Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:5080106.5.5                    30 PI      78        884     1311                (no blast hit)
     2   0.0    0Xl3.1-IMAGE:7008455.5                      17 PI      79        886     1318                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:7390103.5                       9 PI      79        874     1131                CDC37 cell division cycle 37 homolog [Xenopus laevis]
     4   0.0    0Xl3.1-IMAGE:3380248-IMAGp.5                 7 PI      79        878     1155                (no blast hit)
     5   0.0    0Xl3.1-XL437b24ex.3                          6 PI      82        884     1083                (no blast hit)
     6   0.0    0Xl3.1-xlk117m15ex.3                         4 PI      81        880     1157                MGC108344 protein [Xenopus tropicalis]
     7   0.0    0Xl3.1-IMAGE:6634794.5                       4 PI      78        884     1147                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012838735 Xl3.1-IMAGE:6956236.3.5 - 22 ESTs
                                                                       ......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:6956236.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGAGCCTCAAAGCCAGGTTTCGCCCCAGATGCAAGTCCTGTAGAGAAATTTATTCAAACTAACTTCCCTGGCAGCGTGCAAAGGGAAAAACACTACAACATGTTACAGTACCAGATATCCTCATCTTCACTGGCAAGGGTATTCCAGCTTCTTATCTCCAATAAAGACAGCCTCAACATCGAGGAGTATTCTGTGTCACAGACTACTTTAGATCAGGTATTTGTGAACTTTGCCAAACAACAAACAGACGATGAAGATATCCATTTGCATCCTCGAGCTGCAGGGGCCACACGTGATGTGAAAGTAGCACCTGCTCCACCACCAAAAACACCTGCACAATAAAGGGCAGCCGCATACTGAATAGTGACAGATATTTTATAATAACAAAGTTGCTTTTTGAGCTGCAAAATGGTGATACAAATATTCACCAGTAATCATAGTCCCGGCAGTCATCCCTAGTACATAGGTGAGCAACATGCGCCATTGCAGCTACTGTGCTCTAATTACACAGTGAGTAACTTAAGCAGAATACTAATTTTTTATCAGTGATACTTTTTTTTTAATATAAAAAACAATCTTACAAGCAAAATATTTCTATATTCAAAAAAACACAAGTCAACAACAGCACCTTCACATATTTTCATACATAATTTCCTAAAATGTTACAACCTACTGTGTAATGTTTATAGTATCTGACCGCTACCCTCCATTATTTATATGCTGATTATAGAAATAAATTACTAAGAGTTTATGTACAGTGCTGTTCTGCAATGCTAAAGAAAGGTATAGGTTGGATTAAGATTTGGATGCTGCCCCTCACACATTAGAATTTGCAAATGTTATTCATAATTTTGATTTCCTACTAACAACGGATTCACACTTAGGGGGTTCTTTATTAAAGTCCGAATGCCAAAAACTAAAAGAAATCATTTTTTTTACTATAAAATACGTATTTTTAGTGGGGAAAAAAAACTTGATTTTTTTCCTGATTAATTATACCCTGAGGATGGAAAAAGTCTGAATCCCACAATCTGGCATCTCAGACCTGCCGAGGTTCTATATAAGTCAATGGGAGAAGTCCCGAAGATATCCTGCGCTGGGTTTCGTACAAAAAGCTGAAGATTTGGTGGTTTTCATGCAAAAATCTGAAAAAAAATAGAATTTTTTTCAGATTTTCACAATTTTCGAGTTTTTTTTCTGCACTGGAATTTTTCGGGAAAATGTATTGTTAAATAAGGGGAAATAACCCGTGCGGATTTGGTCGGTGTATATTTAAAAAAATAATGGGATAAACTCAGATTTTGATAAATAACCCCCTTATTATAAGGTTCAGATACAAAAGGTAACTGAGGACATGGTATTAGTCTGTGATACCTGAATACTATTACTGTGCTTGCAGCCATCATTCTAAATAGAAATACCCATGATGGCAAATCTAGGGGCTGTTTACCCATTAAAGCAAGAAAGCACCGCAGTTATCACTGATAACGTTTCACCAACTTAAGTTTTAGTTATTTTTTTAGTTATTTTTAATGATGCTTTAAAAGAGATAGTTAACAGATTCTTCTGTTGCATAGGGGAACATTTTATATTAAAGGTGTTTGGCTAAAAAACATATTTTTTAAATAAAACACTGAACTATTTAAAAGCTGCAGTGAGGGAACAAGGAATAAATGCTGCCATACCAGAACCAACCCGTTCATACCAAAAATGATACAGTCTAGTAATGTTCTAGATTTAGGAGTGTCCCATCTTACCTAAAGGCATGTGCTTGTGAGTTGGAATGGAGTATTATGGCTACAGTGATTGTCTCTTCCCAGCTATGCCTGTAATGTTTCATTTGTGCTCAGGCAAGAAAAAAATTAAAGACTGGCCATTCTGATACTGACATAACCCTGTTCTAACTATACATTCATCTACTCCACTGGATTTATACTCACTATTATTACTATTTGTAAAGAAATAAACACCTTTTTCTAAATAAGATGGGTGCACCTTTAAATATAAATATCATCATATTAAATAAAAAAATAAACCTGAATTTAACTGTGGAAATGTATCTTTGAAAGGCCTGTGCAGCTGTTTTACTTTAGATGGCTGATATTTCATGTCTTTATTTTGCACGGCACATAAAAATAAAAGCTCTCCTGGTAAAATAA
                                                  Xl3.1-CHK-1012721623                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCAAAGCCAGGTTTCGCCCCAGATGCAAGTCCTGTAGAGAAATTTATTCAAACTAACTTCCCTGGCAGCGTGCAAAGGGAAAAACACTACAACATGTTACAGTACCAGATATCCTCATCTTCACTGGCAAGGGTATTCCAGCTTCTTATCTCCAATAAAGACAGCCTCAACATCGAGGAGTATTCTGTGTCACAGACTACTTTAGATCAGGTATTTGTGAACTTTGCCAAACAACAAACAGACGATGAAGATATCCATTTGCATCCTCGAGCTGCAGGGGCCACACGTGATGTGAAAGTAGCACCTGCTCCACCACCAAAAACACCTGCACAATAAAGGGCAGCCGCATACTGAATAGTGACAGATATTTTATAATAACAAAGTTGCTTTTTGAGCTGCAAAATGGTGATACAAATATTCACCAGTAATCATAGTCCCGGCAGTCATCCCTAGTACATAGGTGAGCAACATGCGCCATTGCAGCTACTGTGCTCTAATTACACAGTGAGTAACTTAAGCAGAATACTAATTTTTTATCAGTGATACTTTTTTTTTAATATAAAAAACAATCTTACAAGCAAAATATTTCTATATTCAAAAAAACACAAGTCAACAACAGCACCTTCACATATTTTCATACATAATTTCCTAAAATGTTACAACCTACTGTGTAATGTTTATAGTATCTGACCGCTACCCTCCATTATTTATATGCTGATTATAGAAATAAATTACTAAGAGTTTATGTACAGTGCTGTTCTGCAATGCTAAAGAAAGGTATAGGTTGGATTAAGATTTGGATGCTGCCCCTCACACATTAGAATTTGCAAATGTTATTCATAATTTTGATTTCCTACTAACAACGGATTCACACTTAGGGGGTTCTTTATTAAAGTCCGAATGCCAAAAACTAAAAGAAATCATTTTTTTTACTATAAAATACGTATTTTTAGTGGGGAAAAAAAACTTGATTTTTTTCCTGATTAATTATACCCTGAGGATGGAAAAAGTCTGAATCCCACAATCTGGCATCTCAGACCTGCCGAGGTTCTATATAAGTCAATGGGAGAAGTCCCGAAGATATCCTGCGCTGGGTTTCGTACAAAAAGCTGAAGATTTGGTGGTTTTCATGCAAAAATCTGAAAAAAAATAGAATTTTTTTCAGATTTTCACAATTTTCGAGTTTTTTTTCTGCACTGGAATTTTTCGGGAAAATGTATTGTTAAATAAGGGGAAATAACCCGTGCGGATTTGGTCGGTGTATATTTAAAAAAATAATGGGATAAACTCAGATTTTGATAAATAACCCCCTTATTATAAGGTTCAGATACAAAAGGTAACTGAGGACATGGTATTAGTCTGTGATACCTGAATACTATTACTGTGCTTGCAGCCATCATTCTAAATAGAAATACCCATGATGGCAAATCTAGGGGCTGTTTACCCATTAAAGCAAGAAAGCACCGCAGTTATCACTGATAACGTTTCACCAACTTAAGTTTTAGTTATTTTTTTAGTTATTTTTAATGATGCTTTAAAAGAGATAGTTAACAGATTCTTCTGTTGCATAGGGGAACATTTTATATTAAAGGTGTTTGGCTAAAAAACATATTTTTTAAATAAAACACTGAACTATTTAAAAGCTGCAGTGAGGGAACAAGGAATAAATGCTGCCATACCAGAACCAACCCGTTCATACCAAAAATGATACAGTCTAGTAATGTTCTAGATTTAGGAGTGTCCCATCTTACCTAAAGGCATGTGCTTGTGAGTTGGAATGGAGTATTATGGCTACAGTGATTGTCTCTTCCCAGCTATGCCTGTAATGTTTCATTTGTGCTCAGGCAAGAAAAAAATTAAAGACTGGCCATTCTGATACTGACATAACCCTGTTCTAACTATACATTCATCTACTCCACTGGATTTATACTCACTATTATTACTATTTGTAAAGAAATAAACACCTTTTTCTAAATAAGATGGGTGCACCTTTAAATATAAATATCATCATATTAAATAAAAAAATAAACCTGAATTTAACTGTGGAAATGTATCTTTGAAAGGCCTGTGCAGCTGTTTTACTTTAGATGGCTGATATTTCATGTCTTTATTTTGCACGGCACATAAAAATAAAAGCTCTCCTGGTAAAATAATTTGTA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        2     2     2     2     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     5     3     6     3     6     3     6     3     6     3     6     3     5     3     5     3     5     3     6     3     6     3     6     3     7     3     7     3     7     3     7     3     6     3     6     4     6     4     6     4     6     4     6     5     6     5     6     5     6     5     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     7     3     8     3     8     3     8     3     8     3     8     3     8     3     8     2     7     2     7     2     7     2     7     2     6     2     6     2     6     4     6     3     6     4     6     3     6     4     6     4     6     5     6     5     6     4     6     4     6     4     7     4     7     4     7     4     7     5     8     5     8     5     9     5    10     5    10     5    10     5     9     5     9     5     9     6    11     7    11     7    11     9    11     8    11     8    12     8    11     8    11     8    11     8    12     9    12     9    12     9    12     9    12     8    12     9    12     9    12    10    12    11    12    10    12    11    12    10    12    10    12    10    12     9    12     9    12    10    12    10    12    10    12    10    12    10    12    10    12    10    12     9    12     9    12     9    12     9    11     9    11     9    11     9    11     9    11     9    11     9    11     8    11     8    10     8    10     8    10     8    10     8    10     9    11     9    11     9    10     8    10     8    10     8    10     8    10     8    10     8    10     8    10     9    10     7    10     6    10     7     9     6     9     5     8     5     8     5     8     5     8     5     7     5     7     5     7     4     6     3     4     3     4     3     4     3     3     3     3
  5   1   2      ests                            Xl3.1-IMAGE:6949857.5                                                                                                                                                                                                                                                                                                                                           GTTCGATGCCCTTGATGATCTCTTGACTGGCCGTGAACATCTTCAGCTGTATGGGCGATTACGTGGAGTACCTGAGGATGAAATTGATATGGTTGCAGACTGGGGCATTGAAAAACTGGGAGTTGGAAAATACGCAGACAATCTAGCTGGGACATACAGTGGTGGAAACAAGCGCAAGCTGGCTACTGCAATTGCCCTCATAGGATGTCCTCCCGTAGTGCTGCTGGATGAACCAACAACAGGTATGGATCCTCAGTCACGCCGATTCTTGTGGAACTCCATAGTCAGCATCATTAAAGAGGGCAGAGCGGTGATTTTGACTTCTCACAGCATGGAAGAATGTGAAGCTCTTTGCACTCGTCTTGCCATAATGGTCAAAGGCAAGTTCAAATGTCTTGGCACCATACAACATCTGAAGTATAAGTTTGGAGACGGTTACATTGTGACCATGAAGGTGAGAGCCTCAAAGCCAGGTTTCGCCCCAGATGCAAGTCCTGTAGAGAAATTTATTCAAACTAACTTCCCTGGCAGCGTGCAAAGGGAAAAACACTACAACATGTTACAGTACCAGATATCCTCATCTTCACTGGCAAGGGTATTCCAGCTTCTTATCTCCAATAAAGACAGCCTCAACATCGAGGAGTATTCTGTGTCACAGACTACTTTAGATCAGGTATTTGTGAACTTTGCCAAACAACAAACAGACGATGAAGATATCCATTTGCATCCTCGAGCTGCAGGGGCCACACGTGATGTGAAAGTAGCACCTGCTCCACCACCAAAAACACCTGCACAATAAAGGGCAGCCGCATACTGAATAGTGACAGATATTTTATAATAACAAAGTTGCTTTTTGAGCTGCAAAATGGTGATACAAATATTCACCAGTAATCATAGTCCCGGCAGTCATCCCTAGTACATAGGTGAGCAACATGCGCCATTGCAGCTACTGTGCTCTAATTACACAGTGAGTAACTTAAGCAGAATACTAATTTTTTATCAGTGATACTTTTTTTTTAATATAAAAAACAATCTTACAAGCAAAATATTTCTATATTCAAAAAAACACAAGTCAACAACAGCACCTTCACATATTTTCATACATAATTTCCTAAAATGTTACAACCTACTGTGTAATGTTTATAGTATCTGACCGCTACCCTCCATTATTTATATGCTGATTATAGAAATAAATTACTAAGAGTTTATGTACAGTGCTGTTCTGCAATGCTAAAGAAAGGTATAGGTTGGATTAAGATTTGGATGCTGCCCCTCACACATTAGAATTTGCAAATGTTATTCATAATTTTGATTTCCTAC
  5   1   2      ests                            Xl3.1-IMAGE:6956236.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGGGAAAAAAAACTTGATTTTTTTCCTGATTAATTATACCCTGAGGATGGAAAAAGTCTGAATCCCACAATCTGGCATCTCAGACCTGCCGAGGTTCTATATAAGTCAATGGGAGAAGTCCCGAAGATATCCTGCGCTGGGTTTCGTACAAAAAGCTGAAGATTTGGTGGTTTTCATGCAAAAATCTGAAAAAAAATAGAATTTTTTTCAGATTTTCACAATTTTCGAGTTTTTTTTCTGCACTGGAATTTTTCGGGAAAATGTATTGTTAAATAAGGGGAAATAACCCGTGCGGATTTGGTCGGTGTATATTTAAAAAAATAATGGGATAAACTCAGATTTTGATAAATAACCCCCTTATTATAAGGTTCAGATACAAAAGGTAACTGAGGACATGGTATTAGTCTGTGATACCTGAATACTATTACTGTGCTTGCAGCCATCATTCTAAATAGAAATACCCATGATGGCAAATCTAGGGGCTGTTTACCCATTAAAGCAAGAAAGCACCGCAGTTATCACTGATAACGTTTCACCAACTTAAGTTTTAGTTATTTTTTTAGTTATTTTTAATGATGCTTTAAAAGAGATAGTTAACAGATTCTTCTGTTGCATAGGGGAACATTTTATATTAAAGGTGTTTGGCTAAAAAACATATTTTTTAAATAAAACACTGAACTATTTAAAAGCTGCAGTGAGGGAACAAGGAATAAATGCTGCCATACCAGAACCAACCCGTTCATACCAAAAATGATACAGTCTAGTAATGTTCTAGATTTAGGAGTGTCCCATCTTACCTAAAGGCATGTGCTTGTGAGTTGGAATGGAGTATTATGGCTACAGTGATTGTCTCTTCCCAGCTATGCCTGTAATGTTTCATTTGTGCTCAGGCAAGAAAAAAATTAAAGACTGGCCATTCTGATACTGACATAACCCTGTTCTAACTATACATTCATCTACTCCACTGGATTTATACTCACTATTATTACTATTTGTAAAGAAATAAACACCTTTTTCTAAATAAGATGGGTGCACCTTTAAATATAAATATCATCATATTAAATAAAAAAATAAACCTGAATTTAACTGTGGAAATGTATCTTTGAAAGGCCTGTGCAGCTGTTTTACTTTAGATGGCTGATATTTCATGTCTTTATTTTGCACGGCACATAAAAATAAAAGCTCTCCTGGTAAAATAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ------A-----
  5   1   2      ests                            Xl3.1-IMAGE:6949857.5                                                                                                                                                                                                                                                                                                                                           GTTCGATGCCCTTGATGATCTCTTGACTGGCCGTGAACATCTTCAGCTGTATGGGCGATTACGTGGAGTACCTGAGGATGAAATTGATATGGTTGCAGACTGGGGCATTGAAAAACTGGGAGTTGGAAAATACGCAGACAATCTAGCTGGGACATACAGTGGTGGAAACAAGCGCAAGCTGGCTACTGCAATTGCCCTCATAGGATGTCCTCCCGTAGTGCTGCTGGATGAACCAACAACAGGTATGGATCCTCAGTCACGCCGATTCTTGTGGAACTCCATAGTCAGCATCATTAAAGAGGGCAGAGCGGTGATTTTGACTTCTCACAGCATGGAAGAATGTGAAGCTCTTTGCACTCGTCTTGCCATAATGGTCAAAGGCAAGTTCAAATGTCTTGGCACCATACAACATCTGAAGTATAAGTTTGGAGACGGTTACATTGTGACCATGAAGGTGAGAGCCTCAAAGCCAGGTTTCGCCCCAGATGCAAGTCCTGTAGAGAAATTTATTCAAACTAACTTCCCTGGCAGCGTGCAAAGGGAAAAACACTACAACATGTTACAGTACCAGATATCCTCATCTTCACTGGCAAGGGTATTCCAGCTTCTTATCTCCAATAAAGACAGCCTCAACATCGAGGAGTATTCTGTGTCACAGACTACTTTAGATCAGGTATTTGTGAACTTTGCCAAACAACAAACAGACGATGAAGATATCCATTTGCATCCTCGAGCTGCAGGGGCCACACGTGATGTGAAAGTAGCACCTGCTCCACCACCAAAAACACCTGCACAATAAAGGGCAGCCGCATACTGAATAGTGACAGATATTTTATAATAACAAAGTTGCTTTTTGAGCTGCAAAATGGTGATACAAATATTCACCAGTAATCATAGTCCCGGCAGTCATCCCTAGTACATAGGTGAGCAACATGCGCCATTGCAGCTACTGTGCTCTAATTACACAGTGAGTAACTTAAGCAGAATACTAATTTTTTATCAGTGATACTTTTTTTTTAATATAAAAAACAATCTTACAAGCAAAATATTTCTATATTCAAAAAAACACAAGTCAACAACAGCACCTTCACATATTTTCATACATAATTTCCTAAAATGTTACAACCTACTGTGTAATGTTTATAGTATCTGACCGCTACCCTCCATTATTTATATGCTGATTATAGAAATAAATTACTAAGAGTTTATGTACAGTGCTGTTCTGCAATGCTAAAGAAAGGTATAGGTTGGATTAAGATTTGGATGCTGCCCCTCACACATTAGAATTTGCAAATGTTATTCATAATTTTGATTTCCTAC
                                                  Xl3.1-CHK-1012700160                                                                                                                                                                                                                                                                                                                                                 TGCCCTTGATGATCTCTTGACTGGCCGTGAACATCTTCAGCTGTATGGGCGATTACGTGGAGTACCTGAGGATGAAATTGATATGGTTGCAGACTGGGGCATTGAAAAACTGGGAGTTGGAAAATACGCAGACAATCTAGCTGGGACATACAGTGGTGGAAACAAGCGCAAGCTGGCTACTGCAATTGCCCxxxxxxGxxxxxCxxCCxxxxxxxxxxxxGxxxxAxxxAxxAxxxGxxxxxxxxxxCxxxxxCxCxxxxxxTTxTxGxxxxxxxTAGTCAGCATCATTAAAGAGGGCAGAGCGGTGATTTTGACTTCTCACAGCATGGAAGAATGTGAAGCTCTTTGCACTCGTCTTGCCATAATGGTCAAAGGCAAGTTCAAATGTCTTGGCACCATACAACATCTGAAGTATAAGTTTGGAGACGGTTACATTGTGACCATGAAGGTGAGAGCCTCAAAGCCAGGTTTCGCCCCAGATGCAAGTCCTGTAGAGAAATTTATTCAAACTAACTTCCCTGGCAGCGTGCAAAGGGAAAAACACTACAACATGTTACAGTACCAGATATCCTCATCTTCACTGGCAAGGGTATTCCAGCTTCTTATCTCCAATAAAGACAGCCTCAACATCGAGGAGTATTCTGTGTCACAGACTACTTTAGATCAGGTATTTGTGAACTTTGCCAAACAACAAACAGACGATGAAGATATCCATTTGCATCCTCGAGCTGCAGGGGCCACACGTGATGTGAAAGTAGCACCTGCTCCACCACCAAAAACACCTGCACAATAAAGGGCAGCCGCATACTGAATAGTGACAGATATTTTATAATAACAAAGTTGCTTTTTGAGCTGCAAAATGGTGATACAAATATTCACCAGTAATCATAGTCCCGGCAGTCATCCCTAGTACATAGGTGAGCAACATGCGCCATTGCAGCTACTGTGCTCTAATTACACAGTGAGTAACTTAAGCAGAATACTAATTTTTTATCAGTGATACTTTTTTTTTAATATAAAAAACAATCTTACAAGCAAAATATTTCTATATTCAAAAAAACACAAGTCAACAACAGCACCTTCACATATTTTCATACATAATTTCCTAAAATGTTACAACCTACTGTGTAATGTTTATAGTATCTGACCGCTACCCTCCATTATTTATATGCTGATTATAGAAATAAATTACTAAGAGTTTATGTACAGTGCTGTTCTGCAATGCTAAAGAAAGGTATAGGTTGGATTAAGATTTGGATGCTGCCCCTCACACATTAGAATTTGCAAATGTTATTCATAATTTTGATTTCCTACTAACAA
  5   1   0       add Brn1                            IMAGE:6953027.5p TCCTAAAGGGTCTATAGATTGTGAAGATGAAGATATTGCACAGGAAAGGCAGAGAGTCATGAAAGGGGGAGGATAAAATGATATCTTAAAATTGAAGGAATTAACTAAGACATATCCAGGGAAACAGAGTCCTGCAGTGGATAGACTCTGTCTTGGTGTCCGGCCTGGAGAGTGTTTTGGCCTGCTCGGAGTTAATGGCGCTGGAAAGACCACCACATTCAAGATGCTTACTGGAGATATTCAAGTAACGTCAGGAGATGCCTCTGTGGCTGGATACAGCATCCTGCAGGACATTGCTGATGTGCACCAGAACACGGGATACTGTCCTCAGTTCGATGCCCTTGATGATCTCTTGACTGGCCGTGAACATCTTCAGCTGTATGGGCGATTACGTGGAGTACCTGAGGATGAAATTGATATGGTTGCAGACTGGGGCATTGAAAAACTGGGAGTTGGAAAATACGCAGACAATCTAGCTGGGACATACAGTGGTGGAAACAAGCGCAAGCTGGCTACTGCAATTGCCCCTCATAGGATGTCCTCCTGTAGTGCTGCTGGATGAAACAACAACAGGGGATGGATCCTCAGTCACGCCCAATTCTTGGGGGAACTCCGTAAGTCCGCCATCATTTAAAAAAGGGCAGAAACCGGGGAATTTTGAACTTTCTCCACCACCTGGGAGCAAATGTGGAAGCCTCTTTTGCCCCTCAGCTTTGGCCCTAAATGGGTCAAAAGGCAAAGCTTCAAAATGTCCCTGGGGCCCCCCCTACCAACATTTCTCGAAGATTTAAAAATTTTTGGGAAAACACGGTTCATCTTTTGGGGGGCCCCATTATAAAGGGCGAAGGAAGCCCTTTCAAAAGCCCCCGGGTTTTTTCCCGccccccccATATATCCAAGGTTCCCCGGCGAAAAA
  5   1   2       add Brn1                            IMAGE:6950679.5p                                                                                                                                                                                                                                                                                                                   TCCGGAATTCTCGGGATGTCCTCAGTTCGATGCCCTTGATGATCTCTTGACTGGCCGTGAACATCTTCAGCTGTATGGGCGATTACGTGGAGTACCTGAGGATGAAATTGATATGGTTGCAGACTGGGGCATTGAAAAACTGGGAGTTGGAAAATACGCAGACAATCTAGCTGGGACATACAGTGGTGGAAACAAGCGCAAGCTGGCTACTGCAATTGCCCTCATAGGATGTCCTCCCGTAGTGCTGCTGGATGAACCAACAACAGGTATGGATCCTCAGTCACGCCGATTCTTGTGGAACTCCATAGTCAGCATCATTAAAGAGGGCAGAGCGGTGATTTTGACTTCTCACAGCATGGAAGAATGTGAAGCTCTTTGCACTCGTCTTGCCATAATGGTCAAAGGCAAGTTCAAATGTCTTGGCACCATACAACATCTGAAGTATAAGTTTGGAGACGGTTACATTGTGACCATGAAGGTGAGAGCCTCAAAGCCAGGTTTCGCCCCAGATGCAAGTCCTGTAGAGAAATTTATTCAAACTAACTTCCCTGGCAGCGTGCAAAGGGAAAAACACTACAACATGTTACAGTACCAGATATCCTCATCTTCACTGGCAAGGGTATTCCAGCTTCTTATCTCCAATAAAGACAGCCTCAACATCGAGGAGTATTCTGTGTCACAGACTACTTTAGATCAGGTATTTGTGAACTTTGCCCAACAACAAACAGACGATGAAGATATCCATTTGCATCCCTCGAGCTGGCAGGGGCACACGTGGATGTGAAAAGTAGCACCTGGCTCCACCACCCAAAAACACCTGCACCATAAAAGGGCCAGCCCGCATACTGGAATAGTGGCCAAAAATTTTTAAAATAAACCAAAGTTGCCT
  5   1   2       bld Brn1      in                    IMAGE:4739982.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTGAGAGCCTCAAAGCCAGGTTTCGCCCCAGATGCAAGTCCTGTAGAGAAATTTATTCAAACTAACTTCCCTGGCAGCGTGCAAAGGGAAAAACACTACAACATGTTACAGTACCAGATATCCTCATCTTCACTGGCAAGGGTATTCCAGCTTCTTATCTCCAATAAAGACAGCCTCAACATCGAGGAGTATTCTGTGTCACAGACTACTTTAGATCAGGTATTTGTGAACTTTGCCAAACAACAAACAGACGATGAAGATATCCATTTGCATCCTCGAGCTGCAGGGGTCACACGTGATGTGAAAGTAGCACCTGCTCCACCACCAAAAACACCTGCACAATAAAGGGCAGCCAGCATACTGAATAGTGACAGATATTTTATAATAACAAAGTTGCTTTTTGAGCTGCAAAATGGTGATACAAATATTCACCAGTAATCATAGTCCCGGCAGTCATCCCTAGTACATAGGTGAGCAACATGCGCCATTGCAGCTACTGTGCTCTAATTACACAGTGAGTAACTTAAGCAGA
  5   1   2       bld Brn1                            IMAGE:6951910.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCAGGTTTCGCCCCAGATGCAAGTCCTGTAGAGAAATTTATTCAAACTAACTTCCCTGGCAGCGTGCAAAGGGAAAAACACTACAACATGTTACAGTACCAGATATCCTCATCTTCACTGGCAAGGGTATTCCAGCTTCTTATCTCCAATAAAGACAGCCTCAACATCGAGGAGTATTCTGTGTCACAGACTACTTTAGATCAGGTATTTGTGAACTTTGCCAAACAACAAACAGACGATGAAGATATCCATTTGCATCCTCGAGCTGCAGGGGCCACACGTGATGTGAAAGTAGCACCTGCTCCACCACCAAAAACACCTGCACAATAAAGGGCAGCCGCATACTGAATAGTGACAGATATTTTATAATAACAAAGTTGCTTTTTGAGCTGCAAAATGGTGATACAAATATTCACCAGTAATCATAGTCCCGGCAGTCATCCCTAGTACATAGGTGAGCAACATGCGCCATTGCAGCTACTGTGCTCTAATTACACAGTGAGTAACTTAAGCAGAATACTAATTTTTTATCAGTGATACtttttttttaatataaaaaacaatcttacaagcaaaatatttctatattcaaaaaaacacaaGTCAACAACAGCACCTTCACATATTTTCATAACATAATTTCCTAAAATGTTACAACCTACTGTGGAAAGTTTATAGTATCCGGACCGCTACCCCTCCATTATTTATATGCGTGATTATAGAAAATAAAATTACTAAGAGTTTTATGTACAGGGCCTGGTTCTGCAATGGCTaaaaaaaaGGGATAAGGGTGGGAATTAAAAATTTGGAAGGCTGCCCCCTCCAAACATTTAAAAATTTGGAAAAGGTTATTTCCAAAATTTTGAATTTC
  5   1   2       bld Brn1      in                    IMAGE:6956236.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TATTCAAACTAACTTCCCTGGCAGCGTGCAAAGGGAAAAACACTACAACATGTTACAGTACCAGATATCCTCATCTTCACTGGCAAGGGTATTCCAGCTTCTTATCTCCAATAAAGACAGCCTCAACATCGAGGAGTATTCTGTGTCACAGACTACTTTAGATCAGGTATTTGTGAACTTTGCCAAACAACAAACAGACGATGAAGATATCCATTTGCATCCTCGAGCTGCAGGGGCCACACGTGATGTGAAAGTAGCACCTGCTCCACCACCAAAAACACCTGCACAATAAAGGGCAGCCGCATACTGAATAGTGACAGATATTTTATAATAACAAAGTTGCTTTTTGAGCTGCAAAATGGTGATACAAATATTCACCAGTAATCATAGTCCCGGCAGTCATCCCTAGTACATAGGTGAGCAACATGCGCCATTGCAGCTACTGTGCTCTAATTACACAGTGAGTAACTTAAGCAGAATACTAATTTTTTATCAGTGATACtttttttttaatataaaaaacaatcttacaagcaaaatatttctatattcaaaaaaacacaagtcaacaaCAGCACCTTCACATATTTTCATACATAATTTCCTAAAATGTTACAACCTACTGTGTAATGTTTATAGTATCTGACCGCTACCCTCCATTATTTATATGCTGATTATAGAAATAAATTACTAAGAGTTTATGTACAGTGCTGTTCTGCAATGCTAAAGAAAGGTATAGGGTTGGATTAAGATTTGGATGCTGCCCCTCACACATTAGAATTTGCAAATGTTATTCATAATTTTGATTTCCTACTAACAACGGGATTCACACTTAGGGGGGGTCTTTTATTTAAAGTCCGAAATGGCCCAAAAAC
  5   1   2      seed Brn1      in                    IMAGE:6949857.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GACCGGTCCGGAATTCTCGGGATCTCATCTTCACTGGCAAGGGTATTCCAGCTTCTTATCTCCAATAAAGACAGCCTCAACATCGAGGAGTATTCTGTGTCACAGACTACTTTAGATCAGGTATTTGTGAACTTTGCCAAACAACAAACAGACGATGAAGATATCCATTTGCATCCTCGAGCTGCAGGGGCCACACGTGATGTGAAAGTAGCACCTGCTCCACCACCAAAAACACCTGCACAATAAAGGGCAGCCGCATACTGAATAGTGACAGATATTTTATAATAACAAAGTTGCTTTTTGAGCTGCAAAATGGTGATACAAATATTCACCAGTAATCATAGTCCCGGCAGTCATCCCTAGTACATAGGTGAGCAACATGCGCCATTGCAGCTACTGTGCTCTAATTACACAGTGAGTAACTTAAGCAGAATACTAATTTTTTATCAGTGATACtttttttttaatataaaaaacaagcttacaagcaaaatatttctatattcaaaaaaacacaagtcaacaacaGCACCTTCACATATTTTCATACATAATTTCCTAAAATGTTACAACCTACTGTGTAATGTTTATAGTATCTGACCGCTACCCTCCATTATTTATATGCTGATTATAGAAATAAATTACTAAGAGTTTATGTACAGTGCTGTTCTGCAATGCTAAAGAAAGGTATAGGTTGGATTAAGATTTGGATGCTGCCCCTCACACATTAGAATTTGCAAATGTTATTCATAATTTTGATTTCCTACTAACAACGGATTCACACTTAGGGGGTTCTTTATTAAAGTCCGAATGCCAAAAACTAAAAGAAATCAttttttttactataaaatacgtatttttagtggggaaaaaaaaCTTTATTTTTTTCCTGATTAATTATACCCCTGAGGAA
  5   1   2      skin Tad1      in                    IMAGE:6880385.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGCCGGCAGTCATCCCTAGTACATAGGTGAGCAACATGCGCCATTGCAGCTACTGTGCTCTAATTACACAGTGAGTAACTTAAGCAGAATACTAATTTTTTATCAGTGATACttttttttttaatataaaaaacaagcttacaagcaaaatatttctatattcaaaaaaacacaagtcaacaacaGCACCTTCACATATTTTCATACATAATTTCCTAAAATGTTACAACCTACTGTGTAATGTTTATAGTATCTGACCGCTACCCTCCATTATTTATATGCTGATTATAGAAATAAATTACTAAGAGTTTATGTACAGTGCTGTTCTGCAATGCTAAAGAAAGGTATAGGTTGGATTAAGATTTGGATGCTGCCCCTCACACATTAGAATTTGCAAATGTTATTCATAATTTTGATTTCCTACTAACAACGGGATTCACACTTAGGGGGTTCTTTTATTAAAGTCCCGAATGCCCAAAAACTAAAAAGAAATCAttttttttttaccaaaaaaatacgtattttttagggggggaaaaaaacttgaattttttttCCTGATTAAATTATACCCCTGGAGGAATTGAAAAAAAGTCTTGAAAACCCCCCAAATTCTGGGCATTCCCAAAACCCTGCCCGAAGGGTTTCCATTAATAAGTTAAAATGGGGAAGAAAATTCCCCCgaaaaaaattttccctggcgccctggggttttcctccacacaaaaagagcctggaaaaaaatattgggggggggTTTTTCCC
  5   1   2      ests                            Xl3.1-IMAGE:6956236.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGGGAAAAAAAACTTGATTTTTTTCCTGATTAATTATACCCTGAGGATGGAAAAAGTCTGAATCCCACAATCTGGCATCTCAGACCTGCCGAGGTTCTATATAAGTCAATGGGAGAAGTCCCGAAGATATCCTGCGCTGGGTTTCGTACAAAAAGCTGAAGATTTGGTGGTTTTCATGCAAAAATCTGAAAAAAAATAGAATTTTTTTCAGATTTTCACAATTTTCGAGTTTTTTTTCTGCACTGGAATTTTTCGGGAAAATGTATTGTTAAATAAGGGGAAATAACCCGTGCGGATTTGGTCGGTGTATATTTAAAAAAATAATGGGATAAACTCAGATTTTGATAAATAACCCCCTTATTATAAGGTTCAGATACAAAAGGTAACTGAGGACATGGTATTAGTCTGTGATACCTGAATACTATTACTGTGCTTGCAGCCATCATTCTAAATAGAAATACCCATGATGGCAAATCTAGGGGCTGTTTACCCATTAAAGCAAGAAAGCACCGCAGTTATCACTGATAACGTTTCACCAACTTAAGTTTTAGTTATTTTTTTAGTTATTTTTAATGATGCTTTAAAAGAGATAGTTAACAGATTCTTCTGTTGCATAGGGGAACATTTTATATTAAAGGTGTTTGGCTAAAAAACATATTTTTTAAATAAAACACTGAACTATTTAAAAGCTGCAGTGAGGGAACAAGGAATAAATGCTGCCATACCAGAACCAACCCGTTCATACCAAAAATGATACAGTCTAGTAATGTTCTAGATTTAGGAGTGTCCCATCTTACCTAAAGGCATGTGCTTGTGAGTTGGAATGGAGTATTATGGCTACAGTGATTGTCTCTTCCCAGCTATGCCTGTAATGTTTCATTTGTGCTCAGGCAAGAAAAAAATTAAAGACTGGCCATTCTGATACTGACATAACCCTGTTCTAACTATACATTCATCTACTCCACTGGATTTATACTCACTATTATTACTATTTGTAAAGAAATAAACACCTTTTTCTAAATAAGATGGGTGCACCTTTAAATATAAATATCATCATATTAAATAAAAAAATAAACCTGAATTTAACTGTGGAAATGTATCTTTGAAAGGCCTGTGCAGCTGTTTTACTTTAGATGGCTGATATTTCATGTCTTTATTTTGCACGGCACATAAAAATAAAAGCTCTCCTGGTAAAATAA
                                                  Xl3.1-CHK-1012691942                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAAAAACTTGATTTTTTTCCTGATTAATTATACCCTGAGGATGGAAAAAGTCTGAATCCCACAATCTGGCATCTCAGACCTGCCGAGGTTCTATATAAGTCAATGGGAGAAGTCCCGAAGATATCCTGCGCTGGGTTTCGTACAAAAAGCTGAAGATTTGGTGGTTTTCATGCAAAAATCTGAAAAAAAATAGAATTTTTTTCAGATTTTCACAATTTTCGAGTTTTTTTTCTGCACTGGAATTTTTCGGGAAAATGTATTGTTAAATAAGGGGAAATAACCCGTGCGGATTTGGTCGGTGTATATTTAAAAAAATAATGGGATAAACTCAGATTTTGATAAATAACCCCCTTATTATAAGGTTCAGATACAAAAGGTAACTGAGGACATGGTATTAGTCTGTGATACCTGAATACTATTACTGTGCTTGCAGCCATCATTCTAAATAGAAATACCCATGATGGCAAATCTAGGGGCTGTTTACCCATTAAAGCAAGAAAGCACCGCAGTTATCACTGATAACGTTTCACCAACTTAAGTTTTAGTTATTTTTTTAGTTATTTTTAATGATGCTTTAAAAGAGATAGTTAACAGATTCTTCTGTTGCATAGGGGAACATTTTATATTAAAGGTGTTTGGCTAAAAAACATATTTTTTAAATAAAACACTGAACTATTTAAAAGCTGCAGTGAGGGAACAAGGAATAAATGCTGCCATACCAGAACCAACCCGTTCATACCAAAAATGATACAGTCTAGTAATGTTCTAGATTTAGGAGTGTCCCATCTTACCTAAAGGCATGTGCTTGTGAGTTGGAATGGAGTATTATGGCTACAGTGATTGTCTCTTCCCAGCTATGCCTGTAATGTTTCATTTGTGCTCAGGCAAGAAAAAAATTAAAGACTGGCCATTCTGATACTGACATAACCCTGTTCTAACTATACATTCATCTACTCCACTGGATTTATACTCACTATTATTACTATTTGTAAAGAAATAAACACCTTTTTCTAAATAAGATGGGTGCACCTTTAAATATAAATATCATCATATTAAATAAAAAAATAAACCTGAATTTAACTGTGGAAATGTATCTTTGAAAGGCCTGTGCAGCTGTTTTACTTTAGATGGCTGATATTTCATGTCTTTATTTTGCACGGCACATAAAAATAAAAGCTCTCCTGGTAAAATAATTTGTA
  5   1   1       add Brn1      in                    IMAGE:6951105.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCCGGAATTCTCGGGATATTTTATAATAACAAAGTTGCTTTTCTGAGCTGCAAAATGGTGATACAAATATTCACCAGTAATCATAGTCCCGGCAGTCATCCCTAGTACATAGGTGAGCAACATGCGCCATTGCAGCTACTGTGCTCTAATTACACAGTGAGTAACTTAAGCAGAATACTAATTTTTTATCAGTGATACtttttttttaatataaaaaacaagcttacaagcaaaatatttctatattcaaaaaaacacaagtcaacaacaGCACCTTCACATATTTTCATACATAATTTCTTAAAATGTTACAACCTACTGTGTAATGTTTATAGTATCTGACCGCTACCCTCCATTATTTATATGCTGATTATAGAAATAAATTACTAAGAGTTTATGTACAGTGCTGTTCTGCAATGCTAAAGAAAGGTATAGGTTGGATTAAGATTTGGATGCTGCCCCTCACACATTAGAATTTGCAAAGTCCTTATGCAAATGGTATTCATAATTTTGATTTCCTACTAACAACGGATTCACACTTAGGGGGTTCTTTATTAAAGTCCGAATGCTaaaaactcaaaaaaatctttttttttactataaaatacgtatttttagtggggaaaaaaaaCTTTTTTTCCGGATTTATTATACCCTGAGGATGGAAAAAGTCTGATTCCCACAATCCAGCATCTCAGACCTGCCGAGGTTGTATATAAAGTCAATGGGAGAAGTCCCGAAGATATCCTGCGGTGGGGTTTCATACAAAAATCTGAAGATTTGGTGGGTTTTCATGCAAAAATTCTGAAAAAGAAATAGAAattttttttcagatttttcacaaatttttcgagttttttttttCTGCCCCTGGGAATTTTTTCGGGAGAAATGGTTTTGTTTAA
  5   1   2       bld Brn1                            IMAGE:6949788.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGCCATTGCAGCTACTGTGCTCTAATTACACAGTGAGTAACTTAAGCAGAATACTAATTTTTTATCAGTGATACtttttttttaatataaaaaacaagcttacaagcaaaatatttctatattcaaaaaacacaagtcaacaacaGCACCTTCACATATTTTCATACATAATTTCCTAAAATGTTACAACCTACTGTGTAATGTTTATAGTATCTGACCGCTACCCTCCATTATTTATATGCTGATTATAGAAATAAATTACTAAGAGTTTATGTACAGTGCTGTTCTGCAATGCTAAAGAAAGGTATAGGTTGGATTAAGATTTGGATGCTGCCCCTCACACATTAGAATTTGCAAATGTTATTCATAATTTTGATTTCCTACTAACAACGGATTCACACTTAGGGGGTTCTTTATTAAAGTCCGAATGCCAAAAACTAAAAGAAATCAttttttttactataaaatacgtatttttagtggggaaaaaaaaCTTGATTTTTTTCCTGATTAATTATACCCTGAGGATGGAAAAAGTCTGAATCCCACAATCTGGCATCTCAGACCTGCCGAGGTTCTATATAAGTCAATGGGAGAAGTCCCGAAGATATCCTGCGCTGGGTTTCGTACAAAAAGCTGAAGATTTGGTGGTTTTCATGCaaaaatctgaaaaaaaatagaatttttttcagattttcacaattttcgagttttttttCTGCACTGGAATTTTTCGGGAAAATGTATTGTTAAATAAGGGGAAATAACCCGTGCGGATTTGGTCGGTGTATATTTAAAAAAATAATGGGGATAAACTCAGATTTTTGATAAATAAC
  5   1   2       add Tad2      in                    IMAGE:6876231.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAGGTATAGGTTGGATTAAGATTTGGATGCTGCCCCTCACACATTAGAATTTGCAAATGTTATTCATAATTTTGATTTCCTACTAACAACGGATTCACACTTAGGGGGTTCTTTATTAAAGTCCGAATGCCAAAAACTAAAAGAAATCAttttttttactataaaatacgtatttttagtggggaaaaaaaaaCTTGATTTTTTTCCTGATTAATTATACCCTGAGGATGGAAAAAGTCTGAATCCCACAATCTGGCATCTCAGACCTGCCGAGGTTCTATATAAGTCAATGGGAGAAGTCCCGAAGATATCCTGCGCTGGGTTTCGTACAAAAAGCTGAAGATTTGGTGGTTTTCATGCaaaaatctgaaaaaaaatagaatttttttcagattttcacaattttcgagttttttttctgcactggaatttttCGGGAAAATGTATTGTTAAATAAGGGGAAATAACCCGTGCGGATTTGGTCGGTGTATATTTAAAAAAATAATGGGATAAACTCAGATTTTGATAAATAACCCCCTTATTATAAGGTTCAGATACAAAAGGTAACTGAGGACATGGTATTAGTCTGTGATACCTGAATACTATTACTGTGCTTGCAGCCATCATTCTAAATAAAAATACCCATGATGGCAAATCTAGGGGCTGTTTACCCATTAAAGCAAGAAAGCACCGCAGTTATCACTGATAACGTTTCCCCCACTTAAGTTTTAGTTAATTTTTTAAGCTAATTTTAATGATGCCTTTAAAGAGATAGTTAACAGAATTCTTCCTGTTGCCCTAGGGGAACCTTTTTATATTAAAGGGGGTTTGGCTaaaaaaacatatttttttaaaacaaaaaccctggactttttaaaaCCTGCCAGGAGGGAACCAGGGAATAATGGCGGCCATCCCGAAACCAACCCGGTCCTCCCCACAATGGAACCCGCCTAGAAATGGCCCAAAATTAAGGAGTGCCCCCCCTTC
  3   1   2       bld Tad1      in                    IMAGE:6880385.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAATTTTCGCAAAAATTTTTAATTCCAAAAAATTTGTGGTTTTTCCCTACATAAACAAACGGGATTTCCACCCTTTAAGGGGGGTTTTTTTAATTAAAGGTCCGGAAATGCCCAAAAAATTAAAAGGAAATCCATTTTTTTTTTTACTATAAAAATACGTATTTTTAGGTGGGGAAAAAAACTTGATTTTTTTCCCTGATTAATAATACCTGAGGGATGAAAAAAGTCTGAATCCCACAATCTGGCATCTCAGACCTGCCGAGGTTCTATATAAGTCAATGGGAGAAGTCCCGAAGATATCCTGCGCTGGGTTTCGTACAAAAAGCTGAAGATTTGGTGGTTTTCATGCAAAAATCTGAAAAAAAATAGAATTTTTTTCAGATTTTCACAATTTTCGAGTTTTTTTTCTGCACTGGAATTTTTCGGGAAAATGTATTGTTAAATAAGGGGAAATAACCCGTGCGGATTTGGTCGGTGTATATTTAAAAAAATAATGGGATAAACTCAGATTTTGATAAATAACCCCCTTATTATAAGGTTCAGATACAAAAGGTAACTGAGGACATGGTATTAGTCTGTGATACCTGAATACTATTACTGTGCTTGCAGCCATCATTCTAAATAGAAATACCCATGATGGCAAATCTAGGGGCTGTTTACCCATTAAAGCAAGAAAGCACCGCAGTTATCACTGATAACGTTTCACCAACTTAAGTTTTAGTTATTTTTTTAGTTATTTTTAATGATGCTTTAAAAGAGATAGTTAACAGATTCTTCTGTTGCATAGGGGAACATTTTATATTAAAGGTGTTTGGCTAAAAAACATTTTTTTAAATAAAACACTGAACTATTTAAAAGCTGCAGTGAGGGAACAAGG
  5   1   2       bld Brn1      in                    IMAGE:6950373.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGAGGATGGAAAAAGCTGAATCCACAATCTGGCATCTCAGACCTGCCGAGGTTCTATATAAGTCAATGGGAGAAGTCCCGAAGATATCCTGCGCTGGGTTTCGTACAAAAAGCTGAAGATTTGGTGGTTTTCATGCaaaaatctgaaaaaaaatagaatttttttcagattttcacaattttcgagttttttttctgcactggaatttttcGGGAAAATGTATTGTTAAATAAGGGGAAATAACCCGTGCGGATTTGGTCGGTGTATATTTAAAAAAATAATGGGATAAACTCAGATTTTGATAAATAACCCCCTTATTATAAGGTTCAGATACAAAAGGTAACTGAGGACATGGTATTAGTCTGTGATACCTGAATACTATTACTGTGCTTGCAGCCATCATTCTAAATAGAAATACCCATGATGGCAAATCTAGGGGCTGTTTACCCATTAAAGCAAGAAAGCACCGCAGTTATCACTGATAACGTTTCACCAACTTAAGttttagttatttttttagttatttttAATGATGCTTTAAAAGAGATAGTTAACAGATTCTTCTGTTGCATAGGGGAACATTTTATATTAAAGGTGTTTGGCTAAAAAACATATTTTTTAAATAAAACACTGAACTATTTAAAAGCTGCAGTGAGGGAACAAGGAATAAATGCTGCCATACCAAAACCAACCCGTTCATACCAAAAATGATACAGTCTAGTAATGTTCTAGATTTAGGAGTGTCCCATCTTACATAAAAGCATGTGCNTTGTGGAGTTGGGAAAGGAATAATTATGGGCTACCGTGGATTGGTCTCTTTCCCAGCTATGCCCTGGGAAGGGTTTCCTTTGG
  3   1   2       bld Brn1      in                    IMAGE:6949857.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACCAGAGGGAGAATTTTTTTTTTTGGAAAAAAGGGGGGTTGTTTTATTATCACCGGGGGGAGAAATAAACCCCGCGGGCGGGGAATTTTTTTTCGGGGGGTTATTATTTTTAGAAAAAAAAAAATTAGGGGGTGAAAAAATCTCCAGGTTTTCTGTCTAAAATAAAACCCCCCCCCCCTTTTTTAAAACGTTTNAAGTCTCAGATACAAAAGGTAACTGAGGAGCACAGGGGATTTAAGTGTCGTGAGTATCCCTGAGATATATATATACACGTGCGTTGCGCACGCCTCTCTATTTTTAATATGAGAATATCCCCCTGAGGGGCACAAATTTTTAGGGGGCTTTTTTTCCCCCCTTnAAAnCCAnnnAAnnnCCnnnnnnnnnnnnnnnnnnnnnnnnnnnnAAAACGTCGTCACAACCCGTCAGTCTCCACTAGTTTAGTTTTTTTTTAGTTATTTTTAATGATGTTTAAAAGAGATAGTTAACAGATTCTTCTGTTGCATAGGGGAACATTTTATATTAAAGGTGTTTGGCTAAAAAACATATTTTTTAAATAAAACACTGAACTATTTAAGAGCTGCAGTGAGGGAACAAGGAATAAATGCTGCCATACCAGAACCAACCCGTTCATACCAAAAATGATACAGTCTAGTAATGTTCTAGATTTAGGAGTGTCCCATCTTACCTAAAGGCATGTGCTTGTGAGTTGGAATGGAGTATTATGGCTACAGTGATTGTCTCTTCCCAGCTATGCCTGTAATGTTTCATTTGTGCTCAGGCAAGAAAAAAATTAAAGACTGGCCATTCTGATACTGACATAACCCTGTTCTAACTATACATTCATCTACTCCACTGGATTTATACTCACTATTATTACTATTTGTAAAGAAATAAACACCTTTTTCTAAATAAGATGGGTGCACCTTTAAATATAAATATCATCATATTAAATAAAAAAATAAACCTGAATTTAACTGTGGAAATGTATCTTTGAAAGGCCTGTGCAGCTGTTTTAATTTAGATGGCGGAATATTT
  5   1   2       bld Brn1                            IMAGE:7019415.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTGGTGGTTTTCATGCaaaaatctgaaaaaaaatagaatttttttcagattttcacaattttcgagttttttttCTGCACTGGAATTTTTCGGGAAAATGTATTGTTAAATAAGGGGAAATAACCCGTGCGGATTTGGTCGGTGTATATTTAAAAAAATAATGGGATAAACTCAGATTTTGATAAATAACCCCCTTATTATAAGGTTCAGATACAAAAGGTAACTGAGGACATGGTATTAGTCTGTGAAACCTGAATACTATTACTGTGCTTGCAGCCATCATTCTAAATAGAAATACCCATGATGGCAAATCTAGGGGCTGTTTACCCATTAAAGCAAGAAAGCACCGCCATTATCACTGGATAACGTTTCACCAACTTAAGttttagttatttttttagttatttttaATGATGCTTTAAAAGAGATAGTTAACAGATTCTTCTGTTGCATAGGGGAACATTTTATATTAAAGGTGTTTGGCTAAAAAACATATTTTTTAAATAAAACACTGAACTATTTTAAAAGCTGCCGTGAGGGAACAAGGAAATAAATGCTGCCATAACAAAAACCAACCCCGTTCATACCAAAAAATGATACAGGTCCAGATAATGGTTCTAGATTTTAGGAAGGGTCCCCATTCCTaaaaaaaaaGGCTTGGTCTTTTGTGGAATTTGAAAATGGGGAATATTTTGGGGCCTACAGGGGAATTTTTTCTTCTTTCCCCCACCTAAAGCCCCGGGAAAAAAGGTTTCCATTTTTGTGGGCCCCCCCGGGGCCCAAGaaaaaaaaaaattttttagaggggggcggggggccccatttctctttagaaaaagtggggaaaaaaaacaacccccccgtgtgtttcttaacaaaaaatataaaaaaaaaTATTTTTTCTCTCTCATACACCTCTCCCCACGCGCGTGGAGATAA
  3   1   2       bld Tad2      in                    IMAGE:6876231.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAAAATAGAATTTTTTTTTCAGATTTTCACCATTTTTCGAGTTTTTTTTTTGCACCTGGATTTTTTCGGGAAAAATGTATTGTTAATTAAGGGGAAAATAACCCGTGCGGATTTGGTCGGTGTATATTTAAAAAAATAATGGGATAAACTCAGATTTTGATAAATAACCCCCTTATTATAAGGTTCAGATACAAAAGGTAACTGAGGACATGGTATTAGTCTGTGATACCTGAATACTATTACTGTGCTTGCAGCCATCATTCTAAATAGAAATACCCATGATGGCAAATCTAGGGGCTGTTTACCCATTAAAGCAAGAAAGCACCGCAGTTATCACTGATAACGTTTCACCAACTTAAGTTTTAGTTATTTTTTTAGTTATTTTTAATGATGCTTTAAAAGAGATAGTTAACAGATTCTTCTGTTGCATAGGGGAACATTTTATATTAAAGGTGTTTGGCTAAAAAACATATTTTTTAAATAAAACACTGAACTATTTAAAAGCTGCAGTGAGGGAACAAGGAATAAATGCTGCCATACCAGAACCAACCCGTTCATACCAAAAATGATACAGTCTAGTAATGTTCTAGATTTAGGAGTGTCCCATCTTACATAAAGGCATGTGCTTGTGAGTTGGAATGGAGTATTATGGCTACAGTGATTGTCTCTTCCCAGCTATGCCTGTAATGTTTCATTTGTGCTCAGGCAAGAAAAAAATTAAAGACTGGCCATTCTGATACTGACATAACCCTGTTCTAACTATACATTCATCTACTCCACTGGATTTATACTCACTATTATTACTATTTGTAAAGAAAGTAAACACCCTTTTCTAAATAAGA
  3   1   2      seed Brn1      in                    IMAGE:6956236.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTTTTTTTTTCAGATTTTCAACAATTTTGCGAGTTTTTTTTCTGCACTGGAATTTTTCGGGAAAATGTATTGTTAAATAAGGGGAAATAACCCGTGCGGATTTGGTCGGTGTATATTTAAAAAAAATAATGGGATAAACTCAGATTTTGATAAATAACCCCCTTATTATAAGGTTCAGATACAAAAGGTAACTGAGGACATGGTATTAGTCTGTGATACCTGAATACTATTACTGTGCTTGCAGCCATCATTCTAAATAGAAATACCCATGATGGCAAATCTAGGGGCTGTTTACCCATTAAAGCAAGAAAGCACCGCAGTTATCACTGATAACGTTTCACCAACTTAAGTTTTAGTTATTTTTTTAGTTATTTTTAATGATGCTTTAAAAGAGATAGTTAACAGATTCTTCTGTTGCATAGGGGAACATTTTATATTAAAGGTGTTTGGCTAAAAAACATATTTTTTAAATAAAACACTGAACTATTTAAAAGCTGCAGTGAGGGAACAAGGAATAAATGCTGCCATACCAGAACCAACCCGTTCATACCAAAAATGATACAGTCTAGTAATGTTCTAGATTTAGGAGTGTCCCATCTTACATAAAGGCATGTGCTTGTGAGTTGGAATGGAGTATTATGGCTACAGTGATTGTCTCTTCCCAGCTATGCCTGTAATGTTTCATTTGTGCTCAGGCAAGAAAAAAATTAAAGACTGGCCATTCTGATACTGACATAACCCTGTTCTAACTATACATTCATCTACTCCACTGGATTTATACTCACTATTATTACTATTTGTAAAGAAATAAACACCTTCTTCTAAATAAGATGGGGCACCTCAACTGAAAAT
  3   1   2       bld Brn1      in                    IMAGE:6950373.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAAGGGGGAAATTAACCCCGTGCGGAATTTGGTCCGGTGAATATTTAAAAAAAATAATGGGGATAAACTCGGATTTTTGATAAATAACCCCCTTATTATAAGGTTCAGATACAAAAGGTAACTGAGGACAGGGTATTAGTCTGTGATACCTGAATACTATTACTGTGCTTGCAGCCATCATTCTAAATAGAAATACCCCATGATGGCAAATCTAGGGGCTGTTTACCCATTAAAGCAAGAAAGCACCGCAGTTATCACTGATAACGTTTCACCAACTTAAGTTTTAGTTATTTTTTTAGTTATTTTTAATGATGCTTTAAAAGAGATAGTTAACAGATTCTTCTGTTGCATAGGGGAACATTTTATATTAAAGGTGTTTGGCTAAAAAACATATTTTTTAAATAAAACACTGAACTATTTAAAAGCTGCAGTGAGGGAACAAGGAATAAATGCTGCCATACCAGAACCAACCCGTTCATACCAAAAATGATACAGTCTAGTAATGTTCTAGATTTAGGAGTGTCCCATCTTACATAAAGGCATGTGCTTGTGAGTTGGAATGGAGTATTATGGCTACAGTGATTGTCTCTTCCCAGCTATGCCTGTAATGTTTCATTTGTGCTCAGGCAAGAAAAAAATTAAAGACTGGCCATTCTGATACTGACATAACCCTGTTCTAACTATACATTCATCTACTCCACTGGATTTATACTCACTATTATTACTATTTGTAAAGAAATAAACACCCTTTTCTAAATAAGATGGGTGCACCTTTAAATATAAATATCATCATATTAAATAAAAAAATAAACCTGAATTTAACTGTGGAAATGTATCTTTGAAAGGCCTGTGCAGCTGTTTTACTTTAGATGGCCGATATTCAG
  5   1   2       bld Eye1                            IMAGE:6948300.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCCGGAATTTCCGGGATCCCGTNGCGGATTTAGGTCGAGTGTATATTTAAAAAAATAATGGGATAAACTCAGATTTTGATAAATAACCCCCTTATTATAAGGTTCAGATACAAAAGGTAACTGAGGACATGGTATTAGTCTGTGATACCTGAATACTATTACTGTGCTTGCAGCCATCATTCTAAATAGAAATACCCATGATGGCAAATCTAGGGGCTGTTTACCCATTAAAGCAAGAAAGCACCGCAGTTATCACTGATAACGTTTCACCAACTTAAGttttagttatttttttagttatttttAATGATGCTTTAAAAGAGATAGTTAACAGATTCTTCTGTTGCATAGGGGAACATTTTATATTAAAGGTGTTTGGCTAAAAAACATATTTTTTAAATAAAACACTGAACTATTTAAGAGCTGCAGTGAGGGAACAAGGAATAAATGCTGCCATACCAGAACCAACCCGTTCATACCAAAAATGATACAGTCTAGTAATGTTCTAGATTTAGGAGTGTCCCATCTTACCTAAAGGCATGTGCTTGTGAGTTGGAATGGAGTATTATGGCTACAGTGATTGTCTCTTCCCAGCTATGCCTGTAATGTTTCATTTGTGCTCAGGCAAGAAAAAAATAAAGACTGGCCATTCTGATACTGACATGACCCTGTTCTAACTATACATTCATCTACTCCACTGGATTTATACTCCCTATTTATTACTATTTGTaaaagaaaaaaaaCACCCTTTTTTCTAAAATAAGATGGGATGCACCCTTTTTAAAATAATAAATTATCCCTCCCCTCTTTAGAATAAAGAAAAAATTGAACCCCTGCAAATTTTTAAACCTGGGTGGGGAAAAATGGATATTCTTTCTTTTAAGAAGAGGGGCCCTGGTGTGCCCAAGCCTTGC
  5   1   2       bld Brn1      in                    IMAGE:6950964.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCGTGCGGATTTGGTCGGTGTATATTTAAAAAAATAATGGGATAAACTCAGATTTTGATAAATAACCCCCTTATTATAAGGTTCAGATACAAAAGGTAACTGAGGACATGGTATTAGTCTGTGATACCTGAATACTATTACTGTGCTTGCAGCCATCATTCTAAATAGAAATACCCATGATGGCAAATCTAGGGGCTGTTTACCCATTAAAGCAAGAAAGCACCGCAGTTATCACTGATAACGTTTCACCAACTTAAGttttagttatttttttagttatttttaATGATGCTTTAAAAGAGATAGTTAACAGATTCTTCTGTTGCATAGGGGAACATTTTATATTAAAGGTGTTTGGCTAAAAAACATATTTTTTAAATAAAACACTGAACTATTTAAGAGCTGCAGTGAGGGAACAAGGAATAAATGCTGCCATACCAGAACCAACCCGTTCATACCAAAAATGATACAGTCTAGTAATGTTCTAGATTTAGGAGTGTCCCATCTTACCTAAAGGCATGTGCTTGTGAGTTGGAATGGAGTATTATGGCTACAGTGATTGTCTCTTCCCAGCTATGCCTGTAATGTTTCATTTGTGCTCAGGCAAGAAAAAAATTAAAGACTGGCCATTCTGATACTGACATAACCCTGTTCTAACTATACATTCATCTACTCCACTGGATTTATACTCACTATTATTACTATTTTGTAAGAAATAAACACCTTTTTCTAAATAAGATGGGTGCACCCtttaaatataaatatcatcatatttaaataaaaaaataaaaCCTGAAATTTAACCTGTGGGAAAATGTATTCTTTTGAAAAAGCCCTGGTGCC
  3   1   2       bld Brn1      in                    IMAGE:6951105.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATTTTGAAAAATAAACCCCCTTATTATAAGGTTCGGATACAAAAGGTAATTGAGGACATGGTATTAGTCTGTGATACCTGAATACTATTACTGTGCTTGCAGCCATCTTTCTAAATAGAAATACCCATGATGGCAAATCTAGGGGGCTGTTTACCCATTAAAGCAAGAAAGTACCGCAGTTATCACTGATAACGTTTCACCAACTTAAGTTTTAGTTATTTTTTTAGTTATTTTTAATGATGCTTTAAAAGAGATAGTTAACAGATTCTTCTGTTGCATAGGGGAACATTTTATATTAAAGGTGTTTGGCTAAAAAACATATTTTTTAAATAAAACACTGAACTATTTAAAAGCTGCAGTGAGGGAACAAGGAATAAATGCTGCCATACCAGAACCAACCCGTTCATACCAAAAATGATACAGTCTAGTAATGTTTTAGATTTAGGAGTGTCCCATCTTACCTAAAGGCATGTGCTTGGTAGTTGGAATGGAGTATTATGGCTACAGTGATTGTCTCTTCCCAGCTATGCCTGTAATGTTTCATTTGTGCTCAGGCAAGAAAAAAATTAAAGACTGGCCATTCTGATACTGACATAACCCTGTTCTAACTATACATTCATCTACTCCACTGGATTTATACTCACTATTATTACTATTTGTAAAGAAATAAACACCTTTTTCTAAATAAGATGGGTGCACCTTTAAATATAAATATCATCATATTAAATAAAAAAATAAACCTGAATTTAACTGTGGAAATGTACCTTTGAAAGGCCTGTGCAGCTGTTTTACTTTAGATGGCTGATATTTCATGTCTTTATTTTGCACGGCACATAAAAATAAAAGCTCTCCNGGTAAAATAAT
  3   1   2       bld Brn1      in                    IMAGE:6950964.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGTAACTGAGGACAATGGTATTAGTCTGTGATACCTGAATACTATTACTGTGCTTGCAGCCATCTTTCTAAATAGAAATACCCCATGATGGCAAATCTAGGGGCTGTTCCCCATTAAAGCAAGAAAGCACCGCAGTTATCACTGATAACGTTTCACCAACTTAAGTTTTAGTTATTTTTTTAGTTATTTTTAATGATGCTTTAAAAGAGATAGTTAACAGATTCTTCTGTTGCATAGGGGAACATTTTATATTAAAGGTGTTTGGCTAAAAAACATATTTTTTAAATAAAACACTGAACTATTTAAGAGCTGCAGTGAGGGAACAAGGAATAAATGCTGCCATACCAGAACCAACCCGTTCATACCAAAAATGATACAGTCTAGTAATGTTCTAGATTTAGGAGTGTCCCATCTTACCTAAAGGCATGTGCTTGTGAGTTGGAATGGAGTATTATGGCTACAGTGATTGTCTCTTCCCAGCTATGCCTGTAATGTTTCATTTGTGCTCAGGCAAGAAAAAAATTAAAGACTGGCCATTCTGATACTGACATAACCCTGTTCTAACTATACATTCATCTACTCCACTGGATTTATACTCACTATTATTACTATTTGTAAAGAAATAAACACCTTTTTCTAAATAAGATGGGTGCACCTTTAAATATAAATATCATCATATTAAATAAAAAAATAAACCTGAATTTAACTGTGGAAATGTATCTTTGAAAGGCCTGTGCAGCTGTTTTACTTTAGATGGCTGATATTTCATGTCTTTATTTTGCACGGCACATAAAAATAAAAGCTCTCCTGGTAAAATAATTTGTATGGCCCCCGTTTGGCA
  3   1   2       bld Brn1      in                    IMAGE:4739982.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCCCAGCTATGCCTGTAATGTTTCATTTGTGCTCAGGCAAGAAAAAAATTAAAGACTGGCCATTTTGATACTGACATAACCCTGTTCTAACTATACATTCATCTACTCCACTGGATTTATACTCACTATTATTACTATTTGTAAAGAAATAAACACCTTTTTCTAAATAAGATGGGTGCACCTTTAAATATAAATATCATCATATTAAATAAAAAAATAAACCTGAATTTAACTGTGGAAATGTATCTTTGAAAGGCCTGTGCAGCTGTTTTACTTTAGATGGCTGATATTTCATGTCTTTATTTTGCACGGCACATAAAAATAAAAGCTCTCCTGGTAAAATAATTTGTATGGCAAAGTTATGCATTATAATTAGATCAATAAACGTTACAGAGAATGAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)