Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-PBX0095B12.5                          7 END     1           8       14                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:5512667.5                       7 PI      77       1264     1585                c-ets-1b proto-oncogene [Xenopus laevis]
     3   0.0    0Xl3.1-IMAGE:8544815.5                       4 PI      90         96      792                ets-2a proto-oncogene [Xenopus laevis]

 This cluster: approximate FL confidence score = 96%

 1012838714 Xl3.1-IMAGE:6630729-IMAGp.5.5 - 12 ESTs
                                                                       ......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                         Xl3.1-IMAGE:6630729-IMAGp.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGGGGTATCTCCGGCCGCTGCGCTTAAAGGGCGATTACAGCTCGAACGCTCACGGGAGCTCAGGATTCTTCTCTCTGTTCCGAGCCTGGGAATTCTATTAACTCTCAGTGTCGCCAACGACCTCCTTTGGATTGTTTGTGGATAATTATATACTCGGGAAGGACATACCCTCCCTCAGCTGCTCAGGGCCAATGACAGAGTTTGGAATTCGAAACATGGACCAAGTGGCTCCAGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTAGCGTTTGACAATGTCCAAGTGCCGACCTCGCTCTACTGTGGCTTATTTTCTGCTTATGAAGAAGAACAGGCCGTGCCAACAGGCCTGGACTCTTACCCTCATGATTCCAGCAGCTGTGAGTTACCCCTGCTAACCCCGTGCAGCAAAGCTGTGATGAGTCAAGCGCTGAAAGATACGTTTAATGGTTTTGCGAAGGAACGATGCAGACTTGGCATCCCCGGCAATCCATGGCTTTGGGATGAGAATAATGTGTTACAGTGGCTTTTGTGGGCCGCCAAGGAATTCTCCTTGGAGAACGTGAATTTTCAGAAGTTTCTCATGAATGGACACGAGCTATGCAGCCTCGGGAAGGAGAGGTTTTTGGCTCTGGCACCTGACTTCGTTGGGGACATACTTTGGGAACATCTGGAAGAAATGATGAAAGAGCATCAAGAAAAGGCCCAGGAGGCCATATATTGACCATTCTAACCGGGGACTCACTAAAACCAGTGGGATGAATGCAGAATTCTTTAAATTTCACTGCCTGAATCCGTTGCAAGTGTGGGGGCACAAGTACCCCAATTACCCCTAAAAATGGGAATGTAATAAAGGCCCACTGGTCAGACTCTCCTCAACCCCAAACAAGAGTTCCAACAATACCCCAGCTCTTGCCTTAAATCCAGAGCGGTAAACTACTCACCCGCCAGCCAGGACTTTGCCAGGAGCAATATGAATGCACTGCTCAATTCTCTAAATTCTGGCAAGTTGAGAGATTATGACTCGGGAGACAGTGGCACGGAAAGCTTCGAGAGCACCGAATCTCTACTACAGTCTTGGACGAGCCAGTCTTCTCTTGTCGACATGCAACGAGTTCCTTCTTACGACGGCTTTGAGGAAGATGGCAGCCAGGCGTTATGCCTAAATAAGCCACCTATGTCCTTTAAAGATTACATCCAAGACAGATGTGAGCCAGCAGAACTAGGCAAGCCTGTTATTCCGGCATCTATACTTGCTGGATTCACAGGAAGTGGACCAATCCAGCTGTGGCAATTCCTGTTGGAACTTTTAACGGATAAGTCATGTCAGTCGTTTATCAGCTGGACTGGGGACGGATGGGAGTTCAAGCTGACTGACCCAGATGAGGTGGCCCGTCGGTGGGGCAAAAGGAAAAACAAACCTAAAATGAACTACGAGAAGCTTAGTCGAGGACTAAGGTATTATTACGACAAGAACATTATCCACAAGACATCAGGGAAGAGATACGTGTACCGATTTGTTTGTGACCTTCACAACTTATTGGGCTACACGCCGGATGAATTGCACGCAATGCTTGGAGTACAGCCCGACACAGACGAATGAGCTGCCGGAGTGTGAACTAAATCATTGGTTTGAAGAGCACATTATTGTACTGTGAAAAGGATCGTTTAGTGGGCTGTCCAAGATGGCCGAACAGTGCATGACTTCAAAAGACTGGAAACATCAAATCCGTGACATGAATTGGCTCTTTGCTCTGTTTTCTTAGATCGGAGTAAAGATCTGATGGATGGC
                                                  Xl3.1-CHK-1012722070                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TATCTCCGGCCGCTGCGCTTAAAGGGCGATTACAGCTCGAACGCTCACGGGAGCTCAGGATTCTTCTCTCTGTTCCGAGCCTGGGAATTCTATTAACTCTCAGTGTCGCCAACGACCTCCTTTGGATTGTTTGTGGATAATTATATACTCGGGAAGGACATACCCTCCCTCAGCTGCTCAGGGCCAATGACAGAGTTTGGAATTCGAAACATGGACCAAGTGGCTCCAGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTAGCGTTTGACAATGTCCAAGTGCCGACCTCGCTCTACTGTGGCTTATTTTCTGCTTATGAAGAAGAACAGGCCGTGCCAACAGGCCTGGACTCTTACCCTCATGATTCCAGCAGCTGTGAGTTACCCCTGCTAACCCCGTGCAGCAAAGCTGTGATGAGTCAAGCGCTGAAAGATACGTTTAATGGTTTTGCGAAGGAACGATGCAGACTTGGCATCCCCGGCAATCCATGGCTTTGGGATGAGAATAATGTGTTACAGTGGCTTTTGTGGGCCGCCAAGGAATTCTCCTTGGAGAACGTGAATTTTCAGAAGTTTCTCATGAATGGACACGAGCTATGCAGCCTCGGGAAGGAGAGGTTTTTGGCTCTGGCACCTGACTTCGTTGGGGACATACTTTGGGAACATCTGGAAGAAATGATGAAAGAGCATCAAGAAAAGGCCCxxGxxGCCATATATTGACCATTCTAACCGGGGACTCACTAAAACCAGTGGGATGAATGCAGAATTCTTTAAATTTCACTGCCTGAATCCGTTGCAAGTGTGGGGGCACAAGTACCCCAATTACCCCTAAAAATGGGAATGTAATAAAGGxxxxxxGGTCAGACTCTCCTCAACCCCAAACAAGAGTTCCAACAATACCCCAGCTCTTGCCTTAAATCCAGAGCGGTAAACTACTCACCCGCCAGCCAGGACTTTGCCAGGAGCAATATGAATGCACTGCTCAATTCTCTAAATTCTGGCAAGTTGAGAGATTATGACTCGGGAGACAGTGGCACGGAAAGCTTCGAGAGCACCGAATCTCTACTACAGTCTTGGACGAGCCAGTCTTCTCTTGTCGACATGCAACGAGTTCCTTCTTACGACGGCTTTGAGGAAGATGGCAGCCAGGCGTTATGCCTAAATAAGCCACCTATGTCCTTTAAAGATTACATCCAAGACAGATGTGAGCCAGCAGAACTAGGCAAGCCTGTTATTCCGGCATCTATACTTGCTGGATTCACAGGAAGTGGACCAATCCAGCTGTGGCAATTCCTGTTGGAACTTTTAACGGATAAGTCATGTCAGTCGTTTATCAGCTGGACTGGGGACGGATGGGAGTTCAAGCTGACTGACCCAGATGAGGTGGCCCGTCGGTGGGGCAAAAGGAAAAACAAACCTAAAATGAACTACGAGAAGCTAAGTCGAGGACTAAGGTATTATTACGACAAGAACATTATCCACAAGACATCAGGGAAGAGATACGTGTACCGATTTGTTTGTGACCTTCACAACTTATTGGGCTACACGCCGGATGAATTGCACGCAATGCTTGGAGTACAGCCCGACACAGACGAATGAGCTGCCGGAGTGTGAACTAAATCATTGGTTTGAAGAGCACATTATTGTACTGTGAAAAGGATCGTTTAGTGGGCTGTCCAAGATGGCCGAACAGTGCATGACTTCAAAAGACTGGAAACATCAAATCCGTGACATGAATTGGCTCTTTGCTCTGTTTTCTTAGATCGGAGTAAAGATCTGATG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                2     3     3     3     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     3     5     2     4     1     3     1     3     2     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     2     4     2     4     2     3     2     3     2     3     2     3     2     3     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     4     2     4     3     4     3     4     3     4     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     4     4     3     4     4     4     3     4     3     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3
  5   1   2      ests                      Xl3.1-IMAGE:6630729-IMAGp.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGGGGTATCTCCGGCCGCTGCGCTTAAAGGGCGATTACAGCTCGAACGCTCACGGGAGCTCAGGATTCTTCTCTCTGTTCCGAGCCTGGGAATTCTATTAACTCTCAGTGTCGCCAACGACCTCCTTTGGATTGTTTGTGGATAATTATATACTCGGGAAGGACATACCCTCCCTCAGCTGCTCAGGGCCAATGACAGAGTTTGGAATTCGAAACATGGACCAAGTGGCTCCAGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTAGCGTTTGACAATGTCCAAGTGCCGACCTCGCTCTACTGTGGCTTATTTTCTGCTTATGAAGAAGAACAGGCCGTGCCAACAGGCCTGGACTCTTACCCTCATGATTCCAGCAGCTGTGAGTTACCCCTGCTAACCCCGTGCAGCAAAGCTGTGATGAGTCAAGCGCTGAAAGATACGTTTAATGGTTTTGCGAAGGAACGATGCAGACTTGGCATCCCCGGCAATCCATGGCTTTGGGATGAGAATAATGTGTTACAGTGGCTTTTGTGGGCCGCCAAGGAATTCTCCTTGGAGAACGTGAATTTTCAGAAGTTTCTCATGAATGGACACGAGCTATGCAGCCTCGGGAAGGAGAGGTTTTTGGCTCTGGCACCTGACTTCGTTGGGGACATACTTTGGGAACATCTGGAAGAAATGATGAAAGAGCATCAAGAAAAGGCCCAGGAG
  5   1   2      ests                            Xl3.1-IMAGE:3379512.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTGCCTACTGGTCAAACTCTCCTCCACCCCAAACAAGAGTTCCAACAATACCCCAGCTCTTGCCTTAAATCCAGAGCGGTAAACTACTCACCCGCCAGCCAGGACTTTGCCAGGAGCAATATGAATGCACTGCTCAATTCTCTAAATTCTGGCAAGTTGAGAGATTATGACTCGGGAGACAGTGGCACGGAAAGCTTCGAGAGCACCGAATCTCTACTACAGTCTTGGACGAGCCAGTCTTCTCTTGTCGACATGCAACGAGTTCCTTCTTACGACGGCTTTGAGGAAGATGGCAGCCAGGCGTTATGCCTAAATAAGCCACCTATGTCCTTTAAAGATTACATCCAAGACAGATGTGAGCCAGCAGAACTAGGCAAGCCTGTTATTCCGGCATCTATACTTGCTGGATTCACAGGAAGTGGACCAATCCAGCTGTGGCAATTCCTGTTGGAACTTTTAACGGATAAGTCATGTCAGTCGTTTATCAGCTGGACTGGGGACGGATGGGAGTTCAAGCTGACTGACCCAGATGAGGTGGCCCGTCGGTGGGGCAAAAGGAAAAACAAACCTAAAATGAACTACGAGAAGCTAAGTCGAGGACTAAGGTATTATTACGACAAGAACATTATCCACAAGACATCAGGGAAGAGATACGTGTACCGATTTGTTTGTGACCTTCACAACTTATTGGGCTACACGCCGGATGAATTGCACGCAATGCTTGGAGTACAGCCCGACACAGACGAATGAGCTGCCGGAGTGTGAACTAAATCATTGGTTTGAAGAGCACATTATTGTACTGTGAAAAGGATCGTTTAGTGGGCTGTCCAAGATGGCCGAACAGTGCATGACTTCAAAAGACTGGAAACATCAAATCCGTGACATGAATTGGCTCTTTGCTCTGTTTTCTTAGATCGGAGTAAAGATCTGATGGATTACTTTCTGAAGAAAAGTGACTATCGAGATATCCAGCAATGGTCAGGACTCAATGACTCCATCAGATCCTGTCTATTGATACCACAGCATCGTGGCACTTTCCGCATCAGGATCTATGAAAAAGGAAGGATT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       T-----------
                                               BLH ATG     192    1528                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                               BLH MIN     192     206                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                               BLH OVR     192      30                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                               EST CLI      -5      21                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ce ---- 3e-030     NP_508865.1 friend leukemia integration 1 like (XF694) [Caenorhabditis elegans] =======================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Ag ---- 6e-050     XP_557464.3 AGAP004619-PA [Anopheles gambiae str. PEST] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Dm ---- 4e-053     NP_732858.1 pointed CG17077-PC [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Ci ---- 8e-058     NP_001071702.1 transcription factor protein [Ciona intestinalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Sp ---- 6e-059     NP_999698.1 ets homolog [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Dr ---= 6e-131     NP_001018874.1 hypothetical protein LOC326672 [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Bt ==== 3e-173     NP_001073683.1 v-ets erythroblastosis virus E26 oncogene homolog 2 [Bos taurus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Mm ==== 2e-174     NP_035939.2 E26 avian leukemia oncogene 2, 3' domain [Mus musculus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Cf ==== 1e-174     XP_544886.2 PREDICTED: similar to C-ets-2 protein isoform 1 [Canis familiaris] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Hs ==== 3e-177     NP_005230.1 v-ets erythroblastosis virus E26 oncogene homolog 2; Oncogene ETS-2; v-ets avianerythroblastosis virus E2 oncogene homolog 2; v-ets avian erythroblastosis virusE26 oncogene homolog 2; human erythroblastosis virus oncogene homolog 2 [Homosapiens] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Gg ==== 0          NP_990643.1 v-ets avian erythroblastosis virus E26 oncogene homolog 2 [Gallus gallus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Xt ==== 0          NP_001120533.1 hypothetical protein LOC100145687 [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xl ==== 0          NP_001081505.1 X1-c-ets-2b protein [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                         Xl3.1-IMAGE:6630729-IMAGp.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAA------------------------------------------------------------------------------------------ATG---------------------ATG------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATGATG------------------------------------TGA------TAA------------TAA---------------------------TAA------------------------------------------------------------ATG---ATGTAATAA------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------TGA------------TGA---------------TGA---------------------------------TAG------------------------------------------------------------TGA------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
  5   1   2      ests                      Xl3.1-IMAGE:6630729-IMAGp.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGGGGTATCTCCGGCCGCTGCGCTTAAAGGGCGATTACAGCTCGAACGCTCACGGGAGCTCAGGATTCTTCTCTCTGTTCCGAGCCTGGGAATTCTATTAACTCTCAGTGTCGCCAACGACCTCCTTTGGATTGTTTGTGGATAATTATATACTCGGGAAGGACATACCCTCCCTCAGCTGCTCAGGGCCAATGACAGAGTTTGGAATTCGAAACATGGACCAAGTGGCTCCAGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTAGCGTTTGACAATGTCCAAGTGCCGACCTCGCTCTACTGTGGCTTATTTTCTGCTTATGAAGAAGAACAGGCCGTGCCAACAGGCCTGGACTCTTACCCTCATGATTCCAGCAGCTGTGAGTTACCCCTGCTAACCCCGTGCAGCAAAGCTGTGATGAGTCAAGCGCTGAAAGATACGTTTAATGGTTTTGCGAAGGAACGATGCAGACTTGGCATCCCCGGCAATCCATGGCTTTGGGATGAGAATAATGTGTTACAGTGGCTTTTGTGGGCCGCCAAGGAATTCTCCTTGGAGAACGTGAATTTTCAGAAGTTTCTCATGAATGGACACGAGCTATGCAGCCTCGGGAAGGAGAGGTTTTTGGCTCTGGCACCTGACTTCGTTGGGGACATACTTTGGGAACATCTGGAAGAAATGATGAAAGAGCATCAAGAAAAGGCCCAGGAG
                                                  Xl3.1-CHK-1012698709                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TATCTCCGGCCGCTGCGCTTAAAGGGCGATTACAGCTCGAACGCTCACGGGAGCTCAGGATTCTTCTCTCTGTTCCGAGCCTGGGAATTCTATTAACTCTCAGTGTCGCCAACGACCTCCTTTGGATTGTTTGTGGATAATTATATACTCGGGAAGGACATACCCTCCCTCAGCTGCTCAGGGCCAATGACAGAGTTTGGAATTCGAAACATGGACCAAGTGGCTCCAGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTAGCGTTTGACAATGTCCAAGTGCCGACCTCGCTCTACTGTGGCTTATTTTCTGCTTATGAAGAAGAACAGGCCGTGCCAACAGGCCTGGACTCTTACCCTCATGATTCCAGCAGCTGTGAGTTACCCCTGCTAACCCCGTGCAGCAAAGCTGTGATGAGTCAAGCGCTGAAAGATACGTTTAATGGTTTTGCGAAGGAACGATGCAGACTTGGCATCCCCGGCAATCCATGGCTTTGGGATGAGAATAATGTGTTACAGTGGCTTTTGTGGGCCGCCAAGGAATTCTCCTTGGAGAACGTGAATTTTCAGAAGTTTCTCATGAATGGACACGAGCTATGCAGCCTCGGGAAGGAGAGGTTTTTGGCTCTGGCACCTGACTTCGTTGGGGACATACTTTGGGAACATCTGGAAGAAATGATGAAAGAGCATCAAGAAAAGGCC
  5   1   2       bld Ga12 5x3  out                        XL209h20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCACGAGATTGTATCTCCGGCCGCTGCGCTTAAAGGGCGATTACAGCTCGAACGCTCACGGGAGCTCAGGATTCTTCTCTCTGTTCCGAGCCAGGGAATTCTATTAACTCTCAGTGTCGCCAACGACCTCCTTTGGATTGTTTGTGGATAATTATATACTCGGGAAGGACATACCCTCCCTCAGCTGCTCAGGGCCAATGACAGAGTTTGGAATTCGAAACATGGACCAAGTGGCTCCAGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTAGCGTTTGACAATGTCCAAGTGCCGACCTCCCTCTACTGTGGCTTATTTTCTGCTTATGAAGAAGAACAGGCCGTACCAACGGGCCTGGACTCTTACCCTCATGATTCCAGCAGCTGTGAGTTACCCCTGCTAACCCCGTGCAGCAAAGCTGTGATGAGTCAAGCGCTGAAAGATACGTTTAATGGTTTTGCGAAGGAACGATGCAGACTTGGCATCCCCGGCAATCCATGGCTTTGGGATGAGAATAATGTGTTACAGTGGCTTTTGTGGGCCGCCAAGGAATTCTCCCTGGAGAACGTGAATTTTCAGAAGTTTCTCATGAATGGACACGAGCTGTGCAGCCTCGGGAAGGAGAGGTTTTTGGCTCTGGCACCTGACTTCG
  5   1   2       bld Bla1 5g3  in                    IMAGE:3379512.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGGGGTATCTCCGGCCGCTGCGCTTAAAGGGCGATTACAGCTCGAACGCTCACGGGAGCTCAGGATTCTTCTCTCTGTTCCGAGCCTGGGAATTCTATTAACTCTCAGTGTCGCCAACGACCTCCTTTGGATTGTTTGTGGATAATTATATACTCGGGAAGGACATACCCTCCCTCAGCTGCTCAGGGCCAATGACAGAGTTTGGAATTCGAAACATGGACCAAGTGGCTCCAGTGTATAACGGCCACAGAGGAATGNCTCAAGCG
  5   1   2       bld Bla1 5g3  in                    IMAGE:3379513.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGGGGTATCTCCGGCCGCTGCGCTTAAAGGGCGATTACAGCTCGAACGCTCACGGGAGCTCAGGATTCTTCTCTCTGTTCCGAGCCTGGGAATTCTATTAACTCTCAGTGTCGCCAACGACCTCCTTTGGATTGTTTGTGGATAATTATATACTCGGGAAGGACATACCCTCCCTCAGCTGCTCAGGGCCAATGACAGAGTTTGGAATTCGAAACATGGACCAAGTGGCTCCAGTGTATAACGGCCACAGAGGAATGCTCAAGC
  5   1   2      seed Emb1 5g                IMAGE:6630729-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGCTTAAAGGGCGATTACAGCTCGAACGCTCACGGGAGCTCAGGATTCTTCTCTCTGTTCCGAGCCTGGGAATTCTATTAACTCTCATTGTCGCCAACGACCTCCTTTGGATTGTTTGTGGATAATTATATACTCGGGAAGGACATACCCTCCCTCAGCTGCTCAGGGCCAATGACAGAGTTTGGAATTCGAAACATGGACCAAGTGGCTCCAGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTAGCGTTTGACAATGTCCAAGTGCCGACCTCGCTCTACTGTGGCTTATTTTCTGCTTATGAAGAAGAACAGGCCGTGCCAACAGGCCTGGACTCTTACCCTCATGATTCCAGCAGCTGTGAGTTACCCCTGCTAACCCCGTGCAGCAAAGCTGTGATGAGTCAAGCGCTGAAAGATACGTTTAATGGTTTTGCGAAGGAACGATGCAGACTTGGCATCCCCGGCAATCCATGGCTTTGGGATGAGAATAATGTGTTACAGTGGCTTTTGTGGGCCGCCAAGGAATTCTCCTTGGAGAACGTGAATTTTCAGAAGTTTCTCATGAATGGACACGAGCTATGCAGCCTCGGGAAGGAGAGGTTTTTGGCTCTGGCACCTGACTTCGTTGGGGACATACTTTGGGAACATCTGGAAGAAATGATGAAAGAGCATCAAGAAAAGGCCCAGGAGCCATA
  5   1   2       bld Emb1 5g                         IMAGE:6630729.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCTTAAAGGGCGATTACAGCTCGAACGCTCACGGGAGCTCAGGATTCTTCTCTCTGTTCCGAGCCTGGGAATTCTATTAACTCTCATTGTCGCCAACGACCTCCTTTGGATTGTTTGTGGATAATTATATACTCGGGAAGGACATACCCTCCCTCAGCTGCTCAGGGCCAATGACAGAGTTTGGAATTCGAAACATGGACCAAGTGGCTCCAGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTAGCGTTTGACAATGTCCAAGTGCCGACCTCGCTCTACTGTGGCTTATTTTCTGCTTATGAAGAAGAACAGGCCGTGCCAACAGGCCTGGACTCTTACCCTCATGATTCCAGCAGCTGTGAGTTACCCCTGCTAACCCCGTGCAGCAAAGCTGTGATGAGTCAAGCGCTGAAAGATACGTTTAATGGTTTTGCGAAGGAACGATGCAGACTTGGCATCCCCGGCAATCCATGGCTTTGGGATGAGAATAATGTGTTACAGTGGCTTTTGTGGGCCGCCAAGGAATTCTCCTTGGAGAACGTGAATTTTCAGAAGTTTCTCATGAATGGACACGAGCTATGCAGCCTCGGGAAGGAGAGGTTTTTGGCTCTGGCACCTGACTTCGTTGGGGACATACTTTGGGAACATCTGGAAGAAATGATGAAAGAGCATCCAGAAAAGGCCCCAGGAGCCATATATTGACCATTCTAACCGGGGACTCACTAAAACCAGTGGGATGAATGCAGAATTCTTTAAATTTCACTGCCTGAATCCGTTGCAAGTGTGGGGGCACAAGTACCCCAATTACCCCTAAAAATGGGAATGTAATAAAGGATATGGGGCTCCAGGGCCCCACCTGGTCCAGAAATTCTCCCTCAAACCCCCAAACAAAGAGGTTCCCAACAAATAACCCCCAAGCTCCTTGGCCT
  5   1   2       bld Emb1 5g                         IMAGE:6631306.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCTTAAAGGGCGATTACAGCTCGAACGCTCACGGGAGCTCAGGATTCTTCTCTCTGTTCCGAGCCTGGGAATTCTATTAACTCTCATTGTCGCCAACGACCTCCTTTGGATTGTTTGTGGATAATTATATACTCGGGAAGGACATACCCTCCCTCAGCTGCTCAGGGCCAATGACAGAGTTTGGAATTCGAAACATGGACCAAGTGGCTCCAGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTAGCGTTTGACAATGTCCAAGTGCCGACCTCGCTCTACTGTGGCTTATTTTCTGCTTATGAAGAAGAACAGGCCGTGCCAACAGGCCTGGACTCTTACCCTCATGATTCCAGCAGCTGTGAGTTACCCCTGCTAACCCCGTGCAGCAAAGCTGTGATGAGTCAAGCGCTGAAAGATACGTTTAATGGTTTTGCGAAGGAACGATGCAGACTTGGCATCCCCGGCAATCCATGGCTTTGGGATGAGAATAATGTGTTACAGTGGCTTTTGTGGGCCGCCAAGGAATTCTCCTTGGAGAACGTGAATTTTCAGAAGTTTCTCATGAATGGACACGAGCTATGCAGCCTCGGGAAGGAGAGGTTTTTGGCTCTGGCACCTGACTTCGTTGGGGACATACTTTGGGAACATCTGGAAGAAATGATGGAAAGAGCATCAAGAAAAGGCCCAGGAAGCCCTATATTGACCATTCTAACCGGGACTCACTTAACCAGTGGATGAATGCAGATTCCTTAAATTTCACTGCTGATCCGTTGCAATGTGGGGCACAAGTACCACATTTACCCTAAAAAAGGGAATGTATAATTGATAGGTGGCTCAGTGCCCACTGGTCCAAATCTCCCCTCCAC
  5   1   2       bld Ga12 5g3  out                        XL194h22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCAACGACCTCCTTTGGATTGTTTGTGGATAATTATATACTCGGGAAGGACATACCCTCCCTCAGCTGCTCAGGGCCAATGACAGAGTTTGGAATTCGAAACATGGACCAAGTGGCTCCAGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTAGCGTTTGACAATGTCCAAGTGCCGACCTCCCTCTACTGTGGCTTATTTTCTGCTTATGAAGAAGAACAGGCCGTACCAACGGGCCTGGACTCTTACCCTCATGATTCCAGCAGCTGTGAGTTACCCCTGCTAACCCCGTGCAGCAAAGCTGTGATGAGTCAAGCGCTGAAAGATACGTTTAATGGTTTTGCGAAGGAACGATGCAGACTTGGCATCCCCGGCAATCCATGGCTTTGGGATGAGAATAATGTGTTACAGTGGCTTTTGTGGGCCGCCAAGGAATTCTCCCTGGAGAACGTGAATTTTCAGAAGTTTCTCATGAATGGACACGAGCTGTGCAGCCTCGGGAAGGAGAGGTTTTTGGCTCTGGCACCTGACTTCGTTGGGGACATACTTTGGGAACATCTGGAAGAAATGATGAAAGAGCATCAAGAAAAGGC
  5   1   2       bld Ga12                                 XL189f11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCAAGCGCCAGTTAGCGTTTGACAATGTCCAAGTGCCGACCTCGCTCTACTGTGGCTTATTTTCTGCTTATGAAGAAGAACAGGCCGTGCCAACAGGCCTGGACTCTTACCCTCATGATTCCAGCAGCTGTGAGTTACCCCTGCTAACCCCGTGCAGCAAAGCTGTGATGAGTCAAGCGCTGAAAGATACGTTTAATGGTTTTGCGAAGGAACGATGCAGACTTGGCATCCCCGGCAATCCATGGCTTTGGGATGAGAATAATGTGTTACAGTGGCTTTTGTGGGCCGCCAAGGAATTCTCCTTGGAGAACGTGAATTTTCAGAAGTTTCTCATGAATGGACACGAGCTATGCAGCCTCGGGAAGGAGAGGTTTTTGGCTCTGGCACCTGACTTCGTTGGGGACATACTTTGGGAACATCTGGAAGAAATGATGAAAGAGTATCAAGAAAAGGCCCAGGAGCCGTATATTGACCATTCTAACCGGGACTCACTAAACCAGTGGATGAATGCAGATTCCTTAAATTTCACTGCTGATCCGTTGCAGTGTGGGGCACAAGTACACAATTACCCTAAAAATGGAATGTATAATGATATGTGCTCAGTGCCCACTGGTCAGACTCTCCTCAACCCCAAACAAGAGTTCCAACAATACCCCAGCTCTTGCCTTAAATCCAGAGCAGTAAACTACCCGCCCGCCA
  5   1   2      ests                            Xl3.1-IMAGE:3379512.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTGCCTACTGGTCAAACTCTCCTCCACCCCAAACAAGAGTTCCAACAATACCCCAGCTCTTGCCTTAAATCCAGAGCGGTAAACTACTCACCCGCCAGCCAGGACTTTGCCAGGAGCAATATGAATGCACTGCTCAATTCTCTAAATTCTGGCAAGTTGAGAGATTATGACTCGGGAGACAGTGGCACGGAAAGCTTCGAGAGCACCGAATCTCTACTACAGTCTTGGACGAGCCAGTCTTCTCTTGTCGACATGCAACGAGTTCCTTCTTACGACGGCTTTGAGGAAGATGGCAGCCAGGCGTTATGCCTAAATAAGCCACCTATGTCCTTTAAAGATTACATCCAAGACAGATGTGAGCCAGCAGAACTAGGCAAGCCTGTTATTCCGGCATCTATACTTGCTGGATTCACAGGAAGTGGACCAATCCAGCTGTGGCAATTCCTGTTGGAACTTTTAACGGATAAGTCATGTCAGTCGTTTATCAGCTGGACTGGGGACGGATGGGAGTTCAAGCTGACTGACCCAGATGAGGTGGCCCGTCGGTGGGGCAAAAGGAAAAACAAACCTAAAATGAACTACGAGAAGCTAAGTCGAGGACTAAGGTATTATTACGACAAGAACATTATCCACAAGACATCAGGGAAGAGATACGTGTACCGATTTGTTTGTGACCTTCACAACTTATTGGGCTACACGCCGGATGAATTGCACGCAATGCTTGGAGTACAGCCCGACACAGACGAATGAGCTGCCGGAGTGTGAACTAAATCATTGGTTTGAAGAGCACATTATTGTACTGTGAAAAGGATCGTTTAGTGGGCTGTCCAAGATGGCCGAACAGTGCATGACTTCAAAAGACTGGAAACATCAAATCCGTGACATGAATTGGCTCTTTGCTCTGTTTTCTTAGATCGGAGTAAAGATCTGATGGATTACTTTCTGAAGAAAAGTGACTATCGAGATATCCAGCAATGGTCAGGACTCAATGACTCCATCAGATCCTGTCTATTGATACCACAGCATCGTGGCACTTTCCGCATCAGGATCTATGAAAAAGGAAGGATT
                                                  Xl3.1-CHK-1012709051                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACTGGTCAAACTCTCCTCCACCCCAAACAAGAGTTCCAACAATACCCCAGCTCTTGCCTTAAATCCAGAGCGGTAAACTACTCACCCGCCAGCCAGGACTTTGCCAGGAGCAATATGAATGCACTGCTCAATTCTCTAAATTCTGGCAAGTTGAGAGATTATGACTCGGGAGACAGTGGCACGGAAAGCTTCGAGAGCACCGAATCTCTACTACAGTCTTGGACGAGCCAGTCTTCTCTTGTCGACATGCAACGAGTTCCTTCTTACGACGGCTTTGAGGAAGATGGCAGCCAGGCGTTATGCCTAAATAAGCCACCTATGTCCTTTAAAGATTACATCCAAGACAGATGTGAGCCAGCAGAACTAGGCAAGCCTGTTATTCCGGCATCTATACTTGCTGGATTCACAGGAAGTGGACCAATCCAGCTGTGGCAATTCCTGTTGGAACTTTTAACGGATAAGTCATGTCAGTCGTTTATCAGCTGGACTGGGGACGGATGGGAGTTCAAGCTGACTGACCCAGATGAGGTGGCCCGTCGGTGGGGCAAAAGGAAAAACAAACCTAAAATGAACTACGAGAAGCTAAGTCGAGGACTAAGGTATTATTACGACAAGAACATTATCCACAAGACATCAGGGAAGAGATACGTGTACCGATTTGTTTGTGACCTTCACAACTTATTGGGCTACACGCCGGATGAATTGCACGCAATGCTTGGAGTACAGCCCGACACAGACGAATGAGCTGCCGGAGTGTGAACTAAATCATTGGTTTGAAGAGCACATTATTGTACTGTGAAAAGGATCGTTTAGTGGGCTGTCCAAGATGGCCGAACAGTGCATGACTTCAAAAGACTGGAAACATCAAATCCGTGACATGAATTGGCTCTTTGCTCTGTTTTCTTAGATCGGAGTAAAGATCTGxxxxAxTACTTTCTGAAGAAAAGTGACTATCGAGATATCCAGCAATGGTCAGGACTCAATGACTCCATCAGATCCTGTCTATTGATACCACAGCATCGTGGCACTTTCCGCATCAGGATCTATGAAAAAGGAAGGATTTTGGGG
  5   1   2       bld Kid                             IMAGE:7008591.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTGCCTACTGGTCAAACTCTCCTCCACCCCAAACAAGAGTTCCAACAATACCCCAGCTCTTGCCTTAAATCCAGAGCGGTAAACTACTCACCCGCCAGCCAGGACTTTGCCAGGAGCAATATGAATGCACTGCTCAATTCTCTAAATTCTGGCAAGTTGAGAGATTATGACTCGGGAGACAGTGGCACGGAAAGCTTCGAGAGCACCGAATCTCTACTACAGTCTTGGACGAGCCAGTCTTCTCTTGTCGACATGCAACGAGTTCCTTCTTACGACGGCTTTGAGGAAGATGGCAGCCAGGCGTTATGCCTAAATAAGCCACCTATGTCCTTTAAAGATTACATCCAAGACAGATGTGAGCCAGCAGAACTAGGCAAGCCTGTTATTCCGGCATCTATACTTGCTGGATTCACAGGAAGTGGACCAATCCAGCTGTGGCAATTCCTGTTGGAACTTTTAACGGATAAGTCATGTCAGTCGTTTATCAGCTGGACTGGGGACGGATGGGAGTTCAAGCTGACTGACCCAGATGAGGTGGCCCGTCGGTGGGGCAAAAGGAAAAACAAACCCAAAATGAACTACGAGAAGCTTAGCCGAGGACTAAGGTATTATTACGACAAGAACATTATCCACAAGACGTCGGGGAAGAGATACGTGTACCGATTCGTTTGCGACCTTCACAACCTGTTGGGGTTACACACGGATGAATTGCATGCCATGCTTGGCGTACAGCCCGACAAAACGAATGACTGCTGGATGCGAC
  5   1   2      seed Brn1                            IMAGE:6955781.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTGGACGAGCCAGTCTTCTCTTGTCGACATGCAACGAGTTCCTTCTTACGATGGCTTTGAGGAAGATGGCAGCCAGGCGTTATGCCTAAATAAGCCACCTATGTCCTTTAAAGATTACATCCAAGACAGATGTGAGCCAGCAGAACTAGGAAAGCCTGTTATTCCGGCATCTATACTTGCTGGATTCACAGGAAGTGGACCAATCCAGCTGTGGCAATTCCTGTTGGAACTTTTAACGGATAAGTCATGTCAGTCGTTTATCAGCTGGACTGGGGACGGATGGGAGTTCAAGCTGACTGACCCAGATGAGGTGGCCCGTCGGTGGGGcaaaaggaaaaacaaaccaaaaaTGAACTACGAGAAGCTTAGTCGAGGACTAAGGTATTATTACGACAAGAACATTATCCACAAGACGTCGGGGAAGAGATACGTGTACCGATTCGTTTGCGACCTTCACAACCTGTTGGGTTACACACCGGATGAATTGCACGCCATGCTTGGCGTACAGCCCGACACAGACGAATGAGCTGCTGGAAACTGTTCATAATGGGAAAGATCATCTTTTACGAGGACAAGAATTTCCAAGGTCGGTCGTATGAGTGCAACAGTGACTCTGCTGATCTGCACTCATTCTTCAGTCGATGCAACTCAATTCGCGTGGATAATGGAACCTGGGATATTGTATGAACACCCCAACTACAAAGGGCACCAGTACTTTCTGAAGAAAAGTGACTATCGAGATATCCAGCAATGGTCAGGACTCAATGACTCCATCAGATCCTGTCTATTGATACCACAGCATCGTGGCACTTTCCGCATCAGGATCTATGAAAAAGGAAGGATTTTGGGG
  3   1   1       add Bla1 5g3  in                    IMAGE:3379513.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGTAAGCTAGCATAATTAGGAAACATGTTTATTCCCGGATCTATACTCGTTGGCTCCCACGGCAGTGGACCGATCCCATTTGGCACGCTCTCGTGGCACCCTTCAACGGATCAGTTATGTCAGTCCTTTATCAGCTGGACTGGGGATGGATGGGAGTTCAAGCTGGCTGACCCAGATGAGGTGGCCCGGCGGTGGGGTAAAAGGAAAAACAAACCTAAAATGAACTACGAGAAGCTAAGTCGAGGACTAAGGTATTATTATGACAAGAACATCATCCACAAGACATCAGGGAAGAGATACGTGTACCGATTTGTTTGTGACCTTCACAACTTATTGGGCTACACGCCGGATGAATTGCACGCAATGCTTGGAGTACAGCCCGACACAGACGAATGAGCTGCCGGAGTGTGAACTAAATCATTGGTTTGAAGAGCACATTATTGTACTGTGAAAAGGATCGTTTAGTGGGCTGTCCAAGATGGCCGAACAGTGCATGACTTCAAAAGACTGGAAACATCAAATCCGTGACATGAATTGGCTCTTTGCTCTGTTTTCTTAGATCGGAGTAAAGATCTGATGGATGGCGC
  3   1   1       add Bla1 5g3  in                    IMAGE:3379512.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTAGCCACCAGAACTAGCCCAACTGTATTCCCGCATCAAACTGCTGGCTTCCCAGGCAGTGGACCGATCCAATTGTGGCAGTTCTTGTTGGAACTTTTAACGGATAAGTCATGTCAGTCCTTTATCAGCTGGACTGGGGATGGATGGGAGTTCAAGCTGGCTGACCCAGATGAGGTGGCCCGGCGGTGGGGTAAAAGGAAAAACAAACCTAAAATGAACTACGAGAAGCTAAGTCGAGGACTAAGGTATTATTATGACAAGAACATCATCCACAAGACATCAGGGAAGAGATACGTGTACCGATTTGTTTGTGACCTTCACAACTTATTGGGCTACACGCCGGATGAATTGCACGCAATGCTTGGAGTACAGCCCGACACAGACGAATGAGCTGCCGGAGTGTGAACTAAATCATTGGTTTGAAGAGCACATTATTGTACTGTGAAAAGGATCGTTTAGTGGGCTGTCCAAGATGGCCGAACAGTGCATGACTTCAAAAGACTGGAAACATCAAATCCGTGACATGAATTGGCTCTTTGCTCTGTTTTCTTAGATCGGAGTAAAGATCTGATGGATGGCGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)