATCTTCACCAACCGCAGGGATATCCGGAAGGTTGGACTTGAAAGGAAAGAATACATCCAGCTGGTGGAGCAGTTGAGGAATACAGTAGCACTGGACGCTGATATAAAAGAACAAAGCTTATTCTGGGCAGACACTATCCAGAAAGCCATTTTTCGTGCCCCATTTGACACCCGGGAAAAAGTAGGCTCCCATGTCAAGGTTGTGGAAGATGTGCACAGTCCATCAGCAATTGCAATTGACTGGATCTACAAAAATATATATTGGATAGATACTATTTTAAAGACCATTTCTGTGTCTAATTTTGATGGCTCCAAAAGGAAAACCTTGTTCAGTTCAGAGCTGCAAGATCTAACCTCCATTGCGGTTGATCCAATATCTGGGTTTATTTACTGGTCTGACTGTGGAGAGCCTGCCAAAATTGAAAAAGCTGGAATGAATGGAATAGACAGACAACAGTTGATAACAGCAGATGTGCAAAGACCTAGTGGCATTGCAATTGATGTGGTAAAAAGCCGTTTATATTGGGTTGATTCCAAACTGCATACACTCTCTAGTGTGGACCTCAATGGTCAGGATCGCAGAGTCATTCTGAAATCTCATGAATTCCTTGCTCATCCTCTTGCACTTACTATATTTGAGGATCGTGTCTACTGGATTGATGGTGAGAATGAAGCAATCTATGGGGCCAACAAATTTTCTGGGCAAGAGCTTGAAACTTTAGTCAATAATTTAAATGATGCCCAAGATATAATAGTCTACCATGAACTCATCCAACCCCTAGGTATAAACTGGTGCAATGAACAGATAGAAAATGGCGGCTGTAAATATCTGTGTTTACCGGCTCCGCAGATAAGTGATCGTTCACCCAAGTATACTTGTGCTTGTCCTGATGGCTTTGAAGTACATGAAGGAAGGAGCTGCAGAGCAGGTAGTAAAGCTACTATGGACCACCCTGTCAAACCTACAGGAATAATGCCTAATAAACCACTTCCAAGTGGTAATAATGACACTGCTTCTGTGTATGAAGTAAATCAGTCTGCCAAAGGGACCTCTGCTGCATGGGCAATCCTTCCCCTTTTGTTAATAGCAATGGCGGCTTCTGGGGGTTACCTGATGTGGCGCAACTGGCAA
                                                  Xl3.1-CHK-1012697491                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACTGGTGTATGCAAGGCAGTAGGAAGGGAGCCATGTCTGATCTTCACCAACCGCAGGGATATCCGGAAGGTTGGACTTGAAAGGAAAGAATACATCCAGCTGGTGGAGCAGTTGAGGAATACAGTAGCACTGGACGCTGATATAAAAGAACAAAGCTTATTCTGGGCAGACACTATCCAGAAAGCCATTTTTCGTGCCCCATTTGACACCCGGGAAAAAGTAGGCTCCCATGTCAAGGTTGTGGAAGATGTGCACAGTCCATCAGCAATTGCAATTGACTGGATCTACAAAAATATATATTGGATAGATACTATTTTAAAGACCATTTCTGTGTCTAATTTTGATGGCTCCAAAAGGAAAACCTTGTTCAGTTCAGAGCTGCAAGATCTAACCTCCATTGCGGTTGATCCAATATCTGGGTTTATTTACTGGTCTGACTGTGGAGAGCCTGCCAAAATTGAAAAAGCTGGAATGAATGGAATAGACAGACAACAGTTGATAACAGCAGATGTGCAAAGACCTAGTGGCATTGCAATTGATGTGGTAAAAAGCCGTTTATATTGGGTTGATTCCAAACTGCATACACTCTCTAGTGTGGACCTCAATGGTCAGGATCGCAGAGTCATTCTGAAATCTCATGAATTCCTTGCTCATCCTCTTGCACTTACTATATTTGAGGATCGTGTCTACTGGATTGATGGTGAGAATGAAGCAATCTATGGGGCCAACAAATTTTCTGGGCAAGAGCTTGAAACTTTAGTCAATAATTTAAATGATGCCCAAGATATAATAGTCTACCATGAACTCATCCAACCCCTAGGTATAAACTGGTGCAATGAACAGATAGAAAATGGCGGCTGTAAATATCTGTGTTTACCGGCTCCGCAGATAAGTGATCGTTCACCCAAGTATACTTGTGCTTGTCCTGATGGCTTTGAAGTACATGAAGGAAGGAGCTGCAGAGCAGGTAGTAAAGCTACTATGGACCACCCTGTCAAACCTACAGGAATAATGCCTAATAAACCACTTCCAAGTGGTAATAATGACACTGCTTCTGTGTATGAAGTAAATCAGTCTGCCAAAGGGACCTCTGCTGCATGGGCAATCCTTCCCCTTTTGTTAATAGCAATGGCGGCTTCTGGGGGTTACCTGATGTGGCGCAACTGGCAACGGAAA
  3   1   2       bld Bla1      in                    IMAGE:3379533.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTGGCTATGAATGTAAACGCACTGCGGGCTTTAAGCTAATTGACCGGAAAACATGTGGAGATATGAACGAATGCCACAATCCAACAATCTGCAGCCAGATCTGTGTGAACCTGAAAGGAGGCTACAAATGTGAATGCAGCAAAGGATATCAGATGGATCCATCCACTGGTGTATGCAAGGCAGTAGGAAGGGAGCCATGTCTGATCTTCACCAACCGCAGGGATATCCGGAAGGTTGGACTTGAAAGGAAAGAATACATCCAGCTGGTGGAGCAGTTGAGGAATACAGTAGCACTGGACGCTGATATAAAAGAACAAAGCTTATTCTGGGCAGACACTATCCAGAAAGCCATTTTTCGTGCCCCATTTGACACCCGGGAAAAAGTAGGCTCCCATGTCAAGGTTGTGGAAGATGTGCACAGTCCATCAGCAATTGCAATTGACTGGATCTACAAAAATATATATTGGATAGATACTAGTTTAAAGACCATTTCTGTGTCTAATTTTGATGGCTCCAAAAGGAAAACCTTGTTCAGTTCAGAGCTGCAAGATCTAACCTCCATTGCGGTTGATCCAATATCTGGGTTTATTTACT
  5   1   2       bld Ov1       in                    IMAGE:8329589.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCATCCACTGGTGTATGCAAGGCAGTAGGAAGGGAGCCATGTCTGATCTTCACCAACCGCAGGGATATCCGGAAGGTTGGACTTGAAAGGAAAGAATACATCCAGCTGGTGGAGCAGTTGAGGAATACAGTAGCACTGGACGCTGATATAAAAGAACAAAGCTTATTCTGGGCAGACACTATCCAGAAAGCCATTTTTCGTGCCCCATTTGACACCCGGGAAAAAGTAGGCTCCCATGTCAAGGTTGTGGAAGATGTGCACAGTCCATCAGCAATTGCAATTGACTGGATCTACAAAAATATATATTGGATAGATACTATTTTAAAGACCATTTCTGTGTCTAATTTTGATGGCTCCAAAAGGAAAACCTTGTTCAGTTCAGAGCTGCAAGATCTAACCTCCATTGCGGTTGATCCAATATCTGGGTTTATTTACTGGTCTGACTGTGGAGAGCCTGCCAAAATTGAAAAAGCTGGAATGAATGGAATAGACAGACAACAGTTGATAACAGCAGATGTGCAAAGACCTAGTGGCATTGCAATTGATGTGGTAAAAAGCCGTTTATATTGGGTTGATTCCAAACTGCATACACTCTCTAGTGTGGACCTCAATGGTCAGGATCGCAGAGTCATTCTGAAATCTCATGAATTCCTTGCTCATCCTCTTGCACTTACTATATTTGAGGATCGTGTC
  5   1   2       bld Ooc3      in                    IMAGE:3437697.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGAATACATCCAGCTGGTGGAGCAGTTGAGGAATACAGTAGCACTGGATGCATTCTTTACTTAACAGAGCTTCTTCTGGGCTGACACTATCCAGAAAGCCATTTATGCGAGCCCCCTTTGACACCCGGGAAAAAGTAGGCTCCCATGTCAAGGTTGTGGAAGATGTGCACAGTCCATCAGCAATTGCAATTGACTGGATCTACAAAAATATATATTGGATAGATACTATTTTAAAGACCATTTCTGTGTCTAATTTTGATGGCTCCAAAAGGAAAACCTTGTTCAGTTCAGAGCTGCAAGATCTAACCTCCATTGCGGTTGATCCAATATCTGGGTTTATTTACTGGTCTGACTGTGGAGAGCCTGCCAAAATTGAAAAAGCTGGAATGAATGGAATAGACAGACAACAGTTGATAACAGCAGATGTGCAAAG
  5   1   2      seed Ov1                    IMAGE:6317980-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCACAGTCCATCAGCAATTGCAATTGACTGGATCTACAAAAATATATATTGGATAGATACTATTTTAAAGACCATTTCTGTGTCTAATTTTGATGGCTCCAAAAGGAAAACCTTGTTCAGTTCAGAGCTGCAAGATCTAACCTCCATTGCGGTTGATCCAATATCTGGGTTTATTTACTGGTCTGACTGTGGAGAGCCTGCCAAAATTGAAAAAGCTGGAATGAATGGAATAGACAGACAACAGTTGATAACAGCAGATGTGCAAAGACCTAGTGGCATTGCAATTGATGTGGTAAAAAGCCGTTTATATTGGGTTGATTCCAAACTGCATACACTCTCTAGTGTGGACCTCAATGGTCAGGATCGCAGAGTCATTCTGAAATCTCATGAATTCCTTGCTCATCCTCTTGCACTTACTATATTTGAGGATCGTGTCTACTGGATTGATGGTGAGAATGAAGCAATCTATGGGGCCAACAAATTTTCTGGGCAAGAGCTTGAAACTTTAGTCAATAATTTAAATGATGCCCAAGATATAATAGTCTACCATGAACTCATCCAACCCCTAGGTATAAACTGGTGCAATGAACAGATAGAAAATGGCGGCTGTAAATATCTGTGTTTACCGGCTCCGCAGATAAGTGATCGTTCACCCAAGTATACTTGTGCTTGTCCTGATGGCTTTGAAGTACATGAAGGAAGGAGCTGCAGAGCAGGTAGTAAAG
  5   1   2       bld Ov1                             IMAGE:6317980.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACAGTCCATCAGCAATTGCAATTGACTGGATCTACAAAAATATATATTGGATAGATACTATTTTAAAGACCATTTCTGTGTCTAATTTTGATGGCTCCAAAAGGAAAACCTTGTTCAGTTCAGAGCTGCAAGATCTAACCTCCATTGCGGTTGATCCAATATCTGGGTTTATTTACTGGTCTGACTGTGGAGAGCCTGCCAAAATTGAAAAAGCTGGAATGAATGGAATAGACAGACAACAGTTGATAACAGCAGATGTGCAAAGACCTAGTGGCATTGCAATTGATGTGGTAAAAAGCCGTTTATATTGGGTTGATTCCAAACTGCATACACTCTCTAGTGTGGACCTCAATGGTCAGGATCGCAGAGTCATTCTGAAATCTCATGAATTCCTTGCTCATCCTCTTGCACTTACTATATTTGAGGATCGTGTCTACTGGATTGATGGTGAGAATGAAGCAATCTATGGGGCCAACAAATTTTCTGGGCAAGAGCTTGAAACTTTAGTCAATAATTTAAATGATGCCCCAGATATAATAGTCTACCATGAACTCATCCAACCCCTAGGTATAAACTGGTGCCATGAACAGATAGAAAATGGCGGCTGTAAATATCTGTGTTTACCGGCTCCGCAGATAAATGATCGTTCACCCAAGTAATACTTGTGCTTGTCCTGAGGGCTTTTAAGTACCTGAAAGGAAGGAGCTGCACAACCAGGTAATAAAGGCTACTATGGAACCCCCCTGTCAAACCTAACAGGAATAATTGCCTAATAAACCACTTTCCCAGGGGGAAATAATGAACCCTGCCTTCTTGTGGATTGAAAGTAAACTCCGTCCTGGCAAAAAGGAACCCTCCTGGCTGCATGTGGGCAAATCCCTTCCCCCCTTTTTGTTAAAAAAACAAAGGGCGGGGGCTTTCTTGGAGGGGTTAACCCTTGAATGGTGGGCGGCCAACTTGGGGgaaaaccggaaaaaaatttttgtaaaaaaCGT
  5   1   2       bld Ooc1      in                     Ooc1-db26b06.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  gggtcgacccacgcgtccgcccacgcgtccgTATTTTAAAGACCATTTCTGTGTCTAATTTTGATGGCTCCAAAAGGAAAACCTTGTTCAGTTCAGAGCTGCAAGATCTAACCTCCATTGCGGTTGATCCAATATCTGGGTTTATTTACTGGTCTGACTGTGGAGAGCCTGCCAAAATTGAAAAAGCTGGAATGAATGGAATAGACAGACAACAGTTGATAACAGCAGATGTGCAAAGACCTAGTGGCATTGCAATTGATGTGGTAAAAAGCCGTTTATATTGGGTTGATTCCAAACTGCATACACTCTCTAGTGTGGACCTCAATGGTCAGGATCGCAGAGTCATTCTGAAATCTCATGAATTCCTTGCTCATCCTCTTGCACTTACTATATTTGAGGATCGTGTCTACTGGATTGATGGTGAGAATGAAGCAATCTATGGGGCCAACAAATTTTCTGGGCAAGAGCTTGAAACTTTAGTCAATAATTTAAATGATGCCCAAGATATAATAGTCTACCATGAACTCATCCAACCCCTAGGTATAAACTGGTGCAATGAACAGATAGAAAATGGCGGCTGTAAATATCTGTGTNTACCCGGCTCCGCAAGATAAGTGATCGTTCACCCCAGT
  5   1   2       bld Egg1                               PBX0154F09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CACGAGGATTTTGATGGCTCCAAAAGGAAAACCTTGTTCAGTTCAGAGCTGCAAGATCTAACCTCCATTGCGGTTGATCCAATATCTGGGTTTATTTACTGGTCTGACTGTGGAGAGCCTGCCAAAATTGAAAAAGCTGGAATGAATGGAATAGACAGACAACAGTTGATAACAGCAGATGTGCAAAGACCTAGTGGCATTGCAATTGATGTGGTAAAAAGCCGTTTATATTGGGTTGATTCCAAACTGCATACACTCTCTAGTGTGGACCTCAATGGTCAGGATCGCAGAGTCATTCTGAAATCTCATGAATTCCTTGCTCATCCTCTTGCACTTACTATATTTGAGGATCGTGTCTACTGGATTGATGGTGAGAATGAAGCAATCTATGGGGCCAACAAATTTTCTGGGCAAGAGCTTGAAACTTTAGTCAATAATTTAAATGATGCCCAAGATATAATAGTCTACCATGAACTCATCCAACCCCTAGGTATAAACTGGTGCAATGAACAGATAGAAAATGGCGGCTGTAAATATCTGTGTTTACCGGCTCCGCAGATAAGTGATCGTTCACCCAAGTATACTTGTGCTTGTCCTGATGGCTTTGAAGTACATGAAAGAAGGAGCTGCAGAGCAGGTAGTAAAGCTACTATGGACCACCCTGTCAAACCTACAGGAATAATG
  5   1   2       bld Ov1                             IMAGE:6318596.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCTTGATGGTGNAATGAAGAATCTATGGGGCCAACAAATTTTCTGGGCAAGAGCTTGAAACTTTAGTCAATAATTTAAATGATGCCCAAGATATAATAGTCTACCATGAACTCATCCAACCCCTAGGTATAAACTGGTGCAATGAACAGATAGAAAATGGCGGCTGTAAATATCTGTGTTTACCGGCTCCGCAGATAAGTGATCGTTCACCCAAGTATACTTGTGCTTGTCCTGATGGCTTTGAAGTACATGAAGGAAGGAGCTGCAGAGCAGGTAGTAAAGCTACTATGGACCACCCTGTCAAACCTACAGGAATAATGCCTAATAAACCACTTCCAAGTGGTAATAATGACACTGCTTCTGTGTATGAAGTAAATCAGTCTGCCAAAGGGACCTCTGCTGCATGGGCAATCCTTCCCCTTTTGTTAATAGCAATGGCGGCTTCTGGGGGTTACCTGATGTGGCGCAACTGGCAACGGAAAAATATGAAAAGCATGAACTTCGATAATCCAGTGTACTTAAAAACAACAGAGGAGGACTTGGCAATAGATATTGGAAGGCATAGTGGGAATATAGGCCACACCATATCCAGCAATCTCTGTTGTAAACACAGATGACGACTTGTCCTGAGTTTGGGTATTCTTGAATTGGCATTCACCATCCTCCTTTAGAACTACCCCTGCTTCAACAGGGATTCTTGGTGGTATTCTGGATGGTAAACCACACCCAGTGGCTGAAACTACTTTGTCCTTTGTTCCCCAACCCTCCCATGAATAGCCATGGTGCCCCGAAAAAAACCCCGGTGGAAAGAATGTGGAAACAGAACCCACGTTCCCTTACAAGTGTGGAAAAAACCTCTTTGGTAAAAAAACTGTCATCCCCAACCGGGGG
  5   1   2       bld Ooc1      in                     Ooc1-db22b03.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGTCGACCCACGCGTCCGCAAATTTTCTGGGCAAGAGCTTGAAACTTTAGTCAATAATTTAAATGATGCCCAAGATATAATAGTCTACCATGAACTCATCCAACCCCTAGGTATAAACTGGTGCAATGAACAGATAGAAAATGGCGGCTGTAAATATCTGTGTTTACCGGCTCCGCANATAAGTGATCGTTCACCCAAATATACTTGTGCTTGTCCTGATGGCTTTGAAGTACATGAAGGAAGGAGCTGCAGAGCAGGTAGTAAAGCTACTATGGACCACCCTGTCAAACCTACAGGAAATATGCCTAATAAACCACTTCCAAGTGGTAATAATGACACTGCTTCTGTGTATGAAGTAAATCATTCTGCCAAAGGGACCTTTGCTGCATGGGCAATCCTTCCCCTTTTGTTAATAGCAATGGCGGCTTCTGGGGGGTACCTGATGTGGCGCAACTGGCAACGGAAAATATGAAAAGCATGAACTTCGATTATTCAATGTACTTTAAAACCACAGAAGAAGACTTGGCCAATANATATTGGAAGGCATAGTGGGAAATATAAGCCACACATATTTCACCAATTTCTTGTGTTAACACA
  5  -1   2      3-95                            Xl3.1-IMAGE:7202810.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCATTTCAAGCACTTTTGTCTGCAATAGCCAGAATGACTGCAGTGATGGAAGTGACGAAGAGAACTGTGTTGCTTCCACTTGTGGAGCTCATGAGTTTCAGTGCAAGAATTCCTCCTGCATCCCTCTTAGCTGGGTTTGTGATAAGGATTTTGATTGTACAGACCGCTCCGATGAGTCACTGGAGCAGTGCGGTCACCAGCCCATTGCTCCCCAGAGGTGCAGCCCCAATGAAATGCCTTGTGGCTCTGGAGAATGCATACACAAAAAGTGGCGCTGTGATGGAGACCCAGATTGCAAGGACAAGAGTGATGAGATGAATTGCCCATCTCGCACTTGCCAACCAGACCAATTTAAATGTGAGGATGGAAATTGTATTCATGGCAGTAGACAATGCGATGGTGTGAGAGACTGCCTTGATGGCACTGATGAAATACGCTGTAAAAATGTCAATCAGTGCTCAGGACCTGGCAAATTCAAGTGCATATCTGGAGAGTGCATTGATAGTAACAAGGTTTGCAACAAGCATAAAGACTGCAAGGACTGGAGTGATGAGCCAGTAAAGGATTGTGCGATTGATGAATGTTTGGTGAATAACGGTGGTTGTTCCCATACATGCCTTGACCTGCCAATTGGCTATGAATGTGAATGCACTGCTGGCTTTAAGCTAATTGACCGGAAAACATGTGGAGATATTGACGAATGCCAAAATCCAGAAATCTGCAGCCAGATCTGTGTGAACCTGAAAGGAGGCTACAAATGTGAATGCAGTAAAGGATATCAGATGGATCCATCTACTGGTGTATGCAAGGCAATAGGAAGGGAGCCATGTCTGATATTCGCCAACCGCAGAGATATCCGGAAGGTTGGACTTGAAAGGAAAGAATACATCCAGTTGGTGGAGCAGTTGAGGAATACAGTAGCTCTGGACGCTGATATAAAAGAACAAAGCTTGTTCTGGGCAGATACTATTCAGAAAGCCATCTTCCGTGCCCCATTTGACACCCGGGAAAAAGTAGGCACCCATGTCAAGGTTGTGGAGAACGTGCACAGTCCATCAGCAATAGCAATTGACTGGATCTACAAAAATAAT
                                                  Xl3.1-CHK-1012712435                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCCGCTGCATTTCAAGCACTTTTGTCTGCAATAGCCAGAATGACTGCAGTGATGGAAGTGACGAAGAGAACTGTGTTGCTTCCACTTGTGGAGCTCATGAGTTTCAGTGCAAGAATTCCTCCTGCATCCCTCTTAGCTGGGTTTGTGATAAGGATTTTGATTGTACAGACCGCTCCGATGAGTCACTGGAGCAGTGCGGTCACCAGCCCATTGCTCCCCAGAGGTGCAGCCCCAATGAAATGCCTTGTGGCTCTGGAGAATGCATACACAAAAAGTGGCGCTGTGATGGAGACCCAGATTGCAAGGACAAGAGTGATGAGATGAATTGCCCATCTCGCACTTGCCAACCAGACCAATTTAAATGTGAGGATGGAAATTGTATTCATGGCAGTAGACAATGCGATGGTGTGAGAGACTGCCTTGATGGCACTGATGAAATACGCTGTAAAAATGTCAATCAGTGCTCAGGACCTGGCAAATTCAAGTGCATATCTGGAGAGTGCATTGATAGTAACAAGGTTTGCAACAAGCATAAAGACTGCAAGGACTGGAGTGATGAGCCAGTAAAGGATTGTGCGATTGATGAATGTTTGGTGAATAACGGTGGTTGTTCCCATACATGCCTTGACCTGCCAATTGGCTATGAATGTGAATGCACTGCTGGCTTTAAGCTAATTGACCGGAAAACATGTGGAGATATTGACGAATGCCAAAATCCAGAAATCTGCAGCCAGATCTGTGTGAACCTGAAAGGAGGCTACAAATGTGAATGCAGTAAAGGATATCAGATGGATCCATCTACTGGTGTATGCAAGGCAATAGGAAGGGAGCCATGTCTGATATTCGCCAACCGCAGAGATATCCGGAAGGTTGGACTTGAAAGGAAAGAATACATCCAGTTGGTGGAGCAGTTGAGGAATACAGTAGCTCTGGACGCTGATATAAAAGAACAAAGCTTGTTCTGGGCAGATACTATTCAGAAAGCCATCTTCCGTGCCCCATTTGACACCCGGGAAAAAGTAGGCACCCATGTCAAGGTTGTGGAGAACGTGCACAGTCCATCAGCAATAGCAATTGACTGGATCTACAAA
  3  -1   2      seed Egg1                            IMAGE:3301834.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCGGCCGCTGCATTTCAAGCACTTTTGTCTGCAATAGCCAGAATGACTGCAGTGATGGAAGTGACGAAGAGAACTGTGTTGCTTCCACTTGTGGAGCTCATGAGTTTCAGTGCAAGAATTCCTCCTGCATCCCTCTTAGCTGGGTTTGTGATAAGGATTTTGATTGTACAGACCGCTCCGATGAGTCACTGGAGCAGTGCGGTCACCAGCCCATTGCTCCCCAGAGGTGCAGCCCCAATGAAATGCCTTGTGGCTCTGGAGAATGCATACACAAAAAGTGGCGCTGTGATGGAGACCCAGATTGCAAGGACAAGAGTGATGAGATGAATTGCCCATCTCGCACTTGCCAACCAGACCAATTTAAATGTGAGGATGGAAATTGTATTCATGGCAGTAGACAATGCGATGGTGTGAGAGACTGCCTTGATGGCACTGATGAAATACGCTGTAAAAATGTCAATCAGTGCTCAGGACCTGGCAAATTCAAGTGCATATCTGGAGAGTGCATTGATAGTAACAAGGTTTGCAACAAGCATAAAGACTGCAAGGACTGGAGTGATGAGCCAG
  3  -1   2       bld Ov1       in                    IMAGE:5049081.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCATTTCAAGCACTTTTGTCTGCAATAGCCAGAATGACTGCAGTGATGGAAGTGACGAAGAGAACTGTGTTGCTTCCACTTGTGGAGCTCATGAGTTTCAGTGCAAGAATTCCTCCTGCATCCCTCTTAGCTGGGTTTGTGATAAGGATTTTGATTGTACAGACCGCTCCGATGAGTCACTGGAGCAGTGCGGTCACCAGCCCATTGCTCCCCAGAGGTGCAGCCCCAATGAAATGCCTTGTGGCTCTGGAGAATGCATACACAAAAAGTGGCGCTGTGATGGAGACCCAGATTGCAAGGACAAGAGTGATGAGATGAATTGCCCATCTCGCACTTGCCAACCAGACCAATTTAAATGTGAGGATGGAAATTGTATTCATGGCAGTAGACAATGCGATGGTGTGAGAGACTGCCTTGATGGCACTGATGAAATACGCTGTAAAAATGTCAATCAGTGCTCAGGACCTGGCAAATTCAAGTGCATATCTGGAGAGTGCATTGATAGTAACAAGGTTTGCAACAAGCATAAAGACTGCAAGGACTGGAGTGATGAGCCAGTAAAGGATTGTGCGATTGATGAATGTTTGGTGAATAACGGTGGTTGTTCCCATACA
  5  -1   2       bld Te2N                            IMAGE:7202810.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGCGATGGTGTGAGAGACTGCCTTGATGGCACTGATGAAATACGCTGTAAAAATGTCAATCAGTGCTCAGGACCTGGCAAATTCAAGTGCATATCTGGAGAGTGCATTGATAGTAACAAGGTTTGCAACAAGCATAAAGACTGCAAGGACTGGAGTGATGAGCCAGTAAAGGATTGTGCGATTGATGAATGTTTGGTGAATAACGGTGGTTGTTCCCATACATGCCTTGACCTGCCAATTGGCTATGAATGTGAATGCACTGCTGGCTTTAAGCTAATTGACCGGAAAACATGTGGAGATATTGACGAATGCCAAAATCCAGAAATCTGCAGCCAGATCTGTGTGAACCTGAAAGGAGGCTACAAATGTGAATGCAGTAAAGGATATCAGATGGATCCATCTACTGGTGTATGCAAGGCAATAGGAAGGGAGCCATGTCTGATATTCGCCAACCGCAGAGATATCCGGAAGGTTGGACTTGAAAGGAAAGAATACATCCAGTTGGTGGAGCAGTTGAGGAATACAGTAGCTCTGGACGCTGATATAAAAGAACAAAGCTTGTTCTGGGCAGATACTATTCAGAAAGCCATCTTCCGTGCCCCATTTGACACCCGGGAAAAAGTAGGCACCCATGTCAAGGTTGTGGAGAACGTGCACAGTCCATCAGCAATAGCAATTGACTGGATCTACAAAAATAAT
  5   1   2      ests                            Xl3.1-IMAGE:8329589.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAAATATGAAAAGCATGAACTTCGATAATCCAGTGTACTTAAAAACAACAGAGGAGGACTTGGCAATAGATATTGGAAGGCATAGTGGGAATATAGGCCACACATATCCAGCAATCTCTGTTGTAAACACAGATGACGACTTGTCCTGAGTTTGGTTATTCTTGATTGGCATTCACCATCCTCCTTTAGACTACACTGCTTCAACAGGGATTTTGTTGTATTCTGGATGGTAACCACACCAGTGGCTGAACTACTTGTCTTTGTCCACAACCATCCATGAGAGCATGTGCACAGAAGAGTCGTGTGAAGATGTGAACAGACACACTCCCTACATGGGAGACCTCTTGTAAATATTCATCAACTGTGTTCAGCGCTTGATATCGTTACCTCTAAACTATTTGCTCCCAAACTTTTTGTTTCTTCTTACCATCTACCTTTTTTCCCCCCTCAGTATTAAAACCAATACTTTAATAGGTCAAGTACTGTACAAAGCACTTTCCATAGAAAGCCATATTCCAGAAATTGTGCTGTATGTAGTAAGTTATCCTGTACATATGTGTAAAGGCAGTTTGTACATATCCTTAAAGAACACAATCACAATTCTGAAGCACTTTGAAATATTTCAACTGTAAATATGTATCTGTAAACATTTTTGGGTTTTTCATTTATTTTTCCAATGGTTGGGGCAAATGGCAATAGACAAAATTACAAACGGGTTATACATAACAAATTGCCAAATAATTTCTAAACTTAAAGAATTTTGTATGTGTGAATGCAACTGTAAATCTGTCTTGACTGACCTTTTTTATAGAGGTATGCAGAGGGTTTACTCCCTATTAAAACCACTGGAGAATCTTTTCAGAATTAAAATGAACTATGTATTTACAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012688915                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATGAAAAGCATGAACTTCGATAATCCAGTGTACTTAAAAACAACAGAGGAGGACTTGGCAATAGATATTGGAAGGCATAGTGGGAATATAGGCCACACATATCCAGCAATCTCTGTTGTAAACACAGATGACGACTTGTCCTGAGTTTGGTTATTCTTGATTGGCATTCACCATCCTCCTTTAGACTACACTGCTTCAACAGGGATTTTGTTGTATTCTGGATGGTAACCACACCAGTGGCTGAACTACTTGTCTTTGTCCACAACCATCCATGAGAGCATGTGCACAGAAGAGTCGTGTGAAGATGTGAACxxxxxxxxxxCCTACATGGGAGACCTCTTGTAAATATTCATCAACTGTGTTCAGCGCTTGATATCGTTACCTCTAAACTATTTGCTCCCAAACTTTTTGTTTCTTCTTACCATCTACCTTTTTTCCCCCCTCAGTATTAAAACCAATACTTTAATAGGTCAAGTACTGTACAAAGCACTTTCCATAGAAAGCCATATTCCAGAAATTGTGCTGTATGTAGTAAGTTATCCTGTACATATGTGTAAAGGCAGTTTGTACATATCCTTAAAGAACACAATCACAATTCTGAAGCACTTTGAAATATTTCAACTGTAAATATGTATCTGTAAACATTTTTGGGTTTTTCATTTATTTTTCCAATGGTTGGGGCAAATGGCAATAGACAAAATTACAAACGGGTTATACATAACAAATTGCCAAATAATTTCTAAACTTAAAGAATTTTGTATGTGTGAATGCAACTGTAAATCTGTCTTGACTGACCTTTTTTATAGAGGTATGCAGAGGGTTTACTCCCTATTAAAACCACTGGAGAATCTTTTCAGAATTAAAATGAACTATGTATTTACAAAAAAA
  5   1   2       bld Egg1                               PBX0159G07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCAAGTATACTTGTGCTTGTCCTGATGGCTTTGAAGTACATGAAGGAAGGAGCTGCAGAGCATGTAGTTTAGCTACTATGGACCACCCTGTCAAACCTACAGGAATAATGCCTAATAAACCACTTCCAAGTGGTAATAATGACACTGCTTCTGTGTATGAAGTAAATCAATCTGCCAAAGGGACCTCTGCTGCATGGGCAATCCTTCCCCTTTTGTTAATAGCAATGGCGGCTTCTGGGGGTTACCTGATGTGGCGCAACTGGCAACGGAAAAATATGAAAAGCATGAACTTCGATAATCCAGTGTACTTAAAAACAACAGAGGAGGACTTGGCAATAGATATTGGAAGGCATAGTGGGAATATAGGCCACACATATCCAGCAATCTCTGTTGTAAACACAGATGACGACTTGTCCTGAGTTTGGTTATTCTTGATTGGCATTCACCATCCTCCTTTAGACTACACTGCTTCAACAGGGATTTTGTCGTATTCTGGATGGTAACCACACCAGAGGCTGAACTACTTGTCTTTGTCCACAACCATCCATGAGAGCATGTGCACAGAAGAGTCGTGTGAAGATGTGAACAGACACACTC
  3  -1   2       bld Ov1                             IMAGE:5074713.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTAATTCTGAAAAAATTCTCCAATGGTTTTAATAGGGAATAAACCCTCTGCATACCTCTATAAAAAAGGTCAATCAAGACAAATTTACAGTTGCATTCACACATACAAAATTCTTTAACTTTAAAAATTACTTGGCAATACATATTGNAAAGCATAATGGGAATATAGGCCACACATATCCAACAATCTCTGTTGTAAACACATATGACAACTTGTCCTGACTTTGGTTATTCTTGATTGGCATTCACCATCCTCCTTTAAACTACACTGCTTCAACAAGGATTTTGTTGTATTCTGGATGGTAACCACACCAATGGCTGAACTACTTGTCTTTGTCCACAACCATCCATGAAATCATGTGCACAAA
  5   1   2       add Egg1                               PBX0049H10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGCAACAGAAAAATATGAAAAGCATGAATTTTGATAATCCAGTGTACTTAAAAACAACAGAGGAGGACCTGGCGATAGATATTGGAAGGCATAGTGGGAATATAAGCCACACATATGCAGCAATCTCTGTAGTAAACACAGATGATGACCTGTCCTGAGTATGGTCATTCTTGACTGGCATTCACCATGCTCCTTTAGACTACATTGCTTCAACAGGGATTTTGTTGTATTCTGGATGGTAACCACACCAGTGGCTGAACTTGTCCACCTCCCTCCACGAAGAGTCGTGTGAATGGACACACTACCTGCATTGGAGACCTCATGTGAATATTTATCAACTGCGTTCAGCTCTTGATATGGGTACCTCTAAACTATTCGCTCCCAAACCT
  5   1   2       bld Egg1                               PBX0118H10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAATATAGGCCACACATATCCAGCAATCTCTGTTGTAAACACAGATGACGACTTGTCCTGAGTTTGGTTATTCTTGATTGGCATTCACCATCCTCCTTTAGACTACACTGCTTCAACAGGGATTTTGTTGTATTCTGGATGGTAACCACACCAGTGGCTGAACTACTTGTCTTTGTCCACAACCATCCATGAGAGCATGTGCACAGAAGAGTCGTGTGAAGATGTGAACAGACACACTCCCTACATGGGAGACCTCTTGTAAATATTCATCAACTGTGTTCAGCGCTTGATATCGTTACCTCTAAACTATTTGCTCCCAAACTTTTTGTTTCTTCTTACCATCTACCTTTTTTCCCCCCTCAGTATTAAAACCAATACTTTAATAGGTCAAGTACTGTACAAAGCACTTTCCATAGAAAGCCATATTCCAGAAATTGTGCTGTATGTAGTAAGTTATCCTGTACATATGTGTAAAGGCAGTTTGTACATATCCTTAAAGAACACAATCACAATTCTGAAGC
  5   1   2       add Egg1                               PBX0119F10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACGAGGGATATTGGAAGGCATAGTGGGAATATAGGCCACACATATCCAGCAATCTCTGTTGTAAACACAGATTATGACCTGTCCTGAGTATGGTCATTCTTGACTGGCATTCACCATCCTCCTTTAGACTACATTGCTTCAACAGGGATTTTGTTGTATTCTGGATGGTAACCACACCAGTGGCTGAACTTGTCCACCTCCCTCCACGAAGAGTCGTGTGAATGGACACACTACCTGCATTGGAGACCTCATGTAAATATTTATCAACTGCGTTCAGCTCTTGATATGGTTACCTCTAAACTATTCGCTCCCAAACCTTTTGTCTCTTCTCATCATGttttttttCAGTATTAACACCGAATCCTTTAATAGGTCAAGTACTGTATAAAGCACTTTCCATAAAAAGCCATATCCCAGAAATTGTGTTGTATGTAGTAAGTTCACCTGTACATATGTGTATAGGCAGTTTGTACATATCCTTAGAAGAAACACAATCACAATTCTGAAGCACTTTGAAAATATTTAAATTGTAAATATGTGTCTGTAAACCtttttttgggtttttcatttatttt
  5   1   2       bld Egg1                            IMAGE:3300743.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCACGAGGCGACTTGTCCTGAGTTTGGTTATTCTGGATGGGCATTCACCATCCTCCTTTAGACTACACTGCTTCAACAGGGATTTTGTTGTATTCTGGATGGTAACCACACCAGTGGCTGAACTACTTGTCTTTGTCCACAACCATCCATGAGAGCATGTGCACAGAAGAGTCGTGTGAAGATGTGAACAGACACACTCCCTACATGGGAGACCTCTTGTAAATATTCATCAACTGTGTTCAGCGCTTGATATCGTTACCTCTAAACTATTTGCTCCCAAACTTTTTGTTTCTTCTTACCATCTACCTTTTTTCCCCCCTCAGTATTAAAACCAATACTTTAATAGGTCAAGTACTGTACAAAGCACTTTCCATAGAAAGCCATATTCCAGAAATTGTGCTGTATGTAGTAAGTTATCCTGTACATATGTGTAAAGGCAGTTTGTACATATCCTTAAAGAACACAATCACAATTCTGAAGCACTTTGGAATATTTCAACTGTAAATATGTATCTGTAAACATCTCTAGGTCTTTCATATATTTTTCCATCGGTTGGGCAAATGGCGCTATACAAGATGACAAACGGTTATACATAACAAATTGGCCAATAATTTCTAAA
  3   1   2       bld Ova2                            IMAGE:3198326.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGGATGGTACCACACCAGTGGCTGAACTACTGGTCTGTGTCCACAACATCCATGAGAGCATGTGCACAGAAGAGTCGTGTGAAGATGTGAACAGACACACTCCTTACATGGGAGACCTCTTGTAAATATTCATCAACTGTGTTCAGCGCTTGATATCGTTACCTCTAAACTATTTGCTCCCAAACTTTTTGTTTCTTCTTACCATCTACCTTTTCCCCCCTCAGTATTACAACCAATACTTTAATAGGTCAAGTACTGTACAAAGCACTTTCCATAGAAAGCCATATTCCAGAAATTGTGCTGTATGTAGTAAGTTATCCTGTACATATGTGTAAAGGCAGTTTGTACATATCCTTAGAAAGAACACAATCACAATTCTGAAGCACTTTGAAATATTTCAACTGTAAATATGTATCTGTAAACATTTTTGGGTTTTTCATTTATTTTTCCAATGGTTGGGGCAAATGGCAATAGACAAAATTACAAACGGGTTATACATAACAAATTGCCAAATAATTTCTAAACTTAAAGAATTTTGTATGTGTGAATGCAACTGTAAATCTGTCTTGACTGACCTTTTTTATAGAGGTATGCAGAGGGTTTACTCCCTATTAAAACCACTGGAGAATCTTTTCAGAATTAAAATGAACTATGTATTTAC
  3   1   2      seed Ov1       in                    IMAGE:8329589.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCACACCAGTGGCTGAACTACTTGTCTTTGTCCACAACCATCCATGAGAGCATGTGCACAGAAGAGTCGTGTGAAGATGTGAACAGACACACTCCCTACATGGGAGACCTCTTGTAAATATTCATCAACTGTGTTCAGCGCTTGATATCGTTACCTCTAAACTATTTGCTCCCAAACTTTTTGTTTCTTCTTACCATCTACCTTTTTCCCCCCTCAGTATTAAAACCAATACTTTAATAGGTCAAGTACTGTACAAAGCACTTTCCATAGAAAGCCATATTCCAGAAATTGTGCTGTATGTAGTAAGTTATCCTGTACATATGTGTAAAGGCAGTTTGTACATATCCTTAAAGAACACAATCACAATTCTGAAGCACTTTGAAATATTTCAACTGTAAATATGTATCTGTAAACATTTTTGGGTTTTTCATTTATTTTTCCAATGGTTGGGGCAAATGGCAATAGACAAAATTACAAACGGGTTATACATAACAAATTGCCAAATAATTTCTAAACTTAAAGAATTTTGTATGTGTGAATGCAACTGTAAATCTGTCTTGACTGACCTTTTTTATAGAGGTATGCAGAGGGTTTACTCCCTATTAAAACCACTGGAGAATCTTTTCAGAATTAAAATGAACTATGTATTTACAAAAAAAAAAAAAAAG
  3   1   2       bld Ooc1      in                     Ooc1-db22b03.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCATGAGAGCATGTGCACAGAGAGTTGGTGTGAAGATGTGAACAGCACACTCCCTTACATGGAAGACCTCTTGTAAATATTCATCAACTGTGTCAAGCGCTTGATATCGTTACCTCTAAACTATTTGCTCCCAAACTTTTTGTTTCTTCTTACCATCTACCTTTTCCCCCCTCAGTATTANAACCAATACTTTAATAGGTCAAGTACTGTACAAAGCACTTTCCATAGAAAGCCATATTCCAGAAATTGTGCTGTATGTAGTAAGTTATCCTGTACATATGTGTAAAGGCAGTTTGTACATATCCTTAGAAAGAACACAATCACAATTCTGAAGCACTTTGAAATATTTCAACTGTAAATATGTATCTGTAAACATTTTTGGGTTTTTCATTTATTTTTCCAATGGTTGGGGCAAATGGCAATAGACAAAATTACAAACGGGTTATACATAACAAATTGCCAAATAATTTCTAAACTTAAAGAATTTTGTATGTGTGAATGCAACTGTAAATCTGTCTTGACTGACCTTTTTTATAGAGGTATGCAGAGGGTTTACTCCCTATTAAAACCACTGGAGAATCTTTTCAGAATTAAAATGAACTATGTATTTACAAAAAAAAAA
  3   1   2       bld Ov1  5g3  out                   IMAGE:5074117.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGAGAGCATGTGCACAGAAGAGTCGTGTGAAGATGTGAACAGACACACTCCCTACATGGGAGACCTCTTGTAAATATTCATCAACTGTGTTCAGCGCTTGATATCGTTACCTCTAAACTATTTGCTCCCAAACTTTTTGTTTCTTCTTACCATCTACCTTTTTCCCCCCTCAGTATTAAAACCAATACTTTAATAGGTCAAGTACTGTACAAAGCACTTTCCATAGAAAGCCATATTCCAGAAATTGTGCTGTATGTAGTAAGTTATCCTGTACATATGTGTAAAGGCAGTTTGTACATATCCTTAAAGAACACAATCACAATTCTGAAGCACTTTGAAATATTTCAACTGTAAATATGTATCTGTAAACATTTTTGGGTTTTTCATTTATTTTTCCAATGGTTGGGGCAAATGGCAATAGACAAAATTACAAACGGGTTATACATAACAAATTGCCAAATAATTTCTAAACTTAAAGAATTTTGTATGTGTGAATGCAACTGTAAATCTGTCTTGACTGACCTTTTTTATAGAGGTATGCAGAGGGTTTACTCCCTATTAAAACCACTGGAGAATCTTTTCAGAATTAAAATGAGCTATGTATTTAC
  3   1   2       bld Ooc1      in                     Ooc1-db26b06.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGAGTCGGTGTGAATATGTGAACAGACTCACTCCCTACATGGGAGACCTCTTGTAAATATTCATCAACTGTGTTCAGCGCTTGATATCGTTACCTCTAAAATATTTGCTCCCAAACTTTTTGTTTCTTCTTACCATCTACCTTTTCCCCCCTCAGTATTAAAACCAATACTTTAATAGGTCAAGTACTGTACAAAGCACTTTCCATAGAAAGCCATATTCCAGAAATTGTGCTGTATGTAGTAAGTTATCCTGTACATATGTGTAAAGGCAGTTTGTACATATCCTTAGAAAGAACACAATCACAATTCTGAAGCACTTTGAAATATTTCAACTGTAAATATGTATCTGTAAACATTTTTGGGTTTTTCATTTATTTTTCCAATGGTTGGGGCAAATGGCAATAGACAAAATTACAAACGGGTTATACATAACAAATTGCCAAATAATTTCTAAACTTAAAGAATTTTGTATGTGTGAATGCAACTGTAAATCTGTCTTGACTGACCTTTTTTATAGAGGTATGCAGAGGGTTTACTCCCTATTAAAACCACTGGAGAATCTTTTCAGAATTAAAATGAACTATGTATTTACAAAAAAAAAAAAAAAAA
  3   1   2       bld Ov1  5x3  out                   IMAGE:5049407.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTGAAGATGTGAACAGACACACTCCCTACATGGGAGACCTCTTGTAAATATTCATCAACTGTGTTCAGCGCTTGATATCGTTACCTCTAAACTATTTGCTCCCAAACTTTTTGTTTCTTCTTACCATCTACCTTTCCCCCCTCAGTATTAAAACCAATACTTTAATAGGTCAAGTACTGTACAAAGCACTTTCCATAGAAAGCCATATTCCAGAAATTGTGCTGTATGTAGTAAGTTATCCTGTACATATGTGTAAAGGCAGTTTGTACATATCCTTAGAAAGAACACAATCACAATTCTGAAGCACTTTGAAATATTTCAACTGTAAATATGTATCTGTAAACATTTTTGGGTTTTTCATTTATTTTTCCAATGGTTGGGGCAAATGGCAATAGACAAAATTACAAACGGGTTATACATAACAAATTGCCAAATAATTTCTAAACTTAAAGAATTTTGTATGTGTGAATGCAACTGTAAATCTGTCTTGACTGACCTTTTTTATAGAGGTATGCAGAGGGTTTACTCCCTATTAAAACCACTGGAGAATCTTTTCAGAATTAAAATGAGGTATGAATTTCCAAA
  3   1   2       bld Ga12                                 XL155m19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAAATATTTATCAACTGCGTTCAGCTCTTGATATGGTTACCTCTAAACTATTCGCTCCCAAACCTTTTGTCTCTTCTCATCATGTTTTTTTTCAGTATTAACACCGAATCCTTTAATAGGTCAAGTACTGTATAAAGCACTTTCCATAAAAAGCCATATCCCAGAAATTGTGTTGTATGTAGTAAGTTCACCTGTACATATGTGTATAGGCAGTTTGTACATATCCTTAGAAGAAACACAATCACAATTCTGAAGCACTTTGAAAATATTTAAATTGTAAATATGTGTCTGTAAACCTTTTTTTGGGTTTTTCATTTATTTTTCCAATGGTTGGGGCAAATGGCAATAGACAANATGNCAAACGGGTTATACA
  3   1   2       bld Ov1  5g3  out                   IMAGE:5048491.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTGTTCAGCGCTTGATATCGTTACCTCTAAACTATTTGCTCCCAAACTTTTTGTTTCTTCTTACCATCTACCTTTTTCCCCCCTCAGTATTAAAACCAATACTTTAATAGGTCAAGTACTGTACAAAGCACTTTCCATAGAAAGCCATATTCCAGAAATTGTGCTGTATGTAGTAAGTTATCCTGTACATATGTGTAAAGGCAGTTTGTACATATCCTTAAAGAACACAATCACAATTCTGAAGCACTTTGAAATATTTCAACTGTAAATATGTATCTGTAAACATTTTTGGGTTTTTCATTTATTTTTCCAATGGTTGGGGCAAATGGCAATAGACAAAATTACAAACGGGTTATACATAACAAATTGCCAAATAATTTCTAAACTTAAAGAATTTTGTATGTGTGAATGCAACTGTAAATCTGTCTTGACTGACCTTTTTTATAGAGGTATGCAGAGGGTTTACTCCCTATTAAAACCACTGGAGAATCTTTTCAGAATTAAAATGAACTATGTATTTA
  3   1   2       bld Egg2                            IMAGE:5162025.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCAGCGCTTGATATCGTTACCTCTAAACTATTTGCTCCCAAACTTTTTGTTTTTTCTTACCATCTACCTTTTTTCCCCCCTCAGTATTAAAACCAATACTTTAATAGGTCAAGTACTGTACAAAGCCCTTTCCATAGAAAGCCATATTCCAGAAATTGTGCTGTATGTAGTAAGTTATCCTGTACATATGTGTAAAGGCAGTTTGTACATATCCTTAAAGACCCCAATCCCAATTTTGAAGCCCTTTGAAATATTTCACCTGTAAATATGTATCTGTAACCATTTTGGGGTTTTTCATTTATTTTTCCAAGGGTGGGGGCAAATGGCAATAGCCAAAATTCCAACCGGGTTATACATAACAAATTGCCAAATAATTTTTAAACTTAAAGAATTTTGTATGTGGGAATGCAACTGTAAATCTGTCTTGACTGCCCTTTTTTATAGAGGTATGCAGAGGGTTTACTCCCTATTAAAACCCCGGGGGAATCTTTTCAGAATTAAA
  5   1   2       bld Egg1                               PBX0138F05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACTTTTTGTTTCTTCTTACCATCTACCTTTTTTCCCCCCTCAGTATTAAAACCAATACTTTAATATGTCAAGTACTGTACAAAGCACTTTCCATAGAAAGCCATATTCCAGAAATTGTGCTGTATGTAGTAAGTTATCCTGTACATATGTGTAAAGGCAGTTTGTACATATCCTTAAAGAACACAATCACAATTCTGAAGCACTTTGAAATATTTCAACTGTAAATATGTATCTGTAAACatttttgggtttttcatttatttttCCAATGGTTGGGGCAAATGGCAATAGACAAAATTACAAACGGGTTATACATAACAAATTGCCAAATAATTTCTAAACTTAAAGAATTTTGTATGTGTGAATGCAACTGTAAATCTGTCTTGACTGACCTTTTTTATAGAGGTATGCAGAGGGTTTACTCCCTATTAAAACCACTGGAGAATCTTTTCAGAATTAAAATGAACTATGTATTTACaaaaaaaaaaaaaaaaaaGATTC
  3   1   2       bld Ov1  5g3  out                   IMAGE:5048064.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCTACCTTTTTCCCCCCTCAGTATTAAAACCAATACTTTAATAGGTCAAGTACTGTACAAAGCACTTTCCATAGAAAGCCATATTCCAGAAATTGTGCTGTATGTAGTAAGTTATCCTGTACATATGTGTAAAGGCAGTTTGTACATATCCTTAAAGAACACAATCACAATTCTGAAGCACTTTGAAATATTTCAACTGTAAATATGTATCTGTAAACATTTTTGGGTTTTTCATTTATTTTTCCAATGGTTGGGGCAAATGGCAATAGACAAAATTACAAACGGGTTATACATAACAAATTGCCAAATAATTTCTAAACTTAAAGAATTTTGTATGTGTGAATGCAACTGTAAATCTGTCTTGACTGACCTTTTTTATAGAGGTATGCAGAGGGTTTACTCCCTATTAAAACCACTGGAGAATCTTTTCAGAATTAAAATGAACTATGTATTTACA
  3   1   2       bld Ov1                             IMAGE:5048482.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAAAACCAATACTTTAATAGGTCAAGTACTGTACAAAGCACTTTCCATAGAAAGCCATATTCCAGAAATTGTGCTGTATGTAGTAAGTTATCCTGTACATATGTGTAAAGGCAGTTTGTACATATCCTTAAAGAACACAATCACAATTCTGAAGCACTTTGAAATATTTCAACTGTAAATATGTATCTGTAAACATTTTTGGGTTTTTCATTTATTTTTCCAATGGTTGGGGCAAATGGCAATAGACAAAATTACAAACGGGTTATACATAACAAATTGCCAAATAATTTCTAAACTTAAAGAATTTTGTATGTGTGAATGCAACTGTAAATCTGTCTTGACTGACCTTTTTTATAGAGGTATGCAGAGGGTTTACTCCCTATTAAAACCACTGGAGAATCTTTTCAGAATTATAATGAACTATGTATTTCCAAAAAAAAAAAA
  3   1   2       add Emb3                            IMAGE:3400781.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATAGGTCAAGTACTGTATAAAGCACTTTCCATAAAAAGCCATATCCCAGAAATTGTGTTGTATGTAGTAAGTTCACCTGTACATATGTGTATAGGCAGTTTGTACATATCCTTAGAAGAAACACAATCACAATTCTGAAGCACTTTGAAAATATTTAAATTGTAAATATGTGTCTGTAAACCTTTTTTTGGGTTTTTCATTTATTTTTCCAATGGTTGGGGCAAATGGCAATAGACAAAATGACAAACGGGTTATACATATCAAATTGCCAAATAATTTCTAAATTTAAAGAATTTTGTACTGTGTGAATGCAACTGTAAATCTGTCTTGACTGGCCTTTTTTATAGAGGTATGCAAAGGGGTTTCTCCCTGTTAAAAACCACTGGAGAATCTTTTCAGGATTAAAATGAACTATGTATTTAAAAAAAAAAA
  5  -1   2       add Ov1       in                    IMAGE:5049081.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTTCCATAAAAAGCCATATCCCAGAAATTGTGTTGTATGTAGTAAGTTCACCTGTACATATGTGTATAGGCAGTTTGTACATATCCTTAGAAGAAACACAATCACAATTCTGAAGCACTTTGAAAATATTTAAATTGTAAATATGTGTCTGTAAACCtttttttgggtttttcatttatttttcCAATGGTTGGGGCAAATGGCAATAGACAAAATGACAAACGGGTTATACATATCAAATTGCCAAATAATTTCTAAACTTAAAGAATTTTGTACTGTGTGAATGCAACTGTAAATCTGTCTTGACTGGCCTTTTTTATAGAGGTATGCAAAGGGGTTTCTCCCTGTTAAAAACCACTGGAGAATCTTTTCAGGATTAAAATGAACTATGTATTTaaaaaaaaaaaaaaagggcggccgcctttttttttttttttacaggataaaagtgtttttttttttctattttttGTAAAGACTAAAGCATCTCTATTTTCAAACAGCGCAGAATATGGCACCTTTAAATTGTCAGTGTGAAAACAGTGGCAAGATGTATATATGTCTGATAACTAAAATAAAATCTGGATAATGAGGACAGATTCTTTCGGACGCGTGG
  3   1   2       bld Ov1                             IMAGE:4055371.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAGCCATATTCCAGAAATTGTGCTGTATGTAGTAAGTTATCCTGTACATATGTGTAAAGGCAGTTTGTACATATCCTTAAAGAACACAATCACAATTCTGAAGCACTTTGAAATATTTCAACTGTAAATATGTATCTGTAAACATTTTTGGGTTTTTCATTTATTTTTCCAATGGTTGGGGCAAATGGCAATAGACAAAATTACAAACGGGTTATACATAACAAATTGCCAAATAATTTCTAAACTTAAAGAATTTTGTATGTGTGAATGCAACTGTAAATCTGTCTTGACTGACCTTTTTTATAGAGGTATGCAGAGGGTTTACTCCCTATTAAAACCACTGGAGAATCTTTTCAGAATTAAAATGAACTATGTATTT
  3   1   2       bld Ov1  5g3  out                   IMAGE:5073137.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCAGTTGTACATATCCTTAAAGAACACAATCACAATTCTGAAGCACTTTGAAATATTTCAACTGTAAATATGTATCTGTAAACATTTTTGGGTTTTTCATTTATTTTTCCAATGGTTGGGGCAAATGGCAATAGACAAAATTACAAACGGGTTATACATAACAAATTGCCAAATAATTTTTAAACTTAAAGAATTTTGTATGTGTGAATGCAACTGTAAATCTGTCTTGACTGACCTTTTTTATAGAGGTATGCAGAGGGTTTACTCCCTATTAAAACCACTGGAGAATCTTTTCAGAATTAAAATGAACTATGTATTTACAAAAAAAAAAAAAAAG
  3   1   2       bld Ooc3      in                    IMAGE:3437697.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CACAATTCTGAAGCACTTTGAAATATTTCAACTGTAAATATGTATCTGTAAACATTTTTGGGTTTTTCATTTATTTTTCCAATGGTTGGGGCAAATGGCAATACACAAAATTACAAACGGGTTATACAGAACAAATTGCCAAATAATTTCTAAATTTAAAGAATTTTGTATGTGTGAATGCAACTGTAAATCTGTCTTGACTGACCTTTTTTATAGAGGTATGCAGAGGGTTTACTCCCTATTAAAACCACTGGAGAATC
  3   1   2       bld Ov1                             IMAGE:5048488.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGAAATATTTCAACTGTAAATATGTATCTGTAAACATTTTTGGGTTTTTCATTTATTTTTCCAATGGTTGGGGCAAATGGCAATAGACAAAATTACAAACGGGTTATACATAACAAATTGCCAAATAATTTCTAAACTTAAAGAATTTTGTATGTGTGAATGCAACTGTAAATCTGTCTTGACTGACCTTTTTTATAGAGGTATGCAGAGGGTTTACTCCCTATTAAAACCACTGGAGAATCTTTTCAGAATTAAAATGAACTATGTATTTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)