Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6861677.5                       3 END     1           2       33                Rho GTPase activating protein 21 [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL167i14.3                           23 PI      93        560     2172                Rho GTPase-activating protein 21 (Rho-type GTPase-activating protein 21)
     3   0.0    0Xl3.1-xlk111b09ex.3                         6 PI      98       3039     3250                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012838392 Xl3.1-XL424f05ex.5.5 - 35 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xl3.1-XL424f05ex.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGAACCTTTGGTGTGAGGTTAGACGACTGCCCTCCTGCTCACAACAACAAATATGTCCCCTTGATAGTTGATGTTTGTTGCAAATTAGTTGAAGACAGAGGGCTTGAAACCACTGGTATCTATAGAGTCCCTGGTAACAATGCTGCTATATCTAGCATGCAAGAAGAGCTCAACAAAGGAAACACAGACATTGATATCCAAGATGATAAATGGCGTGACTTGAATGTAATAAGCAGTCTACTGAAATCCTTTTTCCGGAAATTGCCAGACCCTCTCTTTACCAACGAAAAGTACAATGATTTTATTGAAGCAAACCGAAAAGAAGACCCAGTTGAGAGACTGAAAACTCTAAAAAGACTGATATTGGATTTGCCAGACCATCACTATGAAACTCTTAAATACTTGTCTGCACATCTGAAGACTGTGGCAGACAGCTCTGAAAAGAACAAGATGGAACCCCGAAATTTGGCTATCGTCTTTGGGCCAACCCTTGTTCGGACATCAGAAGACAACATGACGCACATGGTCACACACATGCCCGACCAGTACAAAATAGTAGAAACCCTCATTCAGAAACATGATTGGTTTTTCAGCGAAGAAAGTGCAGATGAGCCAATTACAACTGTACACGAGGAAAGCACAGTAGAGTCTCAGCCAGTGCCAAACATAGATCATTTACTCCCCAACATTGGAAGGACTGGACTTTCTCCAGGAGACGTATCAGATTCGGCTACTAGTGACTCTGCAAAATCTAAGGGTTCTTGGGGCTCTGGGAAAGATCAGTATAGCAGAGAACTGCTAGTGTCTTCTCTGTTCGCTGCAGCCAGTCGCAAGAGAAAGAAACAGAAAGATAAACCCCAGCCAAGCAGTTCAGAGGATGAGCTTGATAACGTGTTTTATCAAAAGGAGTTATCACAAGTGGAGTTTCAGAAACCAGACAAACAGAATGTTGATAAGGACATGGACCTGAAAGCAAAAGCTAATGCACTTTCATTAAAAGATGCTGACAATGTTAAGGGCACAAATATAATTAAGGAAGATAAGCTAGAAAAAGACATTATGCATTCTGAACCCACTTCTCCTTGCCCCCCAAAGCTTTTAGAACCCCCAATAGCGAATCATGGGCTACAAGCACCATCCAATGACAAAAACATCCCACAAATAAACTTCCAAATGGAAGAGAGCATGTCTGACTCAGGAACTATGCTTAGCACTTCATCGCAAGCCTCTGTGCAAGGGTCAAAACCAAAAGTGGTTAGTCCTGAATTCAAAGGCAGTGATTTCTTAACAGCAGATGTGAGCTCTATCACCTCCGATTACTCTACAACATCATCAACTATATACATGACTGGGTTAGACTCAATTCTGATCAGCCCAGAGGTCCAGTCTGTGGCAGAAAGCAAAGGAGAGGAAGCAGATGATGAGAGAAGTGAACTTGTTAGCGAGGGGCGGCCGATGGAAACAGACAGTGAGAATGATTTCCCCATATTTGCTTCAAGCCTTGCCTTCGATAGGCAACATCAGAGCAAAGCGGAAGAGCCATCAAGGAATGTTCAAGTGAACTCTGAAGGAAGTCCCAGTTGCACAGAAGGGAGTATAACCCCAAAGATGGACAGACGAAGGTTTAGCTCTCATAAACTTATTGAATGTGACACTTTATCAAGGAAAAAGTCAGTGCAACAAAAGACAGACAGTGAATGTTCTGCTGAGAGCAAGACTGAGGAAACGCTGTCCGATGCGCAGGAAGCAGTGAAGAAAGGTAGGTCCCTGAGCATTGTGGACCCCACAGGAAATAATGAGCCAGAAGAGCCTGCCTGGAGAATTAAAATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATTGGAAGTCAAAAAGCAAATGCCGCTGAGACCCGAAAGAAGAAAAACATTCGGCGGAGGCACACACTTGGGGGACATAGAGACTTTGCAGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCCAAGGAAGCTGAACTTTCTGCCGTGGATCGTTTGAAGCCAAAGTGTCCTTCCCAGGACCTCTCTATTTCCGAATGGCTCGTCCGGGAACGTTTACGCACTAGCACATCCGAGCTCAGCACGGTGGAGCCTGAAGAAAAACACATTAGTGAGACCAC------------------------------------------------------------------------------------------------------------CAGCCTGACGATCAAATGAATGGTGACAGCTTCCAGAGCAAAAACAAAAACAACTTCAGTCCTGCCGTCGATGCCCACCCTCATAAACTCTCTGGTACTCAAGTAGTCAGATCTCGATTTTACCAGTACCTTTAAACGCTACCCACAGTTGCAGTTTATAGCCTCTAGTTTATTTACATGTATATCTTGTGCCTGAACTTTATTTTTTGTTTTGTTTTTCAGCCTTATTAGGGCTAAATTCATTCATAGGCCCTGTGGAACGTCTTCACAGAGCTTCGCTGCAGCCAGATGAACATGACATTGACAGAATTTTTTTCTTTTTAATGGAAGTACTCATGAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTCTCTGCCACAATAACACACATTCTTCTCACTTAGCTCCAAAGTCAGGGATCTGCAACCCGGGTCTCTACCCAGAATCCCATGATAGCTGTCTTCCTATTAGGGGATGATGGGAGTTTACCCACTGGAGAGCCAAGCGTTACGTGGCCCCAAGTAAAGTGCCTCATTATGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACATGCTAATTCAAGAAACGTGAACTGTGAGCAAATCCGTAACGTTTTATCCGTGACCAGTTTCCATTCAGTTTAACCGATTTTAACAGGCGGATTCCGAGCTTCCATTCCGATGCATTCCAGTCAGATCTCCCCGTTTTATACACACACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTAAAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAAGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAACACTGGAAATAAAAGTCTTTGGTGATCATTTTTTTT
                                                  Xl3.1-CHK-1012721535                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTTGGTGTGAGGTTAGACGACTGCCCTCCTGCTCACAACAACAAATATGTCCCCTTGATAGTTGATGTTTGTTGCAAATTAGTTGAAGACAGAGGGCTTGAAACCACTGGTATCTATAGAGTCCCTGGTAACAATGCTGCTATATCTAGCATGCAAGAAGAGCTCAACAAAGGAAACACAGACATTGATATCCAAGATGATAAATGGCGTGACTTGAATGTAATAAGCAGTCTACTGAAATCCTTTTTCCGGAAATTGCCAGACCCTCTCTTTACCAACGAAAAGTACAATGATTTTATTGAAGCAAACCGAAAAGAAGACCCAGTTGAGAGACTGAAAACTCTAAAAAGACTGATATTGGATTTGCCAGACCATCACTATGAAACTCTTAAATACTTGTCTGCACATCTGAAGACTGTGGCAGACAGCTCTGAAAAGAACAAGATGGAACCCCGAAATTTGGCTATCGTCTTTGGGCCAACCCTTGTTCGGACATCAGAAGACAACATGACGCACATGGTCACACACATGCCCGACCAGTACAAAATAGTAGAAACCCTCATTCAGAAACATGATTGGTTTTTCAGCGAAGAAAGTGCAGATGAGCCAATTACAACTGTACACGAGGAAAGCACAGTAGAGTCTCAGCCAGTGCCAAACATAGATCATTTACTCCCCAACATTGGAAGGACTGGACTTTCTCCAGGAGACGTATCAGATTCGGCTACTAGTGACTCTGCAAAATCTAAGGGTTCTTGGGGCTCTGGGAAAGATCAGTATAGCAGAGAACTGCTAGTGTCTTCTCTGTTCGCTGCAGCCAGTCGCAAGAGAAAGAAACAGAAAGATAAACCCCAGCCAAGCAGTTCAGAGGATGAGCTTGATAACGTGTTTTATCAAAAGGAGTTATCACAAGTGGAGTTTCAGAAACCAGACAAACAGAATGTTGATAAGGACATGGACCTGAAAGCAAAAGCTAATGCACTTTCATTAAAAGATGCTGACAATGTTAAGGGCACAAATATAATTAAGGAAGATAAGCTAGAAAAAGACATTATGCATTCTGAACCCACTTCTCCTTGCCCCCCAAAGCTTTTAGAACCCCCAATAGCGAATCATGGGCTACAAGCACCATCCAATGACAAAAACATCCCACAAATAAACTTCCAAATGGAAGAGAGCATGTCTGACTCAGGAACTATGCTTAGCACTTCATCGCAAGCCTCTGTGCAAGGGTCAAAACCAAAAGTGGTTAGTCCTGAATTCAAAGGCAGTGATTTCTTAACAGCAGATGTGAGCTCTATCACCTCCGATTACTCTACAACATCATCAACTATATACATGACTGGGTTAGACTCAATTCTGATCAGCCCAGAGGTCCAGTCTGTGGCAGAAAGCAAAGGAGAGGAAGCAGATGATGAGAGAAGTGAACTTGTTAGCGAGGGGCGGCCGATGGAAACAGACAGTGAGAATGATTTCCCCATATTTGCTTCAAGCCTTGCCTTCGATAGGCAACATCAGAGCAAAGCGGAAGAGCCATCAAGGAATGTTCAAGTGAACTCTGAAGGAAGTCCCAGTTGCACAGAAGGGAGTATAACCCCAAAGATGGACAGACGAAGGTTTAGCTCTCATAAACTTATTGAATGTGACACTTTATCAAGGAAAAAGTCAGTGCAACAAAAGACAGACAGTGAATGTTCTGCTGAGAGCAAGACTGAGGAAACGCTGTCCGATGCGCAGGAAGCAGTGAAGAAAGGTAGGTCCCTGAGCATTGTGGACCCCACAGGAAATAATGAGCCAGAAGAGCCTGCCTGGAGAATTAAAATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATTGGAAGTCAAAAAGCAAATGCCGCTGAGACCCGAAAGAAGAAAAACATTCGGCGGAGGCACACACTTGGGGGACATAGAGACTTTGCAGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCCAAGGAAGCTGAACTTTCTGCCGTGGATCGTTTGAAGCCAAAGTGTCCTTCCCAGGACCTCTCTATTTCCGAATGGCTCGTCCGGGAACGTTTACGCACTAGCACATCCGAGCTCAGCACGGTGGAGCCTGAAGAAAAACACATTAGTGAGACCACTGGTCA------------------------------------------------------------------------------------------------------------GACGATCAAATGAATGGTGACAGCTTCCAGAGCAAAAACAAAAACAACTTCAGTCCTGCCGTCGATGCCCACCCTCATAAACTCTCTGGTACTCAAGTAGTCAGATCTCGATTTTACCAGTACCTTTAAACGCTACCCACAGTTGCAGTTTATAGCCTCTAGTTTATTTACATGTATATCTTGTGCCTGAACTTTATTTTTTGTTTTGTTTTTCAGCCTTATTAGGGCTAAATTCATTCATAGGCCCTGTGGAACGTCTTCACAGAGCTTCGCTGCAGCCAGATGAACATGACATTGACAGAATTTTTTTCTTTTTAATGGAAGTACTCATGAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTCTCTGCCACAATAACACACATTCTTCTCACTTAGCTCCAAAGTCAGGGATCTGCAACCCGGGTCTCTACCCAGAATCCCATGATAGCTGTCTTCCTATTAGGGGATGATGGGAGTTTACCCACTGGAGAGCCAAGCGTTACGTGGCCCCAAGTAAAGTGCCTCATTATGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACATGCTAATTCAAGAAACGTGAACTGTGAGCAAATCCGTAACGTTTTATCCGTGACCAGTTTCCATTCAGTTTAACCGATTTTAACAGGCGGATTCCGAGCTTCCATTCCGATGCATTCCAGTCAGATCTCCCCGTTTTATACACACACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTAAAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAAGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAACACTGGAAATAAAAGTCTTTGGTGATCATTTTTTTTTAATAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     6     5     6     5     6     5     6     6     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     5     3     5     3     5     3     5     3     4     4     6     5     6     5     6     5     6     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     6     5     6     5     6     5     6     5     6     4     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     8     5     8     7     8     7     8     6     8     6     8     6     8     7     8     7     8     7     8     7     8     7     8     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     8     8     8     8     8     8     9     9     9    10     9    10     9    11     8    11     9    11     9    11     9    11     9    11    10    11    12    12    13    13    12    13    11    13    11    14    12    14    11    14    12    14    12    14    11    14    11    12    12    12    11    12    11    12    11    12    12    12    12    12    12    12    11    11    11    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    12    11    12    10    12     9    12     9    12     9    12     9    11     9    11     9    11     8    11     8    10     8    10     8    10     8    10     8     9     7     8     7     8     7     8     6     8     6     8     6     8     6     7     5     7     4     7     4     7     2     5     2     5     0     5     0     5     0     5     0     5     0     5     0     5     0     5     0     5     0     5     2     6     2     6     2     6     2     6     3     5     3     5     3     5     3     5     3     4     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     4     6     3     6     3     6     4     6     4     6     4     6     4     6     4     6     5     6     6     7     6     7     6     7     5     6     5     6     5     6     5     6     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     8     7     8    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9    10     9    10     9    10     9    10     9    10     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     8     8     8     8     8     8     8     8     8     7     7     7     7     7     7     7     7     6     6     6     6     4     6     3     4     3     3     2     2     2     2
  5   1   2      ests                               Xl3.1-XL424f05ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGAACCTTTGGTGTGAGGTTAGACGACTGCCCTCCTGCTCACAACAACAAATATGTCCCCTTGATAGTTGATGTTTGTTGCAAATTAGTTGAAGACAGAGGGCTTGAAACCACTGGTATCTATAGAGTCCCTGGTAACAATGCTGCTATATCTAGCATGCAAGAAGAGCTCAACAAAGGAAACACAGACATTGATATCCAAGATGATAAATGGCGTGACTTGAATGTAATAAGCAGTCTACTGAAATCCTTTTTCCGGAAATTGCCAGACCCTCTCTTTACCAACGAAAAGTACAATGATTTTATTGAAGCAAACCGAAAAGAAGACCCAGTTGAGAGACTGAAAACTCTAAAAAGACTGATATTGGATTTGCCAGACCATCACTATGAAACTCTTAAATACTTGTCTGCACATCTGAAGACTGTGGCAGACAGCTCTGAAAAGAACAAGATGGAACCCCGAAATTTGGCTATCGTCTTTGGGCCAACCCTTGTTCGGACATCAGAAGACAACATGACGCACATGGTCACACACATGCCCGACCAGTACAAAATAGTAGAAACCCTCATTCAGAAACATGATTGGTTTTTCAGCGAAGAAAGTGCAGATGAGCCAATTACAACTGTACACGAGGAAAGCACAGTAGAGTCTCAGCCAGTGCCAAACATAGATCATTTACTCCCCAACATTGGAAGGACTGGACTTTCTCCAGGAGACGTATCAGATTCGGCTACTAGTGACTCTGCAAAATCTAAGGGTTCTTGGGGCTCTGGGAAAGATCAGTATAGCAGAGAACTGCTAGTGTCTTCTCTGTTCGCTGCAGCCAGTCGCAAGAGAAAGAAACAGAAAGATAAACCCCAGCCAAGCAGTTCAGAGGATGAGCTTGATAACGTGTTTTATCAAAAGGAGTTATCACAAGTGGAGTTTCAGAAACCAGACAAACAGAATGTTGATAAGGACATGGACCTGAAAGCAAAAGCTAATGCACTTTCATTAAAAGATGCTGACAATGTTAAGGGCACAAATATAATTAAGGAAGATAAGCTAGAAAAAGACATTATGCATTCTGAACCCACTTCTCCTTGCCCCCCAAAGCTTTTAGAACCCCCAATAGCGAATCATGGGCTACAAGCACCATCCAATGACAAAAACATCCCACAAATAAACTTCCAAATGGAAGAGAGCATGTCTGACTCAGGAACTATGCTTAGCACTTCATCGCAAGCCTCTGTGCAAGGGTCAAAACCAAAAGTGGTTAGTCCTGAATTCAAAGGCAGTGATTTCTTAACAGCAGATGTGAGCTCTATCACCTCCGATTACTCTACAACATCATCAACTATATACATGACTGGGTTAGACTCAATTCTGATCAGCCCAGAGGTCCAGTCTGTGGCAGAAAGCAAAGGAGAGGAAGCAGATGATGAGAGAAGTGAACTTGTTAGCGAGGGGCGGCCGATGGAAACAGACAGTGAGAATGATTTCCCCATATTTGCTTCAAGCCTTGCCTTCGATAGGCAACATCAGAGCAAAGCGGAAGAGCCATCAAGGAATGTTCAAGTGAACTCTGAAGGAAGTCCCAGTTGCACAGAAGGGAGTATAACCCCAAAGATGGACAGACGAAGGTTTAGCTCTCATAAACTTATTGAATGTGACACTTTATCAAGGAAAAAGTCAGTGCAACAAAAGACAGACAGTGAATGTTCTGCTGAGAGCAAGACTGAGGAAACGCTGTCCGATGCGCAGGAAGCAGTGAAGAAAGGTAGGTCCCTGAGCATTGTGGACCCCACAGGAAATAATGAGCCAGAAGAGCCTGCCTGGAGAATTAAAATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATTGGAAGTCAAAAAGCAAATGCCGCTGAGACCCGAAAGAAGAAAAACATTCGGCGGAGGCACACACTTGGGGGACATAGAGACTTTGCAGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCCAAGGAAGCTGAACTTTCTGCCGTGGATCGTTTGAAGCCAAAGTGTCCTTCCCAGGACCTCTCTATTTCCGAATGGCTCGTCCGGGAACGTTTACGCACTAGCACATCCGAGCTCAGCACGGTGGAGCCTGAAGAAAAACACATTAGTGAGACCAC
  5   1   2      ests                             Xl3.1-rxlk114o09ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTCACAGAGCTTCGCTGCAGCCAGATGAACATGACATTGACAGAATTTTTTTCTTTTTAATGGAAGTACTCATGAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTCTCTGCCACAATAACACACATTCTTCTCACTTAGCTCCAAAGTCAGGGATCTGCAACCCGGGTCTCTACCCAGAATCCCATGATAGCTGTCTTCCTATTAGGGGATGATGGGAGTTTACCCACTGGAGAGCCAAGCGTTACGTGGCCCCAAGTAAAGTGCCTCATTATGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACATGCTAATTCAAGAAACGTGAACTGTGAGCAAATCCGTAACGTTTTATCCGTGACCAGTTTCCATTCAGTTTAACCGATTTTAACAGGCGGATTCCGAGCTTCCATTCCGATGCATTCCAGTCAGATCTCCCCGTTTTATACACACACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTAAAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAAGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAACACTGGAAATAAAAGTCTTTGGTGATCATTTTTTT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---A--------
                                                                       ...PROTEIN --- Ci ---- 2e-023     FAA00122.1 TPA: zinc finger protein [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 3e-045     NP_608396.2 CG1412-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 3e-054     NP_498877.3 C04D8.1 [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 1e-071     XP_797751.2 PREDICTED: similar to KIAA1424 protein [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 2e-093     XP_548158.2 PREDICTED: similar to Rho GTPase activating protein 21 [Canis familiaris] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 2e-095     XP_601322.4 PREDICTED: similar to Rho GTPase-activating protein 23 (Rho-type GTPase-activating protein 23) [Bos taurus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 0          XP_001918968.1 PREDICTED: hypothetical protein LOC326745, partial [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Bt ---- 0          XP_581232.3 PREDICTED: similar to KIAA1424 protein [Bos taurus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 0          NP_001121556.1 Rho GTPase activating protein 21 isoform 1 [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_065875.2 Rho GTPase activating protein 21; Rho-GTPase activating protein 10 [Homosapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 0          XP_418602.2 PREDICTED: similar to KIAA1424 protein [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 0          A2RUV4.1 Rho GTPase-activating protein 21 (Rho-type GTPase-activating protein 21) [Xenopus tropicalis]  --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 0          NP_001083524.1 rho-GTPase activating protein [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xl3.1-XL424f05ex.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG------ATG---------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG---------ATG---------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGAATG------------------------------------------------ATG------------------------------TAG---------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------TGA---TGA---TGA---------------------------------------TGA---------------------------------------------------------------------------------------------TAG---------------------------------------------ATG------------------------------------------------------------------------------------ATG---------------------------------------TAA------------------TGA---------TAA---------------------------------------------------------------------------------------------------------------TAA------------------------TGA---------------------------------------------------------------------------------TAAATG---TAA---------------------------------------------------------TGA------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ...
  5   1   2      ests                               Xl3.1-XL424f05ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGAACCTTTGGTGTGAGGTTAGACGACTGCCCTCCTGCTCACAACAACAAATATGTCCCCTTGATAGTTGATGTTTGTTGCAAATTAGTTGAAGACAGAGGGCTTGAAACCACTGGTATCTATAGAGTCCCTGGTAACAATGCTGCTATATCTAGCATGCAAGAAGAGCTCAACAAAGGAAACACAGACATTGATATCCAAGATGATAAATGGCGTGACTTGAATGTAATAAGCAGTCTACTGAAATCCTTTTTCCGGAAATTGCCAGACCCTCTCTTTACCAACGAAAAGTACAATGATTTTATTGAAGCAAACCGAAAAGAAGACCCAGTTGAGAGACTGAAAACTCTAAAAAGACTGATATTGGATTTGCCAGACCATCACTATGAAACTCTTAAATACTTGTCTGCACATCTGAAGACTGTGGCAGACAGCTCTGAAAAGAACAAGATGGAACCCCGAAATTTGGCTATCGTCTTTGGGCCAACCCTTGTTCGGACATCAGAAGACAACATGACGCACATGGTCACACACATGCCCGACCAGTACAAAATAGTAGAAACCCTCATTCAGAAACATGATTGGTTTTTCAGCGAAGAAAGTGCAGATGAGCCAATTACAACTGTACACGAGGAAAGCACAGTAGAGTCTCAGCCAGTGCCAAACATAGATCATTTACTCCCCAACATTGGAAGGACTGGACTTTCTCCAGGAGACGTATCAGATTCGGCTACTAGTGACTCTGCAAAATCTAAGGGTTCTTGGGGCTCTGGGAAAGATCAGTATAGCAGAGAACTGCTAGTGTCTTCTCTGTTCGCTGCAGCCAGTCGCAAGAGAAAGAAACAGAAAGATAAACCCCAGCCAAGCAGTTCAGAGGATGAGCTTGATAACGTGTTTTATCAAAAGGAGTTATCACAAGTGGAGTTTCAGAAACCAGACAAACAGAATGTTGATAAGGACATGGACCTGAAAGCAAAAGCTAATGCACTTTCATTAAAAGATGCTGACAATGTTAAGGGCACAAATATAATTAAGGAAGATAAGCTAGAAAAAGACATTATGCATTCTGAACCCACTTCTCCTTGCCCCCCAAAGCTTTTAGAACCCCCAATAGCGAATCATGGGCTACAAGCACCATCCAATGACAAAAACATCCCACAAATAAACTTCCAAATGGAAGAGAGCATGTCTGACTCAGGAACTATGCTTAGCACTTCATCGCAAGCCTCTGTGCAAGGGTCAAAACCAAAAGTGGTTAGTCCTGAATTCAAAGGCAGTGATTTCTTAACAGCAGATGTGAGCTCTATCACCTCCGATTACTCTACAACATCATCAACTATATACATGACTGGGTTAGACTCAATTCTGATCAGCCCAGAGGTCCAGTCTGTGGCAGAAAGCAAAGGAGAGGAAGCAGATGATGAGAGAAGTGAACTTGTTAGCGAGGGGCGGCCGATGGAAACAGACAGTGAGAATGATTTCCCCATATTTGCTTCAAGCCTTGCCTTCGATAGGCAACATCAGAGCAAAGCGGAAGAGCCATCAAGGAATGTTCAAGTGAACTCTGAAGGAAGTCCCAGTTGCACAGAAGGGAGTATAACCCCAAAGATGGACAGACGAAGGTTTAGCTCTCATAAACTTATTGAATGTGACACTTTATCAAGGAAAAAGTCAGTGCAACAAAAGACAGACAGTGAATGTTCTGCTGAGAGCAAGACTGAGGAAACGCTGTCCGATGCGCAGGAAGCAGTGAAGAAAGGTAGGTCCCTGAGCATTGTGGACCCCACAGGAAATAATGAGCCAGAAGAGCCTGCCTGGAGAATTAAAATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATTGGAAGTCAAAAAGCAAATGCCGCTGAGACCCGAAAGAAGAAAAACATTCGGCGGAGGCACACACTTGGGGGACATAGAGACTTTGCAGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCCAAGGAAGCTGAACTTTCTGCCGTGGATCGTTTGAAGCCAAAGTGTCCTTCCCAGGACCTCTCTATTTCCGAATGGCTCGTCCGGGAACGTTTACGCACTAGCACATCCGAGCTCAGCACGGTGGAGCCTGAAGAAAAACACATTAGTGAGACCAC
                                                  Xl3.1-CHK-1012688847                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTTGGTGTGAGGTTAGACGACTGCCCTCCTGCTCACAACAACAAATATGTCCCCTTGATAGTTGATGTTTGTTGCAAATTAGTTGAAGACAGAGGGCTTGAAACCACTGGTATCTATAGAGTCCCTGGTAACAATGCTGCTATATCTAGCATGCAAGAAGAGCTCAACAAAGGAAACACAGACATTGATATCCAAGATGATAAATGGCGTGACTTGAATGTAATAAGCAGTCTACTGAAATCCTTTTTCCGGAAATTGCCAGACCCTCTCTTTACCAACGAAAAGTACAATGATTTTATTGAAGCAAACCGAAAAGAAGACCCAGTTGAGAGACTGAAAACTCTAAAAAGACTGATATTGGATTTGCCAGACCATCACTATGAAACTCTTAAATACTTGTCTGCACATCTGAAGACTGTGGCAGACAGCTCTGAAAAGAACAAGATGGAACCCCGAAATTTGGCTATCGTCTTTGGGCCAACCCTTGTTCGGACATCAGAAGACAACATGACGCACATGGTCACACACATGCCCGACCAGTACAAAATAGTAGAAACCCTCATTCAGAAACATGATTGGTTTTTCAGCGAAGAAAGTGCAGATGAGCCAATTACAACTGTACACGAGGAAAGCACAGTAGAGTCTCAGCCAGTGCCAAACATAGATCATTTACTCCCCAACATTGGAAGGACTGGACTTTCTCCAGGAGACGTATCAGATTCGGCTACTAGTGACTCTGCAAAATCTAAGGGTTCTTGGGGCTCTGGGAAAGATCAGTATAGCAGAGAACTGCTAGTGTCTTCTCTGTTCGCTGCAGCCAGTCGCAAGAGAAAGAAACAGAAAGATAAACCCCAGCCAAGCAGTTCAGAGGATGAGCTTGATAACGTGTTTTATCAAAAGGAGTTATCACAAGTGGAGTTTCAGAAACCAGACAAACAGAATGTTGATAAGGACATGGACCTGAAAGCAAAAGCTAATGCACTTTCATTAAAAGATGCTGACAATGTTAAGGGCACAAATATAATTAAGGAAGATAAGCTAGAAAAAGACATTATGCATTCTGAACCCACTTCTCCTTGCCCCCCAAAGCTTTTAGAACCCCCAATAGCGAATCATGGGCTACAAGCACCATCCAATGACAAAAACATCCCACAAATAAACTTCCAAATGGAAGAGAGCATGTCTGACTCAGGAACTATGCTTAGCACTTCATCGCAAGCCTCTGTGCAAGGGTCAAAACCAAAAGTGGTTAGTCCTGAATTCAAAGGCAGTGATTTCTTAACAGCAGATGTGAGCTCTATCACCTCCGATTACTCTACAACATCATCAACTATATACATGACTGGGTTAGACTCAATTCTGATCAGCCCAGAGGTCCAGTCTGTGGCAGAAAGCAAAGGAGAGGAAGCAGATGATGAGAGAAGTGAACTTGTTAGCGAGGGGCGGCCGATGGAAACAGACAGTGAGAATGATTTCCCCATATTTGCTTCAAGCCTTGCCTTCGATAGGCAACATCAGAGCAAAGCGGAAGAGCCATCAAGGAATGTTCAAGTGAACTCTGAAGGAAGTCCCAGTTGCACAGAAGGGAGTATAACCCCAAAGATGGACAGACGAAGGTTTAGCTCTCATAAACTTATTGAATGTGACACTTTATCAAGGAAAAAGTCAGTGCAACAAAAGACAGACAGTGAATGTTCTGCTGAGAGCAAGACTGAGGAAACGCTGTCCGATGCGCAGGAAGCAGTGAAGAAAGGTAGGTCCCTGAGCATTGTGGACCCCACAGGAAATAATGAGCCAGAAGAGCCTGCCTGGAGAATTAAAATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATTGGAAGTCAAAAAGCAAATGCCGCTGAGACCCGAAAGAAGAAAAACATTCGGCGGAGGCACACACTTGGGGGACATAGAGACTTTGCAGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCCAAGGAAGCTGAACTTTCTGCCGTGGATCGTTTGAAGCCAAAGTGTCCTTCCCAGGACCTCTCTATTTCCGAATGGCTCGTCCGGGAACGTTTACGCACTAGCACATCCGAGCTCAGCACGGTGGAGCCTGAAGAAAAACACATTAGTGAGACCACTGGTCA
  5   1   2       bld Ga12                                 XL147d24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGAGGGGAACCTTTGGTGTGAGGTTAGACGACTGCCCTCCTGCTCACAACAACAAATATGTCCCCTTGATAGTTGATGTTTGTTGCAAATTAGTTGAAGACAGAGGGCTTGAAACCACTGGTATCTATAGAGTCCCTGGTAACAATGCTGCTATATCTAGCATGCAAGAAGAGCTCAACAAAGGAAACACAGACATTGATATCCAAGATGATAAATGGCGTGACTTGAATGTAATAAGCAGTCTACTGAAATCCTTTTTCCGGAAATTGCCAGACCCTCTCTTTACCAACGAAAAGTACAATGATTTTATTGAAGCAAACCGAAAAGAAGACCCAGTTGAGAGACTGAAAACTCTAAAAAGACTGATATTGGATTTGCCAGACCATCACTATGAAACTCTTAAATACTTGTCTGCACATCTGAAGACTGTGGCAGACAGCTCTGAAAAGAACAAGATGGAACCCCGAAATTTGGCTATCGTCTTTGGGCCAACCCTTGTTCGGAC
  5   1   2       bld Ga12                                 XL145h03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGAACCTTTGGTGTGAGGTTAGACGACTGCCCTCCTGCTCACAACAACAAATATGTCCCCTTGATAGTTGATGTTTGTTGCAAATTAGTTGAAGACAGAGGGCTTGAAACCACTGGTATCTATAGAGTCCCTGGTAACAATGCTGCTATATCTAGCATGCAAGAAGAGCTCAACAAAGGAAACACAGACATTGATATCCAAGATGATAAATGGCGTGACTTGAATGTAATAAGCAGTCTACTGAAATCCTTTTTCCGGAAATTGCCAGACCCTCTCTTTACCAACGAAAAGTACAATGATTTTATTGAAGCAAACCGAAAAGAAGACCCAGTTGAGAGACTGAAAACTCTAAAAAGACTGATATTGGATTTGCCAGACCATCACTATGAAACTCTTAAATACTTGTCTGCACATCTGAAGACTGTGGCAGACAGCTCTGAAAAGAACAAGATGGAACCCCGAAATTTGGCTATCGTCTTTGGGCCAACCCTTGTTCGGACATCAGAAGACAACATGACGCACATGGTCACACACATGCCCGACCAGTACAAAATAGTAGAAACCCTCATTCAGAAACATGATTGGTTTTTCAGCGAAGAAAGTGCAGATGAGCCAATTAGATCTTTGTTTATCAACTGTAGACAACTGTACACGAGGAAAGCACAGTAGAGTCTCAGC
  3  -1   2       add Bla2      in                    IMAGE:7296126.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAATATGTCCCCTTGATAGTTGATGTTTGTTGCAAATTAGTTGAAGACAGAGGGCTTGAAACCACTGGTATCTATAGAGTCCCTGGTAACAATGCTGCTATATCTAGCATGCAAGAAGAGCTCAACAAAGGAAACACAGACATTGATATCCAAGATGATAAATGGCGTGACTTGAATGTAATAAGCAGTCTACTGAAATCCTTTTTCCGGAAATTGCCAGACCCTCTCTTTACCNNACGAAAGTACAATGATTTTATTGAAGCAACCCCGAAAGAAGACCCAGTTGAGAGAACTGAAACTCTAAAAGACTGATATTGGATTTGCAGACCATCACTATGAAACTCTTAAATACTTGTCTGCACATCTGAAGACTGTTGCAGACAGCTCTGAAAAGAAACAGATGGACCCCCGAAATTGGGCTATCGTCTTTGGGCCCACCCTTGTCNGACATCAGAAGACACATGACGCACATGGTCACACACATGCCCGAACCAGTACAAATAGTAGAAACCCTCATTCAGAACATGATTGGTTTTTCAGCGAAGAAAGTGCAGATGAGCCNATTACACTGTACACGAGGAAGCACAGTAGAGTCTCAGCAGTGCAAACATAGATCATTACTCCCCACATGAAGGACTGGACTTCTCAGGAACGTTCNAATCGCTACATGATCTGCAATCTAGGGTCTGGGC
  5   1   2       bld Emb1                            IMAGE:6632109.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGTCCCTGGTAACAATGCTGCTATATCTAGCATGCAAGAAGAGCTCAACAAAGGAAACACAGACATTGATATCCAAGATGATAAATGGCGTGACTTGAATGTAATAAGCAGTCTACTGAAATCCTTTTTCCGGAAATTGCCAGACCCTCTCTTTACCAACGAAAAGTACAATGATTTTATTGAAGCAAACCGAAAAGAAGACCCAGTTGAGAGACTGAAAACTCTAAAAAGACTGATATTGGATTTGCCAGACCATCACTATGAAACTCTTAAATACTTGTCTGCACATCTGAAGACTGTGGCAGACAGCTCTGAAAAGAACAAGATGGAACCCCGAAATTTGGCTATCGTCTTTGGGCCAACCCTTGTTCGGACATCAGAAGACAACATGACGCACATGGTCACACACATGCCCGACCAGTACAAAATAGTAGAAACCCTCATTCAGAAACATGATTGGTTTTTCAGCGAAGAAAGTGCAGATGAGCCAATTACAACTGTACACGAGGAAAGCACAGTAGAGTCTCAGCCAGTGCCAAACATAGATCATTTACTCCCCAACATTGGAAGGACTGGACTTTCTCCAGGAGACGTATCAGATTCGGCTACTAGTGACTCTGCAAAATCTAAGGGTTCTTGGGGCTCTGGGAAAGATCAGTATAGCAGAGAACTGCTAGTGTCTTCTCTGTTCGCTGCAGCCAGTCGCAAGAGAAAGAAACAGAAAGATAAACCCCAGCCAAGCAGTTCAGAGGATGAGCTTTGATAACGTGTTTTATCANAAGGAGTTATCAACCAGTGGAGTTTCNGAAACCAGACAAACAGAAATGGTTGATAAGGACATGGNACCNTGAAAGCAAAAGCTAATGCACTTTTCTTNAAAAGATGCTTGACNATGGTTAAGGCC
  5   1   2       bld Ooc2      in                    IMAGE:3746275.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAATTCCTTGATATCCAAGATGATAAATGGCGTGACTTGAATGTAATAAGCAGTCTACTGAAATCCTTTTTCCGGAAATTGCCAGACCCTCTCTTTACCAACGAAAAGTACAATGATTTTATTGAAGCAAACCGAAAAGAAGACCCAGTTGAGAGACTGAAAACTCTAAAAAGACTGATATTGGATTTGCCAGACCATCACTATGAAACTCTTAAATACTTGTCTGCACATCTGAAGACTGTGGCAGACAGCTCTGAAAAGAACAAGATGGAACCCCGAAATTTGGCTATCGTCTTTGGGCCAACCCTTGTTCGGACATCAGAAGACAACATGACGCACATGGTCACACACATGCCCGACCAGTACAAAATAGTAGAAACCCTCATTCAGAAACATGATTGGTTTTTCAGCGAAGAAAGTGCAGATGAGCCAATTACAACTGTACACGAGGAAAGCACAGTAGAGTCTCAGCCAGTGCCAAACATAGATCATTTACTCCCCAACATTGGAAGGACTGGACTNTCTCCAGGAGACGTATCAGATTCGGCTACTAGTGACTCT
  5   1   2       bld Oo1                             IMAGE:6642478.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACCCTCTCTTTACAACGAAAAGACAATGATTTTATTGAAGCAAACCGAAAAGAAACCCAGTTGAGAGACTGAAAACTCTAAAAAGACTGATATTGGATTTGCCAGACCATCACTATGAAACTCTTAAATACTTGTCTGCACATCTGAAGACTGTGGCAGACAGCTCTGAAAAGAACAAGATGGAACCCCGAAATTTGGCTATCGTCTTTGGGCCAACCCTTGTTCGGACATCAGAAGACAACATGACGCACATGGTCACACACATGCCCGACCAGTACAAAATAGTAGAAACCCTCATTCAGAAACATGATTGGTTTTTCAGCGAAGAAAGTGCAGATGAGCCAATTACAACTGTACACGAGGAAAGCACAGTAGAGTCTCAGCCAGTGCCAAACATAGATCATTTACTCCCCAACATTGGAAGGACTGGACTTTCTCCAGGAGACGTATCAGATTCGGCTACTAGTGACTCTGCAAAATCTAAGGGTTCTTGGGGCTCTGGGAAAGATCAGTATAGCAGAGAACTGCTAGTGTCTTCTCTGTTCGCTGCAGCCAGTCGCAAGAGAAAGAAACAGAAAGATAAACCCCAGCCAAGCAGTTCAGAGGATGAGCTTGATAACGTGTTTTATCAAAAGGAGTTATCACAAGTGGAGTTTCAGAAACCAGACAAACAGAATGTTGATAAGGACATGGACCTGAAAGCAAAAGCTAATGCACTTTCATTAAAAGATGCTGACAATGTTAAGGGCACAAATATAATTAAGGAAGATAAGCTAGAAAAAGACATTATGCATTCTGAACCCACTTCTCCTTGCCCCCCAAAGCTTTTAGAACCCCCAATAGCGAATCATGGGCTACAAGCACCATCCAATGACAAAACATCCCACAAATAACTTNCCAATGGNANGAGAGCATGTCTGA
  5   1   2       bld Tbd3                            IMAGE:3549699.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTACTCCCCAACATTGGAGGACTGGACTTTCTCCAGNAGACGTATCAGATTCGGCTACTAGTGACTCTGCAAAATCTAAGGGTTCTTGGGGCTCTGGGAAAGATCAGTATAGCAGAGAACTGCTAGTGTCTTCTCTGTTCGCTGCAGCCAGTCGCAAGAGAAAGAAACAGAAAGATAAACCCCAGCCAAGCAGTTCAGAGGATGAGCTTGATAACGTGTTTTATCAAAAGGAGTTATCACAAGTGGAGTTTCAGAAACCAGACAAACAGAATGTTGATAAGGACATGGACCTGAAAGCAAAAGCTAATGCACTTTCATTAAAAGATGCTGACAATGTTAAGGGCACAAATATAATTAAGGAAGATAAGCTAGAAAAAGACATTATGCATTCTGAACCCACTTCTCCTTGCCCCCCAAAGCTTTTAGAACCCCCAATAGCGAATCATGGGCTACAAGCACCATCCAATGACAAAAACATCCCACAAATAAACTTCCAAATGGAAGAGAGCATGTCTGACTCAGGAACTATGCTTAGCACTTCATCGCAAGCCTCTGTGCAAGGGTCAAAACCAAAAGTGGTTAGTCCTGAATTCAAAGGC
  5   1   2       bld Egg1                            IMAGE:4678178.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCACGAGGAACATTGGAAGGACTGGACTTTCTCCAGGAGACGTATCAGATTCGGCTACTAGTGACTCTGCAAAATCTAAGGGTTCTTGGGGCTCTGGGAAAGATCAGTATAGCAGAGAACTGCTAGTGTCTTCTCTGTTCGCTGCAGCCAGTCGCAAGAGAAAGAAACAGAAAGATAAACCCCAGCCAAGCAGTTCAGAGGATGAGCTTGATAACGTGTTTTATCAAAAGGAGTTATCACAAGTGGAGTTTCAGAAACCAGACAAACAGAATGTTGATAAGGACATGGACCTGAAAGCAAAAGCTAATGCACTTTCATTAAAAGATGCTGAACtttattttttgttttgtttttCAGCCTTATTAGGGCTAAATTCATTCATAGGCCCTGTGGAACGTCTTCACAGAGCTTCGCTGCAGCCAGATGAACATGACATTGACAGAAtttttttctttttAATGGAAGTACTCATGAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTCTCTGCCACAATAACACACATTCTTCTCACTTAGCTC
  5   1   2       bld Tad1      in                    IMAGE:6878987.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAAGATAAACCCCAGCCAAGCAGTTCAGAGGATGAGCTTGATAACGTGTTTTATCAAAAGGAGTTATCACAAGTGGAGTTTCAGAAACCAGACAAACAGAATGTTGATAAGGACATGGACCTGAAAGCAAAAGCTAATGCACTTTCATTAAAAGATGCTGACAATGTTAAGGGCACAAATATAATTAAGGGAGATAAGCTAGAAAAAGACATTATGCATTCTGAACCCACTTCTCCTTGCCCCCCAAAGCTTTTAGAACCCCCAATAGCGAATCATGGGCTACAAGCACCATCCAATGACAAAAACATCCCACAAATAAACTTCCAAATGGAAGAGAGCATGTCTGACTCAGGAACTATGCTTAGCACTTCATCGCAAGCCTCTGTGCAAGGGTCAAAACCAAAAGTGGTTAGTCCTGAATTCAAAGGCAGTGATTTCTTAACAGCAGATGTGAGCTCTATCACCTCCGATTACTCTACAACATCATCAACTATATACATGACTGGGTTAGACTCAATTCTGATCAGCCCAGAGGTCCAGTCTGTGGCAGAAAGCAAAGGAGAGGAAGCAGATGATGAGAGAAGTGAACTTGTTAGCGAGGGGCGGCCGATGGAAACAGACAGTGAGAATGATTTCCCCATATTTGCTTCAAGCCTTGCCTTCGATAGGCAACATCAGAGCAAAGCGGAAGAGCCATCAAGGGAATGTTCAAGTGAACTCTGAAAGAAGTCCCAGTTGCACAGAAGGGAGTATAACCCCCAAGATGGACAGACGAAGGGTTAGCTCTCATAAACTTATTGATGC
  5   1   2       bld Gas9                                 BG409504.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCACGCGTCCGGGACATGGACCTGAAAGCAAAAGCTAATGCACTTTCATTAAAAGATGCTGACAATGTTAAGGGCACAAATATAATTAAGGAAGATAAGCTAGAAAAAGACATTATGCATTCTGAACCCACTTCTCCTTGCCCCCCAAAGCTTTTAGAACCCCCAATAGCGAATCATGGGCTACAAGCACCATCCAATGACAAAAACATCCCACAAATAAACTTCCAAATGGAAGAGAGCATGTCTGACTCAGGAACTATGCTTAGCACTTCATCGCAAGCCTCTGTGCAAGGGTCAAAACCAAAAGTGGTTAGTCCTGAATTCAAAGGCAGTGATTTCTTAACAGCAGATGTGAGCTCTATCACCTCCGATTACTCTACAACATCATCAACTATATACATGACTGGGTTAGACTCAATTCTGATCAGCCCAGAGGTCCAGTCTGTGGCAGAAAGCAAAGGAGAGGAAGCAGATGATGAGAGAAGTGAACTTGTTAGCGAGGGGCGGCCCGATGGAAACAGACAGTGAGAATGATTTCCCCATATTTGCTTCAAGCCTTGCTTCGATAGGCAACATCAGAGCAAAGCGGAAGAGCCATCAAGGAATGTTCAAGTGAACTCTGAANGAAGTCCCAGTTGCCAGAAAGGGAGTATACCCCAAAGATGGACAGACGAAGGTTAACTCTCTAAACTTATTGGAATGTGCN
  5   1   2       bld Emb1                            IMAGE:6631751.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATGTTAAGGGCACAAATATAATTAAGGAAGATAAGCTAGAAAAAGACATTATGCATTCTGAACCCACTTCTCCTTGCCCCCCAAAGCTTTTAGAACCCCCAATAGCGAATCATGGGCTACAAGCACCATCCAATGACAAAAACATCCCACAAATAAACTTCCAAATGGAAGAGAGCATGTCTGACTCAGGAACTATGCTTAGCACTTCATCGCAAGCCTCTGTGCAAGGGTCAAAACCAAAAGTGGTTAGTCCTGAATTCAAAGGCAGTGATTTCTTAACAGCAGATGTGAGCTCTATCACCTCCGATTACTCTACAACATCATCAACTATATACATGACTGGGTTAGACTCAATTCTAATCAGCCCAGAGGTCCAGTCTGTGGCAGAAAGCAAAGGAGAGGAAGCAGATGATGAGAGAAGTGAACTTGTTAGCGAGGGGCGGCCGATGGAAACAGACAGTGAGAATGATTTCCCCATATTTGCTTCAAGCCTTGCCTTCGATAGGCGACATCAGAGCAAAGCGGAAGAGCCATCAAGGAATGTTCAAGTGAACTCTGAAGGAAGTCCCAGTTGCACAGAAGGGAGTATAACCCCAAAGATGGACAGACGAAGGTTTAGCTCTCATAAACTTATTGAATGTGACACTTTATCAAGGAAAAAGTCAGTGCAACAAAAGACAGACAGTGACTGTTCTGCTGAGAGCAAGACTGAGGAAACGCTGTCCGATGCGCAGGAAGCAGTGAAGAAAGGTAGGTCCCCTGAGCATTGTGGACCCCACAGGAANATAATGAGCCAGAAAGAGCCTGGCCCTGGAGAATTNAAATAACAGAGAAGGCTGAAAACTGCGGCCTTAAAAGCATCTGGCAAATGAACATGGTTTTGGAAATTGGGAGGTCAAAAAAGCCAAATGCC
  5   1   2       bld Oo1                             IMAGE:6857225.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAGGCTTGGGTACCGGTCCNGGAATTCCTCGGGATCAAGCACCATCCAATGACAAAAACATCCCACAAATAAACTTCCAAATGGAAGAGAGCATGTCTGACTCAGGAACTATGCTTACCACTTCATCGCAAGCCTCTGTGCAAGGGTCAAAACCAAAAGTGGTTAGTCCTGAATTCAAAGGCAGTGATTTCTTAACAGCAGATGTGAGCTCTATCACCTCCGATTACTCTACAACATCATCAACTATATACATGACTGGGTTAGACTCAATTCTGATCAGCCCAGAGGTCCAGTCTGTGGCAGAAAGCAAAGGAGAGGAAGCAGATGATGAGAGAAGTGAACTTGTTAGCGAGGGGCGGCCGATGGAAACAGACAGTGAGAATGATTTCCCCATATTTGCTTCAAGCCTTGCCTTCGATAGGCAACATCAGAGCAAAGCGGAAGAGCCATCAAGGAATGTTCAAGTGAACTCTGAAGGAAGTCCCAGTTGCACAGAAGGGAGTATAACCCCAAAGATGGACAGACGAAGGTTTAGCTCTCATAAACTTATTGAATGTGACACTTTATCAAGGAAAAAGTCAGTGCAACAAAAGACAGACAGTGAATGTTCTGCTGAGAGCAAGACTGAGGAAACGCTGTCCGATGCGCAGGAAGCAGTGAAGAAAGGTAGGTCCCTGAGCATTGTGGACCCCACAGGAAATAATGAGCCAGAAGAGCCTGCCTGGAGAATTAAAATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATTGGAAGTCAAAAAGCAAATGCCACTGAGACCCGAAAGAAGAAAAACATTCGGCGGAAGCACACACTTGGGGGGACAAAAGAGACTTTGCAGAAATCAGCGTTTTAAATGCTTGGGGAAATCAATGAGGCAAGTTTCCAGGGAT
  5   1   2       bld Oo1                             IMAGE:6639576.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCTGGACCGGTCCGGATTCCCGGGATGGGCTACAAGCACCATCCAATGACAAAAACATCCCACAAATAAACTTCCAAATGGAAGAGAGCATGTCTGACTCAGGAACTATGCTTAGCACTTCATCGCAAGCCTCTGTGCAAGGGTCAAAACCAAAAGTGGTTAGTCCTGAATTCAAAGGCAGTGATTTCTTAACAGCAGATGTGAGCTCTATCACCTCCGATTACTCTACAACATCATCAACTATATACATGACTGGGTTAGACTCAATTCTGATCAGCCCAGAGGTCCAGTCTGTGGCAGAAAGCAAAGGAGAGGAAGCAGATGATGAGAGAAGTGAACTTGTTAGCGAGGGGCGGCCGATGGAAACAGACAGTGAGAATGATTTCCCCATATTTGCTTCAAGCCTTGCCTTCGATAGGCGACATCAGAGCAAAGCGGAAGAGCCATCAAGGAATGTTCAAGTGAACTCTGAAGGAAGTCCCAGTTGCACAGAAGGGAGTATAACCCCAAAGATGGACAGACGAAGGTTTAGCTCTCATAAACTTATTGAATGTGACACTTTATCAAGGAAAAAGTCAGTGCAACAAAAGACAGACAGTGAATGTTCTGCTGAGAGCAAGACTGAGGAAACGCTGTCCGATGCGCAGGAAGCAGTGAAGAAAGGTAGGTCCCTGAGCATTGTGGACCCCACAGGAAATAATGAGCCAGAAGAGCCTGCCTGGAGAATTAAAATAACAGAGAGGCTNGAACTGCGCCTTANAGCATCTGCAGATGACATGTTTGGNAATTGGAAGTCAAAAAAGCAATGCCGCTGAGACCCGAAAGAAGAAAACATTTCGGCGGAGCACACACTTGNNGGGACATAGAGACTTTGCAGAAATCAACGTTTTAAATGCTTGGAAAATCNATGAGCCAGNTCCAGGAAGCTGACTTTCTGNCCGTGNATCGTTTGAAGCCAAAGTGTCCTTCCCCAGACTCTCTATTTCCGAATGGCTTCGTCCCGGGAACGTTTACGCACTAGCACATTCGAAGCTTCAGCACGGGTGGAAGCCTGAAGAAA
  5  -1   2       chi Bla2      in                    IMAGE:7296126.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAGCATGTTGACTCAGGAACTATGCTTAGCACTCATTCGCAAGCCTCTGTGCAAGGGTCAAAACCAAAAGTGGTTAGTCCTGAATTCAAAGGCAGTGATTTCTTAACAGCAGATGTGAGCTCTATCACCTCCGATTACTCTACAACATCATCAACTATATACATGACTGGGTTAGACTCAATTCTGATCAGCCCAGAGGTCCAGTCTGTGGCAGAAAGCAAAGGAGAGGAAGCAGATGATGAGAGAAGTGAACTTGTTAGCGAGGGGCGGCCGATGGAAACAGACAGTGAGAATGATTTCCCCATATTTGCTTCAAGCCTTGCCTTCGATAGGGGACATCAGAGCAAAGCGGAAGAGCCATCAAGGAATGTTCAAGTGAACTTTGAAGGAAGTCCCAGTTGCACAGAAGGGAGTATAACCCCAAAGATGGACAGACGAAGGTTTAGCTTTCATAAACTTATTGAATGTGACACTTTATCAAGGAAAAAGTCAGTGCAACAAAAGACAGACAGTGAATGTTTTGCTGAGAGCAAGACTGAGGAAACGCTGTCCGATGCGCAGGAAGCAGTGAAGAAAGGTAGGTCCCTGAGCATTGTGGACCCCACAGGAAATAATGAGCCAGAAGAGCCTGCCTGGAGAATTAAAATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATTTGCAGATGACATGTTaaaaaaaaaaaccaattttggtgggggggggggggggggggggggtggggggTACTCGAGGGGGGCCCGTACCCATCGCCTTAGATGTCGGAAA
  5   1   2      seed Ga15      in                       XL415n03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCCGCTCAATTCTGATCAGCCCAGAGGTCCAGTCTGTGGCAGAAAGCAAAGGAGAGGAAGCAGATGATGAGAGAAGTGAACTTGTTAGCGAGGGGCGGCCGATGGAAACAGACAGTGAGAATGATTTCCCCATATTTGCTTCAAGCCTTGCCTTCGATAGGCAACATCAGAGCAAAGCGGAAGAGCCATCAAGGAATGTTCAAGTGAACTCTGAAGGAAGTCCCAGTTGCACAGAAGGGAGTATAACCCCAAAGATGGACAGACGAAGGTTTAGCTCTCATAAACTTATTGAATGTGACACTTTATCAAGGAAAAAGTCAGTGCAACAAAAGACAGACAGTGAATGTTCTGCTGAGAGCAAGACTGAGGAAACGCTGTCCGATGCGCAGGAAGCAGTGAAGAAAGGTAGGTCCCTGAGCATTGTGGACCCCACAGGAAATAATGAGCCAGAAGAGCCTGCCTGGAGAATTAAAATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATTGGAAGTCAAAAAGCAAATGCCACTGAGACCCGAAAGAAGAAAAACATTCGGCGGAGGCACACACTTGGGGGACAAAGAGACTTTGCAGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCCAAGGAAGCTGAACTTTCTGCCGTGGATCGTTTGAAGCCAAAGTGTCCTTCCCAGGACCTCTCTATTTCCGAATGGCTCGTCCGGGAACG
  5   1   2       bld Ga15                               XL424f05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCAATTCTGATCAGCCCAGAGGTCCAGTCTGTGGCAGAAAGCAAAGGAGAGGAAGCAGATGATGAGAGAAGTGAACTTGTTAGCGAGGGGCGGCCGATGGAAACAGACAGTGAGAATGATTTCCCCATATTTGCTTCAAGCCTTGCCTTCGATAGGCAACATCAGAGCAAAGCGGAAGAGCCATCAAGGAATGTTCAAGTGAACTCTGAAGGAAGTCCCAGTTGCACAGAAGGGAGTATAACCCCAAAGATGGACAGACGAAGGTTTAGCTCTCATAAACTTATTGAATGTGACACTTTATCAAGGAAAAAGTCAGTGCAACAAAAGACAGACAGTGAATGTTCTGCTGAGAGCAAGACTGAGGAAACGCTGTCCGATGCGCAGGAAGCAGTGAAGAAAGGTAGGTCCCTGAGCATTGTGGACCCCACAGGAAATAATGAGCCAGAAGAGCCTGCCTGGAGAATTAAAATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATTGGAAGTCAAAAAGCAAATGCCACTGAGACCCGAAAGAAGAAAAACATTCGGCGGAGGCACACACTTGGGGGACAAAGAGACTTTGCAGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCCAAGGAAGCTGAACTTTCTGCCGTGGATCGTTTGAAGCCAAAGTGTCCTTCCCAGGACCTCTCTATTTCCGAATGGCTCGTCCGGGAACGTTTACGCACTANCACATCCGAGCTCANCACGGTGGAGCCTGAANA
  5   1   2       bld Oo1                             IMAGE:5079584.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAAGGAGAGGAAGCAGATGATGAGAGAAGTGAACTTGTTAGCGAGGGGCGGCCGATGGAAACAGACAGTGAGAATGATTTCCCCATATTTGCTTCAAGCCTTGCCTTCGATAGGCGACATCAGAGCAAAGCGGAAGAGCCATCAAGGAATGTTCAAGTGAACTCTGAAGGAAGTCCCAGTTGCACAGAAGGGAGTATAACCCCAAAGATGGACAGACGAAGGTTTAGCTCTCATAAACTTATTGAATGTGACACTTTATCAAGGAAAAAGTCAGTGCAACAAAAGACAGACAGTGAATGTTCTGCTGAGAGCAAGACTGAGGAAACGCTGTCCGATGCGCAGGAAGCAGTGAAGAAAGGTAGGTCCCTGAGCATTGTGGACCCCACAGGAAATAATGAGCCAGAAGAGCCTGCCTGGAGAATTAAAATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATTGGAAGTCAAAAAGCAAATGCCGCTGAGACCCGAAAGAAGAAAAACATTCGGCGGAGGCACACACTTGGGGGACATAGAGACTTTGCAGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCCAAGGAAGCTGAACTTTCTGCCGTGGATCGTTTGAAGCCAAAGTGTCCTTCCCAGGACCTCTCTATTTCCGAATGGCTCGTCCGGGAACGTTTACGCACTAGCACATCCGAGCTCAGCACGGTGGAGCCTGAAGAAAAACACATTAGTGAGACCACTGGNTCAGAAAGAGTCCGCCTCTGCCAGCCCACCACCATCATCTCCATCACAAGTAAGCACAGCCGTCCTTTCCCGCTGGAAAGTGACAGN
  5   1   2       add Oo1                             IMAGE:5084296.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGAGGAAGCAGATGATGAGAGAAGTGAACTTGTTAGCGAGGGGCGGCCGATGGAAACAGACAGTGAGAAGGATTTCCCCGTGTTTGCTTCAAGCCTTGCCTTGCGATAGGCGACATCAGAGCAAAGCGGAAGAGCCATCAAGGAATGTTCAAGTGAACTCTGAAGGAAGTCCCGGTTGCACGGAAGGGAGTATAACCGCAAAGATGGACAGACGAAGGTTTAGCTCTCATAGAGTTATGGAATGTGACACTGGATCAAGGAAAAAGTCAGTGCGACAGAAGACAGACAGTGAATGTTCTGCTGAGAGCAAGACTGAGGAAACGCTGTCCGATGCGCAGGAAGCAGTGAAGAAAGGTAGGTCCCTGAGCATTGTGGACCCCACAGGAAATAATGAGCCAGAAGAGCCTGCCTGGAGAATTAAAATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATTGGAAGTCAAAAAGCAAATGCCGCTGAGACCCGAAAGAAGAAAAACATTCGGCGGAGGCACACACTTGGGGGACATAGAGACTTTGCAGAAAGCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCCAAGGAAGCTGAACTTTCTGCCGTGGATCGTTTGAAGCCAAAGTGTCCCTTCCCCAGGACCCTCTCTATTTCCCGAATGGCTCGGTCCGGGGAACGTTTTACGCCACCTAAGCACATTCCCGAGGCTCCAGCAACGGTGGGAAGCCCTTGAAAGAAAAAAACACCATTTAGTTGGAGGACCCACCTGGGGTCCAGGAAAAAGAAGTTCCGGCCCTTCCTTGGCCCCAGCCCCCCAACCACACCAATTCAATTCTTCCCAATTCCACACAAGGTAAAAGGCAACCAGGCCCCCGGTCTCCCTTTCCCCGCCGCCTGTGGGAAA
  3  -1   2       add Ga15                               XL462f05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAACTTTGTTAGCGAGGGGCGGCCGATCGGAAACAGACNGTGAGAATGATTTCCCCATATTTGCTTCAAGCCTTGCCTTCGATAGGCAACATCAGAGCAAAGCGGANGAGCCATCAAGGAATGTTCAAGTGAACTCTGAANGAAGTCCCANTTGCACAGAAGGGAGTATANCCCCGAAGATGGACAGACGAAGGTTTAGCTCTCATANNCTTATTGAATGTGACNCTTTATCAAGGAAAAAGTCNGTGCAANAAAAGACAGACAGTGAATGTTCTGCTGAGAGCAAGACTGAGGAAACGCTGTCCNATGCGCAGG
  5   1   2       bld Em10                            IMAGE:8320634.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCGACATCAGAGCAAAGCGGAAGAGCCATCAAGGAATGTTCAAGTGAACTCTGAAGGAAGTCCCAGTTGCACAGAAGGGAGTATAACCCCAAAGATGGACAGACGAAGGTTTAGCTCTCATAAACTTATTGAATGTGACACTTTATCAAGGAAAAAGTCAGTGCAACAAAAGACAGACAGTGACTGTTCTGCTGAGAGCAAGACTGAGGAAACGCTGTCCGATGCGCAGGAAGCAGTGAAGAAAGGTAGGTCCCTGAGCATTGTGGACCCCACAGGAAATAATGAGCCAGAAGAGCCTGCCTGGAGAATTAAAATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATTGGAAGTCAAAAAGCAAATGCCGCTGAGACCCGAAAGAAGAAAAACATTCGGCGGAGGCACACACTTGGGGGACATAGAGACTTTGCAGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCCAAGGAAGCTGAACTTTCTGCCGTGGATCGTTTGAAGCCAAAGTGTCCTTCCCAGGACCTCTCTATTTCCGAATGGCTCGTCCGGGAACGTTTACGCACTAGCACATCCGAGCTCAGCACGGTGGAGCCTGAAGAAAACACATTAGTGAGACACTGGTCAGAAGAGTCGCCTCTGCAGCCCACACATCATCTCATCACAGTAGCACAGCGTCCTTCCGCTGGAGTGACACCATCCACGAAACGCACCAGCTGAGATCAATGATGTGACGCTT
  5   1   2       bld Tbd2      in                    IMAGE:3201176.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGCAAAGCGGAAGAGCCATCAAGGAATGTTCAAGTGAACTCTGAAGGAAGTCCCAGTTGCACAGAAGGGAGTATAACCCCAAAGATGGACAGACGAAGGTTTAGCTCTCATAAACTTATTGAATGTGACACTTTATCAAGGAAAAAGTCAGTGCAACAAAAGACAGACAGTGAATGTTCTGCTGAGAGCAAGACTGAGGAAACGCTGTCCGATGCGCAGGAAGCATTGAAGAAAGGTAGGTCCCTGAGCATTGTGGACCCCACAGGAAATAATGAGCCAGAAGAGCCTGCCTGGAGAATTAAAATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATTGGAAGTCAAAAAGCAAATGCCACTGAGACCCGAAAGAAGAAAAACATTCGGCGGAGGCACACACTTGGGGGACAAAGAGACTTTGCAGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCCAAGGAAGCTGAACTTTCTG
  5   1   2       bld Tad1                            IMAGE:6936998.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGAGTCCCAGTTGCACAGAAGGGAGTATAACCCCAAAGATGGACAGACGAAGGTTTAGCTCTCATAAACTTATTGAATGTGACACTTTATCAAGGAAAAAGTCAGTGCAACAAAAGACAGACAGTGACTGTTCTGCTGAGAGCAAGACTGAGGAAACGCTGTCCGATGCGCAGGAAGCAGTGAAGAAAGGTAGGTCCCTGAGCATTGTGGACCCCACAGGAAATAATGAGCCAGAAGAGCCTGCCTGGAGAATTAAAATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATTGGAAGTCAAAAAGCAAATGCCGCTGAGACCCGAAAGAAGAAAAACATTCGGCGGAGGCACACACTTGGGGGACATAGAGACTTTGCAGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCCAAGGAAGCTGAACTTTCTGCCGTGGATCGTTTGAAGCCAAAGTGTCCTTCCCAGGACCTCTCTATTTCCGAATGGCTCGTCCGGGAACGTTTACGCACTAGCACATCCCGAGCTCAGCACGGGGGGACCTGGAAGAAAAACACATTAATCGAGACCCCCTGGTCCAGAAAGGAGTCCCGCCTCCTGGCCAGGCCACCACCCATTCATCCTCCTATCCAAAAGTTAAGCAACAGGCCGTTCCCTTTCCCCGCTTGGGAAAGTGGACAGCCCCCCTTCCCCACCGAAAAACGGCCCACCCCCAAGCCCTGGTACCAATTCCAAATATGAAATGGGGTGGGACAGGCTTTTTCCCaaaaaaacgaaaaC
  5   1   2       bld Emb1                            IMAGE:6864115.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCACGCGTCCGGCCTTAAAGCATCTGCAGATGACATGTTTGGAATTGGAAGTCAAAAAGCAAATGCCGCTGAGACCCGAAAGAAGAAAAACATTCGGCGGAGGCACACACTTGGGGGACATAGAGACTTTGCAGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCCAAGGAAGCTGAACTTTCTGCCGTGGATCGTTTGAAGCCAAAGTGTCCTTCCCAGGACCTCTCTATTTCCGAATGGCTCGTCCGGGAACGTTTACGCACTAGCACATCCGAGCTCAGCACGGTGGAGCCTGAAGAAAAACACATTAGTGAGACCACTGGTCAGAAAGAGTCCGCCTCTGCCAGCCCACCACCATCATCTCCATCACAAGTAAGCACAGCCGTCCTTCCCGCTGGAAGTGACAGCCCATCCCACGAAACGGCACCCCAGCCTGACGATCAAATGAATGGTGACAGCTTCCAGAGCAAAACAAAAACAACTTCAGTCCTGCCGTCGATGCCCACCCTCATAAACTCTCTGGTACTCAAGTAGTCAGATCTCGATTTTACCAGTACCTTTAAACGCTACCCACAGTTGCAGTTTATAGCCTCTAGTTTATTTACATGTATATCTTGTGCCTGAACtttattttttgttttgtttttCAGCCTTATTAGGGCTAAATTCATTCATAGGCCCTGTGGAACGTCTTCACAGAGCTTCGCTGCAGCCAGATGAACATGACATTGACAGAAtttttttcttttttAATGGAAGTACTCATGAAATCTGAACAATTAAATTTGGGAGATAAATTCTTCTTTTGTACACACTGGCTAATCGTGGT
  5   1   0       add Egg1                               PBX0140H11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGTCCGCCTCTGCCAGCCCACCACCATCATCTCCATCACAAGTAAGCACAGCCGTCCTTCCCGCTGGAAGTGACAGCCCATCCCACGAAACGGCACCCCAGCCTGACGATCAAATGAATGGTGACAGCTTCCAGAGCAAAAACAAAAACAACTTCAGTCCTGCCGTCGATGCCCACCCTCATAAACTCTCTGGTACTCAAGTAGTCAGATCTCGATTTTACCAGTACCTTTAAACGCTACCCACAGTTGCAGTTTATAGCCTCTAGTTTATTTACATGTATATCTTGTGCCTGAACtttattttttgttttgtttttCAGCCTTATTAGGGCTAAATTCATTCATAGGCCCTGTGGAACGTCTTCACAGAGCTTCGCTGCAGCCAGATGAACATGACATTGACAGAAtttttttctttttAATGGAAGTACTCATGAAATCTGAACAAT
  5   1   2      ests                             Xl3.1-rxlk114o09ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTCACAGAGCTTCGCTGCAGCCAGATGAACATGACATTGACAGAATTTTTTTCTTTTTAATGGAAGTACTCATGAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTCTCTGCCACAATAACACACATTCTTCTCACTTAGCTCCAAAGTCAGGGATCTGCAACCCGGGTCTCTACCCAGAATCCCATGATAGCTGTCTTCCTATTAGGGGATGATGGGAGTTTACCCACTGGAGAGCCAAGCGTTACGTGGCCCCAAGTAAAGTGCCTCATTATGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACATGCTAATTCAAGAAACGTGAACTGTGAGCAAATCCGTAACGTTTTATCCGTGACCAGTTTCCATTCAGTTTAACCGATTTTAACAGGCGGATTCCGAGCTTCCATTCCGATGCATTCCAGTCAGATCTCCCCGTTTTATACACACACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTAAAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAAGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAACACTGGAAATAAAAGTCTTTGGTGATCATTTTTTT
                                                  Xl3.1-CHK-1012695284                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAGCTTCGCTGCAGCCAGATGAACATGACATTGACAGAATTTTTTTCTTTTTAATGGAAGTACTCATGAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTCTCTGCCACAATAACACACATTCTTCTCACTTAGCTCCAAAGTCAGGGATCTGCAACCCGGGTCTCTACCCAGAATCCCATGATAGCTGTCTTCCTATTAGGGGATGATGGGAGTTTACCCACTGGAGAGCCAAGCGTTACGTGGCCCCAAGTAAAGTGCCTCATTATGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACATGCTAATTCAAGAAACGTGAACTGTGAGCAAATCCGTAACGTTTTATCCGTGACCAGTTTCCATTCAGTTTAACCGATTTTAACAGGCGGATTCCGAGCTTCCATTCCGATGCATTCCAGTCAGATCTCCCCGTTTTATACACACACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTAAAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAAGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAACACTGGAAATAAAAGTCTTTGGTGATCATTTTTTTTTAATA
  5   1   2       bld Tad2                            IMAGE:6935717.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGATCCCACGAAACGGCACCCCAGCCTGACGATCAAATGAATGGTGACAGCTTCCAGAGCAAAAACAAAAACAACTTCAGTCCTGCCGTCGATGCCCACCCTCATAAACTCTCTGGTACTCAAGTAGTCAGATCTCGATTTTACCAGTACCCTTAAACGCTACCCACAGTTGCAGTTTATAGCCTCTAGTTTATTTACATGTATATCTTGTGCCTGAACtttagtttttgttttgtttttCAGCCTTATTAGGGCTAAATTCATTCATAGGCCCTGTGGAACGTCTTCACAGAGCTTCGCTGCAGCCAGATGAACATGACATTGACAGAATTAtttttttttctttttAATGGAAGTACTCATGAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTCTCTGCCACAATAACACACATTCTTCTCACTTAGCTCCAAAGTCAGGGATCTGCAACCCGGGTCTCTACCCAGAATCCCATGATAGCTGTCTTCCTATTAGGGGATGATGGGAGTTTACCCACTGGAGAGCCAAGCGTTACGTGGCCCCAAGTAAAGTGCCTCATTATGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACATGCTAATTCAAGAAACGTGAACTGTGAGCAAATCCGTAACATTTTATCCCTTGACCAGTTTCCATTCAGTTTAACCGATTTTTAACGGCGGGATTCCGAGCTTCCATTTC
  5   1   2       bld Egg1                               PBX0057D09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCAGCCTGACGATCAAATGAATGGTGACAGCTTCCAGAGCAAAAACAAAAACAACTTCAGTCCTGCCGTCGATGCCCACCCTCATAAACTCTCTGGTACTCAAGTAGTCAGATCTCGATTTTACCAGTACCTTTAAACGCTACCCACAGTTGCAGTTTATAGCCTCTAGTTTATTTACATGTATATCTTGTGCCTGAACtttattttttgttttgtttttCAGCCTTATTAGGGCTAAATTCATTCATAGGCCCTGTGGAACGTCTTCACAGAGCTTCGCTGCAGCCAGATGAACATGACATTGACAGAAtttttttctttttAATGGAAGTACTCATGAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTCTCTGCCACAATAACACACATTCTTCTCACTTAGCTCCAAAGTCAGGGATCTGCAACCCGGGTCTCTACCCAGAATCCCATGATAGCTGTCTTCCTATTAGGGGATGATGGGAGTTTACCCACTGGAGAGCCAAGCGTTACG
  3   1   2       bld Tad1      in                    IMAGE:6878987.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTTACCCAGGTTCCCTTTTAAACCGCTACCCCAACCAGTTTGCCAGTTTATAGGCCTCTTAGTTTATTTTACAATGTATTTTTTTGTGGCCTGAACTTAATTTTTTGTTTGGGTTTTCAGCCTTATAGGGGCTAAAATTCATCCTTGGGCCCTGTGGAAAGTCTTCACAGAGCTTCGCTGCAGCCAGATGAACATGACATTGACAGAATTTTTTCTTTTTAAATGGAAGTACTCATGAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTCTCTGCCACAATAACACACATTCTTCTCACTTAGCTCCAAAGTCAGGGATCTGCAACCCGGGTCTCTACCCAGAATCCCATGATAGCTGTCTTCCTATTAGGGGATGATGGGAGTTTACCCACTGGAGAGCCAAGCGTTACGTGGCCCCAAGTAAAGTGCCTCATTATGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACATGCTAATTCAAGAAACGTGAACTGTGAGCAAATCCGTAACGTTTTATCCGTGACCAGTTTCCATTCAGTTTAACCGATTTTAACAGGCGGATTCCGAGCTTCCATTCCGATGCATTCCAGTCAGATCTCCCCGTTTTATACACACACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTAAAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAAGAATATAATTCTGCATGAAGTCC
  3   1   2       bld Ga18                             rxlk114o09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGACTTNTTTTTNTTTNNTTTTCAGCCTNATTAGGNCTAAANTNATTCATAGNNCTNNNGAACGTCTTCACAnnnnnnnnCTGnAnCCAGATnnACATGACAnTGACAGAATTTTTTTCTTTTTAATGGAAGTACTCATGAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTCTCTGCCACAATAACACACATTCTTCTCACTTAGCTCCAAAGTCAGGGATCTGCAACCCGGGTCTCTACCCAGAATCCCATGATAGCTGTCTTCCTATTAGGGGATGATGGGAGTTTACCCACTGGAGANCCAAGCGTTACGTGGCCCCAAGTAAAGTGCCTCATTATGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACATGCTAATTCAAGAAACGTGAACTGTGAGCAAATCCGTAACGTTTTATCCGTGACCAGTTTCCATTCAGTTTAACCGATTTTAACAGGCGGATTCCGAGCTTCCATTCCGATGCATTCCAGTCAGATCTCCCCGTTTTATACACACACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTAAAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAAGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGANCANNANACCCACGNAAACACTNGAAATAA
  3   1   2      seed Ga15      in                       XL415n03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGNATTTTTTTTTTTCTTTTTAATGGAAGTACTCATGAAATCTGAACAATTAATTTGGAGATAAATTCTTNTTTGTACACACTGCTAGTCATGTNTGCTACTTCATTCTCTGCCACAATAACACACATTCTTCTCACTTAGCTCCAAAGTCAGGGATCTGCAACCCGGGTCTCTACCCAGAATCCCATGATAGCTGTCTTCCTATTAGGGGATGATGGGAGTTTACCCACTGGAGAGCCAAGCGTTACGTGGCCCCAAGTAAAGTGCCTCATTATGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACATGCTAATTCAAGAAACGTGAACTGTGAGCAAATCCGTAACGTTTTATCCGTGACCAGTTTCCATTCAGTTTAACCGATTTTAACAGGCGGATTCCGAGCTTCCATTCCGATGCATTCCAGTCAGATCTCCCCGTTTTATACACACACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTAAAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAAGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAACCCCGGAAAAA
  3   1   2       bld Ga12      out                        XL157e10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAGTCAGGGATCTGCAACCCGGGTCTCTACCCAGAATCCCATGATAGCTGTCTTCCTATTAGGGGATGATGGGAGTTTACCCACTGGAGAGCCAAGCGTTACGTGGCCCCAAGTAAAGTGCCTCATTATGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACATGCTAATTCAAGAAACGTGAACTGTGAGCAAATCCGTAACGTTTTATCTGTGACCAGTTTCCATTCAGTTTAACCGATTTTAACAGGCGGATTCCGAGCTTCCATTCCGATGCATTCCAGTCAGATCTCCCCGTTTTATACACACACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGT
  3   1   2       bld Tbd2      in                    IMAGE:3201176.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCCCATGATAGCTGTCTTCCTATTAGGGGATGATGGGAGTTTACCCACTGGAGAGCCAAGCGTTACGTGGCCCCAAGTAAAGTGCCTCATTATGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACATGCTAATTCAAGAAACGTGAACTGTGAGCAAATCCGTAACGTTTTATCCGTGACCAGTTTCCATTCAGTTTAACCGATTTTAACAGGCGGATTCCGAGCTTCCATTCCGATGCATTCCAGTCAGATCTCCCCGTTTTATACACACACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTAAAATAGGCATGTAGA
  3   1   2       bld Tbd7                                 XL094n19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGAGCCAAGCGTTACGTGGCCCCAAGTAAAAGTGCCTCATTATGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACATGCTAATTCAAGAAACGTGAACTGTGAGCAAATCCGTAACGTTTTATCCGTGACCAGTTTCCATTCAGTTTAACCGATTTTAACAGGCGGATTCCGAGCTTCCATTCCGATGCATTCCAGTCAGATCTCCCCGTTTTATACACACACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTAAAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAAGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCCTGNAGCAGCACACCCAC
  3   1   2       bld Ooc2      in                    IMAGE:3746275.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGCCAAGCGTTACGTGGCCCCAAGTAAAGTGCCTCATTATGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACATGCTAATTCAAGAAACGTGAACTGTGAGCAAATCCGTAACGTTTTATCCGTGACCAGTTTCCATTCAGTTTAACCGATTTTAACAGGCGGATTCCGAGCTTCCATTCCGATGCATTCCAGTCAGATCTCCCCGTTTTATACACACACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTAAAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAAGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAACACTGGAAATAAAAGTCTTTGGTGATCATTTTTTTTTAATAATAA
  5   1   2       bld Ga15      in                       XL420f13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAAAGTGCCTCATTATGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACATGCTAATTCAAGAAACGTGAACTGTGAGCAAATCCGTAACGTTTTATCCGTGACCAGTTTCCATTCAGTTTAACCGATTTTAACAGGCGGATTCCGAGCTTCCATTCCGATGCATTCCAGTCAGATCTCCCCGTTTTATACACACACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTAAAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAAGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAACACTGGAAATAAAAGTCTTTGGTGATCAtttttttttaataaaaaaaaaa
  3   1   2       bld Ga15      in                       XL420f13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAAAGTGCCTCATTATGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACATGCTAATTCAAGAAACGTGAACTGTGAGCAAATCCGTAACGTTTTATCCGTGACCAGTTTCCATTCAGTTTAACCGATTTTAACAGGCGGATTCCGAGCTTCCATTCCGATGCATTCCAGTCAGATCTCCCCGTTTTATACACACACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTAAAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAAGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)