Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012838919 Xl3.1-xl332m02.5.5 - 13 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-xl332m02.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCCTTGAGAGAAGAGATCAGAGATTTGGTGCAAGCAGAGCCTGTCGCGAAATTCAGCAAGATGGATCCCAGTATCTACTACTGCCCAGAGCTCGCCCCGCAGCAGGTCCCAAGCCTGGAGGGAAGATTAGAAGATTTATTATATGATGACTCTGGCTTTCTCCATGACTATGACCTGAGCACCAAAAACTCGAGTGCAGGGAAGGGACTGTACCCCGACCCCGAGAGCCTGAGAGCTGCAGTGGGTCAGAACAGCTCCACCCCCTCCTCCGGGCCAGAGCTCGCCCCACAGTCTCTGTAAAGCCTGGAGGGCTACACCGCAGGTTCAGGCACCCTCCCGACTCCCGGCAACTCCCTGCCATGTGATGAATTCCTGCCCTCTTTCCAGACGTTGTTACCAGCACTAACAGAGCAAATACAGCCAGGGCAGCAGGAGACGATGATGATGCCCCCTACTGGGGATTTGCTGTATCACACTCAGCACCAATCTCCCTTCACTGCTATGGATGAGAGCTACTCCCAGGGCGCAGGCTCGGTTGGGGATCAGAGTTTCTCGTGGGCATCACAGGAATGGCACAGCTGGGACGAAACCACCTGGATGGGCTGCAACTCTTTTGAGGCTTCAGTTCCTCCATCACCACTTGTTAATCCTGGAAGTCAACACTCAGCAGCAAACAGAGCTCCCCCTGCAGCCTTTCCTCTCAATGACTCTCCTCACCATCAAGCCCACAGCTTGGGCCCCCGCCGCTCCAGTACAGAAAATGAGAGATACCATCATCCCTATAGACTGAACAGCACCGGGATCAAGGACAAGAAACCACTGCCAACAGCAAGCTCCGGCCCAATTCAGCTCTGGCAGTTCCTCCTGGAGTTACTGCAAGATTCCTCCTGCCAGAAGCTTATCAGCTGGACTGGGAACGGCTGGGAGTTTAAACTTTCTGACCCCAACGAGGTGGCCAGGCGATGGGGCAGACGTAAGAACAAGCCACGGATGAACTACGAGAAGCT------------AGGTATTATTATCACAAGAACATCATACATAAGACTGGAGGTCAGCGCTACGTGTACAGATTTGTCTGTGACCTGCAGGACCTTCTGTCCCGACCCACTCAGACATCACAGCCTCCCACCAAAACCCAGAGACCCAGGATTCAATAATCATGTGAGGGGACCTGGAGCGGGTTCTGGACTTCTGAGAATGAGCCCAGAGCTGCTGCTACATCACAGTCATGCACTAAAGCAAATATCTGCTCTTGCTGAACTAGAAGTCTTACGTTGGAGACAGTTGCAGCCTGAGGGGGCGGTACAAGCAGACAGTGACTGCACTAGGCTCCGCCCACTGGGCAGCAGTTGGATCCAGTGGAAAAGTAAAAAACACTATTGAGCCCCAAAACTTCTGCCTCTAAATTCACTGACGAAAAGTCCGGAGCAGATCCATTAACTCTAGAAGCAAAAAGGCCTCGATTGTATTGTACAGAGAACAGCACAGGCATCACTTACACTTTTATATTAGGGCAGGAGAACATGTGGCTTCCTTCTATTATGAATTAAAGGGCCACACACATTCCGATGAAGACAGCCATTACTGGAGGCTGCTGGGGGTTAGAATTCAGCAACAAACAGAGGCTCCCTGATAAAGCACTGAATAGAAATAGTGATTGGCTGCCTTTCTGGGTTCTGTGAGCACCCATTGGTCCAATCCTAAGGAAGTGGGCGGGCACACTGGCTGGAAAGCAGGTTACAGTCCCGCCTTGTCTTTATAAGATGCTCTTTCTCAGGTACAAATCTACCCAGTGTTTTGTAAATAGACAGATG
                                                  Xl3.1-CHK-1012721667                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGAGAAGAGATCAGAGATTTGGTGCAAGCAGAGCCTGTCGCGAAATTCAGCAAGATGGATCCCAGTATCTACTACTGCCCAGAGCTCGCCCCGCAGCAGGTCCCAAGCCTGGAGGGAAGATTAGAAGATTTATTATATGATGACTCTGGCTTTCTCCATGACTATGAxxxxxGCACCAAAAACTCxxxxxxAGGGAAGGGACTGTACCCCGACCCCGAGAGCCTGAGAGCTGCAGTGGGTCAGAACAGCTCCACCCCCTCCTCCxGxCCAGAGCTCxxxxxACAGTCxxTxxxAAGCCTGGAGxxCTACACxGxAGGTTCAGGCACCCTCCCGACTCCCGGCAACTCCCTGCCATGTGATGAATTCCTGCCCTCTTTCCAGACGTTGTTACCAGCACTAACAGAGCAAATACAGCCAGGGCAGCAGGAGACGATGATGATGCCCCCTACTGGGGATTTGCTGTATCACACTCAGCACCAATCTCCCTTCACTGCTATGGATGAGAGCTACTCCCAGGGCGCAGGCTCGGTTGGGGATCAGAGTTTCTCGTGGGCATCACAGGAATGGCACAGCTGGGACGAAACCACCTGGATGGGCTGCAACTCTTTTGAGGCTTCAGTTCCTCCATCACCACTTGTTAATCCTGGAAGTCAACACTCAGCAGCAAACAGAGCTCCCCCTGCAGCCTTTCCTCTCAATGACTCTCCTCACCATCAAGCCCACAGCTTGGGCCCCCGCCGCTCCAGTACAGAAAATGAGAGATACCATCATCCCTATAGACTGAACAGCACCGGGATCAAGGACAAGAAACCACTGCCAACAGCAAGCTCCGGCCCAATTCAGCTCTGGCAGTTCCTCCTGGAGTTACTGCAAGATTCCTCCTGCCAGAAGCTTATCAGCTGGACTGGGAACGGCTGGGAGTTTAAACTTTCTGACCCCAACGAGGTGGCCAGGCGATGGGGCAGACGTAAGAACAAGCCACGGATGAACTACGAGAAGCTGAGCCG------------TATTATCACAAGAACATCATACATAAGACTGGAGGTCAGCGCTACGTGTACAGATTTGTCTGTGACCTGCAGGACCTTCTGTCCCGACCCACTCAGACATCACAGCCTCCCACCAAAACCCAGAGACCCAGGATTCAATAATCATGTGAGGGGACCTGGAGCGGGTTCTGGACTTCTGAGAATGAGCCCAGAGCTGCTGCTACATCACAGTCATGCACTAAAGCAAATATCTGCTCTTGCTGAACTAGAAGTCTTACGTTGGAGACAGTTGCAGCCTGAGGGGGCGGTACAAGCAGACAGTGACTGCACTAGGCTCCGCCCACTGGGCAGCAGTTGGATCCAGTGGAAAAGTAAAAAACACTATTGAGCCCCAAAACTTCTGCCTCTAAATTCACTGACGAAAAGTCCGGAGCAGATCCATTAACTCTAGAAGCAAAAAGGCCTCGATTGTATTGTACAGAGAACAGCACAGGCATCACTTACACTTTTATATTAGGGCAGGAGAACATGTGGCTTCCTTCTATTATGAATTAAAGGGCCACACACATTCCGATGAAGACAGCCATTACTGGAGGCTGCTGGGGGTTAGAATTCAGCAACAAACAGAGGCTCCCTGATAAAGCACTGAATAGAAATAGTGATTGGCTGCCTTTCTGGGTTCTGTGAGCACCCATTGGTCCAATCCTAAGGAAGTGGGCGGGCACACTGGCTGGAAAGCAGGTTACAGTCCCGCCTTGTCTTTATAAGATGCTCTTTCTCAGGTACAAATCTACCCAGTGTTTTGTAAATAGA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     6     7     6     7     6     7     5     7     5     7     5     6     6     7     6     7     6     7     6     7     5     6     5     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     0     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     4     4     4     4     5     5     5     5     5     5     6     6     6     7     6     7     6     7     6     7     6     7     5     7     6     7     5     7     5     7     4     7     5     7     6     7     5     7     6     7     4     7     4     6     4     6     4     6     4     6     3     6     3     6     4     6     3     6     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     3     4
  5   1   2       e50                                 Xl3.1-xl332m02.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCCTTGAGAGAAGAGATCAGAGATTTGGTGCAAGCAGAGCCTGTCGCGAAATTCAGCAAGATGGATCCCAGTATCTACTACTGCCCAGAGCTCGCCCCGCAGCAGGTCCCAAGCCTGGAGGGAAGATTAGAAGATTTATTATATGATGACTCTGGCTTTCTCCATGACTATGACCTGAGCACCAAAAACTCGAGTGCAGGGAAGGGACTGTACCCCGACCCCGAGAGCCTGAGAGCTGCAGTGGGTCAGAACAGCTCCACCCCCTCCTCCGGGCCAGAGCTCGCCCCACAGTCTCTGTAAAGCCTGGAGGGCTACACCGCAGGTTCAGGCACCCTCCCGACTCCCGGCAACTCCCTGCCATGTGATGAATTCCTGCCCTCTTTCCAGACGTTGTTACCAGCACTAACAGAGCAAATACAGCCAGGGCAGCAGGAGACGATGATGATGCCCCCTACTGGGGATTTGCTGTATCACACTCAGCACCAATCTCCCTTCACTGCTATGGATGAGAGCTACTCCCAGGGCGCAGGCTCGGTTGGGGATCAGAGTTTCTCGTGGGCATCACAGGAATGGCACAGCTGGGACGAAACCACCTGGATGGGCTGCAACTCTTTTGAGGCTTCAGTTCCTCCATCACCACTTGTTAATCCTGGAAGTCAACACTCAGCAGCAAACAGAGCTCCCCCTGCAGCCTTTCCTCTCAATGACTCTCCTCACCATCAAGCCCACAGCTTGGGCCCCCGCCGCTCCAGTACAGAAAATGAGAGATACCATCATCCCTATAGACTGAACAGCACCGGGATCAAGGACAAGAAACCACTGCCAACAGCAAGCTCCGGCCCAATTCAGCTCTGGCAGTTCCTCCTGGAGTTACTGCAAGATTCCTCCTGCCAGAAGCTTATCAGCTGGACTGGGAACGGCTGGGAGTTTAAACTTTCTGACCCCAACGAGGTGGCCAGGCGATGGGGCAGACGTAAGAACAAGCCACGGATGAACTACGAGAAGCT------------AGGTATTATTATCACAAGAACATCATACATAAGACTGGAGGTCAGCGCTACGTGTACAGATTTGTCTGTGACCTGCAGGACCTTCTGTCCCGACCCACTCAGACATCACAGCCTCCCGCCAAAACCCAGAGACCCAGGATTCAATAATCATGTGAGGGGACCTGGAGCGGGTTCTGGACTTCTGAGAATGAGCCCAGAGCTGCTGCTACATCACAGTCATGCATTAATGCAAATATCTGC
  5   1   2       e50                                 Xl3.1-xl332m02.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACATCACAGCCTCCCACCAAAACCCAGAGATCCAGGATTCAATAATCATGTGAGGGGACCTGGAGCGGATTCTGGACTTCTGAGAATGAGCCCAGGGCTGCTGCTACATCACAGTCATGCACTAAAGCAAATATCTGCTCTTGCTGAACTAGAAGTCTTACGTTGGAGACAGTTGCAGCCTGAGGGGGCGGTACAAGCAGACAGTGACTGCACTAGGCTCCGCCCACTGGGCAGCAGTTGGATCCAGTGGAAAAGTAAAAAACACTATTGAGCCCCAAAACTTCTGCCTCTAAATTCACTGACGAAAAGTCCGGAGCAGATCCATTAACTCTAGAAGCAAAAAGGCCTCGATTGTATTGTACAGAGAACAGCACAGGCATCACTTACACTTTTATATTAGGGCAGGAGAACATGTGGCTTCCTTCTATTATGAATTAAAGGGCCACACACATTCCGATGAAGACAGCCATTACTGGAGGCTGCTGGGGGTTAGAATTCAGCAACAAACAGAGGCTCCCTGATAAAGCACTGAATAGAAATAGTGATTGGCTGCCTTTCTGGGTTCTGTGAGCACCCATTGGTCCAATCCTAAGGAAGTGGGCGGGCACACTGGCTGGAAAGCAGGTTACAGTCCCGCCTTGTCTTTATAAGATGCTCTTTCTCAGGTACAAATCTACCCAGTGTTTTGTAAATAGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTGAGAGAAGAGATCGGAGATTTGGTGCAAGCAGAGCCTGTCCCGAAATTCAGCAAGATGGATCCCAGTATCTACTACTGCCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAGGAGGTCCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGGTCAGAAGG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----G------
                                               BLH MIN      61      86                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ce ---- 4e-022     NP_001022326.1 T08H4.3 [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ag ---- 2e-035     XP_557464.3 AGAP004619-PA [Anopheles gambiae str. PEST] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ci ---- 2e-035     NP_001071702.1 transcription factor protein [Ciona intestinalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Dm ---- 3e-035     NP_732858.1 pointed CG17077-PC [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Sp ---- 1e-036     NP_999698.1 ets homolog [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Dr ---- 8e-037     NP_001018874.1 hypothetical protein LOC326672 [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Cf ---- 9e-038     XP_546405.2 PREDICTED: similar to v-ets erythroblastosis virus E26 oncogene homolog 1 isoform 1 [Canis familiaris] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Hs ---- 8e-038     NP_005229.1 v-ets erythroblastosis virus E26 oncogene homolog 1; Avian erythroblastosisvirus E26 (v-ets) oncogene homolog-1; v-ets avian erythroblastosis virus E2oncogene homolog 1; v-ets avian erythroblastosis virus E26 oncogene homolog 1;v-ets erythroblastosis virus [Homo sapiens]  -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Mm ---- 7e-038     NP_035938.2 E26 avian leukemia oncogene 1, 5' domain isoform 1 [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Bt ---- 6e-038     NP_001092576.1 v-ets erythroblastosis virus E26 oncogene homolog 1 [Bos taurus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Gg ---- 2e-038     XP_001231221.1 PREDICTED: hypothetical protein [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = Xt ==== 3e-116     NP_001120216.1 hypothetical protein LOC100145265 [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED = Xl ==== 0          NP_001089600.1 hypothetical protein LOC734657 [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xl3.1-xl332m02.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATGATG------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------TAA---TAG---------------------------------------------------------------TAG------------------------------TGA------------------------TGA------------------------------TAG------------------------------------TGA---------------------------------------------------------TAA------------------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ... open reading frame                                                                                                                                                                ]
  5   1   2       e50                                 Xl3.1-xl332m02.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCCTTGAGAGAAGAGATCAGAGATTTGGTGCAAGCAGAGCCTGTCGCGAAATTCAGCAAGATGGATCCCAGTATCTACTACTGCCCAGAGCTCGCCCCGCAGCAGGTCCCAAGCCTGGAGGGAAGATTAGAAGATTTATTATATGATGACTCTGGCTTTCTCCATGACTATGACCTGAGCACCAAAAACTCGAGTGCAGGGAAGGGACTGTACCCCGACCCCGAGAGCCTGAGAGCTGCAGTGGGTCAGAACAGCTCCACCCCCTCCTCCGGGCCAGAGCTCGCCCCACAGTCTCTGTAAAGCCTGGAGGGCTACACCGCAGGTTCAGGCACCCTCCCGACTCCCGGCAACTCCCTGCCATGTGATGAATTCCTGCCCTCTTTCCAGACGTTGTTACCAGCACTAACAGAGCAAATACAGCCAGGGCAGCAGGAGACGATGATGATGCCCCCTACTGGGGATTTGCTGTATCACACTCAGCACCAATCTCCCTTCACTGCTATGGATGAGAGCTACTCCCAGGGCGCAGGCTCGGTTGGGGATCAGAGTTTCTCGTGGGCATCACAGGAATGGCACAGCTGGGACGAAACCACCTGGATGGGCTGCAACTCTTTTGAGGCTTCAGTTCCTCCATCACCACTTGTTAATCCTGGAAGTCAACACTCAGCAGCAAACAGAGCTCCCCCTGCAGCCTTTCCTCTCAATGACTCTCCTCACCATCAAGCCCACAGCTTGGGCCCCCGCCGCTCCAGTACAGAAAATGAGAGATACCATCATCCCTATAGACTGAACAGCACCGGGATCAAGGACAAGAAACCACTGCCAACAGCAAGCTCCGGCCCAATTCAGCTCTGGCAGTTCCTCCTGGAGTTACTGCAAGATTCCTCCTGCCAGAAGCTTATCAGCTGGACTGGGAACGGCTGGGAGTTTAAACTTTCTGACCCCAACGAGGTGGCCAGGCGATGGGGCAGACGTAAGAACAAGCCACGGATGAACTACGAGAAGCT------------AGGTATTATTATCACAAGAACATCATACATAAGACTGGAGGTCAGCGCTACGTGTACAGATTTGTCTGTGACCTGCAGGACCTTCTGTCCCGACCCACTCAGACATCACAGCCTCCCGCCAAAACCCAGAGACCCAGGATTCAATAATCATGTGAGGGGACCTGGAGCGGGTTCTGGACTTCTGAGAATGAGCCCAGAGCTGCTGCTACATCACAGTCATGCATTAATGCAAATATCTGC
                                                  Xl3.1-CHK-1012697644                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGAGAAGAGATCAGAGATTTGGTGCAAGCAGAGCCTGTCGCGAAATTCAGCAAGATGGATCCCAGTATCTACTACTGCCCAGAGCTCGCCCCGCAGCAGGTCCCAAGCCTGGAGGGAAGATTAGAAGATTTATTATATGATGACTCTGGCTTTCTCCATGACTATGAxxxxxGCACCAAAAACTCxxxxxxAGGGAAGGGACTGTACCCCGACCCCGAGAGCCTGAGAGCTGCAGTGGGTCAGAACAGCTCCACCCCCTCCTCCxGxCCAGAGCTCxxxxxACAGTCxxTxxxAAGCCTGGAGxxCTACACxGxAGGTTCAGGCACCCTCCCGACTCCCGGCAACTCCCTGCCATGTGATGAATTCCTGCCCTCTTTCCAGACGTTGTTACCAGCACTAACAGAGCAAATACAGCCAGGGCAGCAGGAGACGATGATGATGCCCCCTACTGGGGATTTGCTGTATCACACTCAGCACCAATCTCCCTTCACTGCTATGGATGAGAGCTACTCCCAGGGCGCAGGCTCGGTTGGGGATCAGAGTTTCTCGTGGGCATCACAGGAATGGCACAGCTGGGACGAAACCACCTGGATGGGCTGCAACTCTTTTGAGGCTTCAGTTCCTCCATCACCACTTGTTAATCCTGGAAGTCAACACTCAGCAGCAAACAGAGCTCCCCCTGCAGCCTTTCCTCTCAATGACTCTCCTCACCATCAAGCCCACAGCTTGGGCCCCCGCCGCTCCAGTACAGAAAATGAGAGATACCATCATCCCTATAGACTGAACAGCACCGGGATCAAGGACAAGAAACCACTGCCAACAGCAAGCTCCGGCCCAATTCAGCTCTGGCAGTTCCTCCTGGAGTTACTGCAAGATTCCTCCTGCCAGAAGCTTATCAGCTGGACTGGGAACGGCTGGGAGTTTAAACTTTCTGACCCCAACGAGGTGGCCAGGCGATGGGGCAGACGTAAGAACAAGCCACGGATGAACTACGAGAAGCTGAGCCG------------TATTATCACAAGAACATCATACATAAGACTGGAGGTCAGCGCTACGTGTACAGATTTGTCTGTGACCTGCAGGACCTTCTGTCCCGACCCACTCAGACATCACAGCCTCCCGCCAAAACCCAGAGACCCAGGATTCAATAATCATGTGAGGGGACCTGGAGCGGGTTCTGGACTTCTGAGAATGAGCCCAGAGCTGCTGCTACATCACAGTCATGCATTAATGCAAAT
  5   1   2       bld Egg3                            IMAGE:6325017.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCCCCGGGGTTAAGTTGCAGGCTCCCATGTCACCCCCCCTCTCAAGGTGGCCCAAGTGGGCTGCTCTGATTTGACCTCCTCTGTGATGTCACGGAAACTTACTCCTCCGAGTCCCTAAAGATGTCACAGTACAATCAGCCAATCAGAGAGGAGCTGGGTGTATATAAGGGGCAGGAGACTGGCGCTGAAGCAACAATCAGGATTGTCCTGTCCAGGGATTCAAAAACTCCTTGAGAGAAGAGATCAGAGATTTGGTGCAAGCAGAGCCTGTCGCGAAATTCAGCAAGATGGATCCCAGTATCTACTACTGCCCAGAGCTCGCCCCGCAGCAGGTCCCAAGCCTGGAGGGAAGATTAGAAGATTTATTATATGATGACTCTGGCTTTCTCCATGACTATGACCTGAGTGGCTTTCAGCTGAGTGCAGGGAAGGGACTGTACCCCGACCCCGAGAGCCTGAGAGCTGCAGTGGGTCAGAACAGCTCCACCCCCTCCTCCGGGCCCTTCCCCCAAGAACAGTCTCTGTATCACTGGGAGCACTACACCGCAGGTTCCGGCACCCTCCCGACTCCCGGCAACTCCCTGCCATGTGATGAATTCCTGCCCTCTTTCCAGACGTTGTTACCAGCACTAACAGAGCAAATACAGCCAGGGCAGCAGGAGACGATGATGATGATGCCCCCTACTGGGGATTTGCTGTATCACACTCAGCACCAATCTCCCTTCGCTGCTATGGATGAGAGCTACTCACAGGGCGCANGCTCGGTTGGGGGATCAGAGTTTCNTCGTGGGCATCACAGGGAATGGCACANGCTGGGGACGAANGCCACCCTGGNATGGGGGCTGNNCAACTCTTTNNTGAGGGCTTTCAGTTTCCTCCCCATTCACCACCTTGTNTAAATCCCTG
  5   1   2       bld Em10      in                    IMAGE:7982041.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCCTTGAGAGAAGAGATCGGAGATTTGGTGCAAGCAGAGCCTGTCCCGAAATTCAGCAAGATGGATCCCAGTATCTACTACTGCCCAGAGCTCGCCCCGCAGGAGGTCCCAAGCCTGGAGGGCAGATCAGAAGATTTATTATATGATGACTCTGGCTTTCTCCATGACTCTGACCTGAGCGGCTTTCAACTGAGTGCAGGGAAGGGACTGTACCCCGACCCCGAGAGCCTGAGAGCTGCAGTGGGTCAGAACAGCTCCACCCCCTCCTCCGGGCCCTTCCCCCAAGAACAGTCTCTGTATTACTGGGAGCACTACACCGCAGGTTCAGGCACCCTCCCGACTCCCGGCAACTCCCTGCCATGTGATGAATTCCTGCCCTCTTTCCAGACGTTGTTACCAGCACTAACAGAGCAAATACAGCCAGGGCAGCAGGAGACTATGATGATGCCCCCTACTGGGGATTTGCTGTATCACACTCAGCACCAATCTCCCTTCGCTGCTATGGATGAGAGCTACTCACAGGGCGCAGGCTCGGTTGGGGATCAGAGTTTCTCGTGGGCATCACAGGAATGGCACAGCTGGGACGAAGCCACCTGGATGGGCTGCAACTCTTTTGAGGCTTCAGTTCCTCCATCACCACTTGTTAATCCTGGAAGTCAACACTCAGCAGCAAACAGAGCTCCCCCTGCAGCCTTTTCTCTCAATGACTCTCCTCACCATCAAGCCCTCAGCTCGGGCCCCCGCTGCTCCAGTAC
  5   1   2       bld Tbd7      in                         XL052p03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCTCTGGCTTTCTCCATGACTATGACCTGAGTGGCTTTCAGCTGAGTGCAGGGAAGGGACTGTACCCCGACCCCGAGAGCCTGAGAGCTGCAGTGGGTCAGAACAGCTCCACCCCCTCCTCCGGGCCCTTTCCCCAAGAACAGTCTCTGTATCACTGGGAGCACTACACCGCAGGTTCAGGCACCCTCCCGACTCCCGGCAACTCCCTGCCATGTGATGAATTCCTGCCCTCTTTCCAGACGTTGTTACCAGCACTAACAGAGCAAATACAGCCAGGGCAGCAGGAGACGATGATGATGCCCCCTACTGGGGATTTGCTGTATCACACTCAGCACCAATCTCCCTTCGCTGCTATGGATGAGAGCTACTCCCAGGGCGCAGGCTCGGTTGGGGATCAGAGTTTCTCGTGGGCATCACAGGAATGGCACAGCTGGGACGAAACCACCTGGATGGGCTGCAACTCTTTTGAGGCTTCAGTTCCTCCATCACCACTTGTTAATCCTGGGAAGTCAACACTCAGCAGCAAACAGAGCTCCCCCTGCAGCCTTTCCTCTCAATGACTCTCCTCACCATCAAGCCCTCAGCTCGGGCCC
  5   1   2       bld DMZ       in                         xl332m02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTCCTGGTCCAAAAGGCACCAAAAACTCCTTGAGAGAAGAGATCGGAGATTTGGTGCAAGCAGAGCCTGTCCCGAAATTCAGCAAGATGGATCCCAGTATCTACTACTGCCCAGAGCTCGCCCCGCAGGAGGTCCCAAGCCTGGAGGGCAGGTCAGAAGGTTCAGGCACCCTCCCGACTCCCGGCAACTCCCTGCCATGTGATGAATTCCTGCCCTCTTTCCAGACGTTGTTACCAGCACTAACAGAGCAAATACAGCCAGGGCAGCAGGAGACGATGATGATGCCCCCTACTGGGGATTTGCTGTATCACACTCAGCACCAATCTCCCTTCACTGCTATGGATGAGAGCTACTCCCAGGGCGCAGGCTCGGTTGGGGATCAGAGTTTCTCGTGGGCATCACAGGAATGGCACAGCTGGGACGAAACCACCTGGATGGGCTGCAACTCTTTTGAGGCTTCAGTTCCTCCATCACCACTTGTTAATCCTGGAAGTCAACACTCAGCAGCAAACAGAGCTCCCCCTGCAGCCTTTCCTCTCAATGACTCTCCTCACCATCAAGCCCACAGCTTGGGCCCCCGCCGCTCCAGTACAGAAAATGAGAGATACCATCATCCCTATAGACTGAACAGCACCGGGATCAAGGACAAGAAACCACTGCCAACAGCAAGCTCCGGCCCAATTCAGCTCTGGCAGTTCCTCCTG
  5   1   2      seed DMZ       in                         xl272e02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTCCTGTCCAAAAGGCACCAAAAACTCCTTGAGAGAAGAGATCGGAGATTTGGTGCAAGCAGAGCCTGTCCCGAAATTCAGCAAGATGGATCCCAGTATCTACTACTGCCCAGAGCTCGCCCCGCAGGAGGTCCCAAGCCTGGAGGGCAGGTCAGAAGGTTCAGGCACCCTCCCGACTCCCGGCAACTCCCTGCCATGTGATGAATTCCTGCCCTCTTTCCAGACGTTGTTACCAGCACTAACAGAGCAAATACAGCCAGGGCAGCAGGAGACGATGATGATGCCCCCTACTGGGGATTTGCTGTATCACACTCAGCACCAATCTCCCTTCACTGCTATGGATGAGAGCTACTCCCAGGGCGCAGGCTCGGTTGGGGATCAGAGTTTCTCGTGGGCATCACAGGAATGGCACAGCTGGGACGAAACCACCTGGATGGGCTGCAACTCTTTTGAGGCTTCAGTTCCTCCATCACCACTTGTTAATCCTGGAAGTCAACACTCAGCAGCAAACAGAGCTCCCCCTGCAGCCTTTCCTCTCAATGACTCTCCTCACCATCAAGCCCACAGCTTGGGCCCCCGCCGCTCCAGTACAGAAAATGAGAGATACCATCATCCCTATAGACTGAACAGCACCGGGATCAAGGACAAGAAACCACTGCCAACAGCAAGCTCCGGCCCAATTCAGCTCTGGCAGTTCC
  5   1   2       bld DMZ       in                         xl235c01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTCCTGTCCAAAAGGCACCAAAAACTCCTTGAGAGAAGAGATCGGAGATTTGGTGCAAGCAGAGCCTGTCCCGAAATTCAGCAAGATGGATCCCAGTATCTACTACTGCCCAGAGCTCGCCCCGCAGGAGGTCCCAAGCCTGGAGGGCAGGTCAGAAGGTTCAGGCACCCTCCCGACTCCCGGCAACTCCCTGCCATGTGATGAATTCCTGCCCTCTTTCCAGACGTTGTTACCAGCACTAACAGAGCAAATACAGCCAGGGCAGCAGGAGACGATGATGATGCCCCCTACTGGGGATTTGCTGTATCACACTCAGCACCAATCTCCCTTCACTGCTATGGATGAGAGCTACTCCCAGGGCGCAGGCTCGGTTGGGGATCAGAGTTTCTCGTGGGCATCACAGGAATGGCACAGCTGGGACGAAACCACCTGGATGGGCTGCAACTCTTTTGAGGCTTCANTTCCTCCATCACCACTTGTTAATCCTGGAAGTCAACACTCAGCAGCAAACAGAGCTCCCCCTGCAGCCTTTCCTCTCAATGACTCTCCTCACCATCAAGCCCACAGCTTGGGCCCCCGCCGCTCCNGTACAGAAAATGAGAGATACCATCATCCCTATAGACTGAACAGCACCGGGATCAAGGACAAGAAACCACTGCCNACAGCAAGCTCCGGCCCAATTCAGCTCTGGCAGTTC
  5   1   2       bld Ga18                              xlk118n19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGCTGCAACTCTTTTGAGGCTTCAGTTCCTCCATCACCACTTGTTAATCCTGGAAGTCAACACTCAGCAGCAAACAGAGCTCCCCCTGCAGCCTTTCCTCTCAATGACTCTCCTCACCATCAAGCCCTCAGCTCGGGCCCCCGCCGCTCCAGTACAGATAATGAGAGATACCATCACCCCTATAGACTGAACAGCACAGGGATCAAGGACAAGAAACCACTGCCAACAGCAAGCTCCGGNCCAATTCAGCTCTGGNAGTTCCTCCTGGAGTTACTGCAAGATTCCTCCTGCCAGAAGCTTATCAGCTGGACTGGGAACGGCTGGGAGTTTAAACTTTCTGACCCCAACGAGGTGGCCAGGCGATGGGNCAGACGTAAGAACAAGCCACGGATGAACTACGAGAAGCTGAGCCGNGNNNNAGGTATTATTATCACAAGAACATCATACATAAGACTGGAGGNCAGCGCTACGTGTACAGATTTGTCTGTGANCTGCAGGACCTTCTGTCCCGACCCACTCAGACATCACAGCCTCCCACCAAAACCCAGAGACCCAGGATTCAATAATCATGCGAGGGGNCCTGGAGCGGGTTCTGGACTTCTGAGAATGAGCCCAGAGCTGCTGNTACATCACAGTCATGCACTAAAGCAAATATGTNCTCTTNNTGAACTAGAAGNCTTACGTTGGAGNNAGTTGCNGCCTGAGGGGNNGGTACAAGCAGNNNGTGACTNCACTAGGCTCCNCCNNCTNGACAGCAGTTGGNTTCAGNNNAAANNNNAAAAAANAC
  5   1   2       bld Ga18                               xlk52f05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCCCTGCAGCCTTTCCTCTCAATGACTCTCCTCACCATCAAGCCCACAGCTTGGNCCCCCGCCGCTCCAGTACAGATAATGAGAGATACCATCATCCCTATAGACTGAACAGCACAGGGATCAAGGACAAGAAACCACTGCCAACAGCAAGCTCCGGCCCAATTCAGCTCTGGCAGTTCCTCCTGGAGTTACTGCAAGATTCCTCCTGCCAGAAGCTTATCAGCTGGACTGGGAACGGCTGGGAGTTTAAACTTTCTGACCCCAACGAGGTGGCCAGGCGATGGGGCAGACGTAAGAACAAGCCACGGATGAACTACGAGAAGCTGAGCCGNGNNNGAGGTATTATTATCACAAGAACATCATACATAAGACTGGAGGTCAGCGCTACGTGTACAGATTTGTCTGTGACCTGCAGGACCTTCTGTCCCGACCCACTCAGACATCACAGCCTCCCGCCAAAACCCAGAGACCCAGGATTCAATAATCATGTGAGGGGACCTGGAGCGGGTTCTGGACTTCTGAGAATGAGCCCAGAGCTGCTGCTACATCACAGTCATGCATTAATGCAAATATCTGCTCTTGCTGAACTAGAAGTCTTACGTTGGAGACAGTTGCAGNCTGAGGGGGCGGTNNAAGCAGACAGTGACTGCACTAGGCTCCNCCCACTGGACAGCAGTTGGATCCAGNGGaaaagnaaaaaaaCACTATTGAGCCCCAAAACTTCTGCCTCTAAATTCACTGACTAAAAGNNNNNGCAGANCCATTNNCTCTAGAAGCAAAAANGCNTCGATTGT
  5   1   2       e50                                 Xl3.1-xl332m02.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACATCACAGCCTCCCACCAAAACCCAGAGATCCAGGATTCAATAATCATGTGAGGGGACCTGGAGCGGATTCTGGACTTCTGAGAATGAGCCCAGGGCTGCTGCTACATCACAGTCATGCACTAAAGCAAATATCTGCTCTTGCTGAACTAGAAGTCTTACGTTGGAGACAGTTGCAGCCTGAGGGGGCGGTACAAGCAGACAGTGACTGCACTAGGCTCCGCCCACTGGGCAGCAGTTGGATCCAGTGGAAAAGTAAAAAACACTATTGAGCCCCAAAACTTCTGCCTCTAAATTCACTGACGAAAAGTCCGGAGCAGATCCATTAACTCTAGAAGCAAAAAGGCCTCGATTGTATTGTACAGAGAACAGCACAGGCATCACTTACACTTTTATATTAGGGCAGGAGAACATGTGGCTTCCTTCTATTATGAATTAAAGGGCCACACACATTCCGATGAAGACAGCCATTACTGGAGGCTGCTGGGGGTTAGAATTCAGCAACAAACAGAGGCTCCCTGATAAAGCACTGAATAGAAATAGTGATTGGCTGCCTTTCTGGGTTCTGTGAGCACCCATTGGTCCAATCCTAAGGAAGTGGGCGGGCACACTGGCTGGAAAGCAGGTTACAGTCCCGCCTTGTCTTTATAAGATGCTCTTTCTCAGGTACAAATCTACCCAGTGTTTTGTAAATAGA
                                                  Xl3.1-CHK-1012705779                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGCCTCCCACCAAAACCCAGAGATCCAGGATTCAATAATCATGTGAGGGGACCTGGAGCGGATTCTGGACTTCTGAGAATGAGCCCAGGGCTGCTGCTACATCACAGTCATGCACTAAAGCAAATATCTGCTCTTGCTGAACTAGAAGTCTTACGTTGGAGACAGTTGCAGCCTGAGGGGGCGGTACAAGCAGACAGTGACTGCACTAGGCTCCGCCCACTGGGCAGCAGTTGGATCCAGTGGAAAAGTAAAAAACACTATTGAGCCCCAAAACTTCTGCCTCTAAATTCACTGACGAAAAGTCCGGAGCAGATCCATTAACTCTAGAAGCAAAAAGGCCTCGATTGTATTGTACAGAGAACAGCACAGGCATCACTTACACTTTTATATTAGGGCAGGAGAACATGTGGCTTCCTTCTATTATGAATTAAAGGGCCACACACATTCCGATGAAGACAGCCATTACTGGAGGCTGCTGGGGGTTAGAATTCAGCAACAAACAGAGGCTCCCTGATAAAGCACTGAATAGAAATAGTGATTGGCTGCCTTTCTGGGTTCTGTGAGCACCCATTGGTCCAATCCTAAGGAAGTGGGCGGGCACACTGGCTGGAAAGCAGGTTACAGTCCCGCCTTGTCTTTATAAGATGCTCTTTCTCAGGTACAAATCTACCCAGTGTTTTGTAAATAGACAGATG
  3   1   2      seed DMZ       in                         xl332m02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CANTCAGACATCACAGCCTCCCACCAAAACCCAGAGATCCAGGATTCAATAATCATGTGAGGGGACCTGGAGCGGATTCTGGACTTCTGAGAATGAGCCCAGGGCTGCTGCTACATCACAGTCATGCACTAAAGCAAATATCTGCTCTTGCTGAACTAGAAGTCTTACGTTGGAGACAGTTGCAGCCTGAGGGGGCGGTACAAGCAGACAGTGACTGCACTAGGCTCCGCCCACTGGGCAGCAGTTGGATCCAGTGGAAAAGTAAAAAACACTATTGAGCCCCAAAACTTCTGCCTCTAAATTCACTGACGAAAAGTCCGGAGCAGATCCATTAACTCTAGAAGCAAAAAGGCCTCGATTGTATTGTACAGAGAACAGCACAGGCATCACTTACACTTTTATATTAGGGCAGGAGAACATGTGGCTTCCTTCTATTATGAATTAAAGGGCCACACACATTCCGATGAAGACAGCCATTACTGGAGGCTGCTGGGGGTTAGAATTCAGCAACAAACAGAGGCTCCCTGATAAAGCACTGAATAGAAATAGTGATTGGCTGCCTTTCTGGGTTCTGTGAGCACCCATTGGTCCAATCCTAAGGAAGTGGGCGGGCACACTGGCTGGAAAGCAGGTTACAGTCCCGCCTTGTCTTTATAAGATGCTCTTTCTCAGGTACAAATCTACCCAGTGTTTTGTAAATAGACAGAT
  3   1   2       bld DMZ       in                         xl235c01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACATCACAGCCTCCCACCAAAACCCAGAGATCCAGGATTCAATAATCATGTGAGGGGACCTGGAGCGGATTCTGGACTTCTGAGAATGAGCCCAGGGCTGCTGCTACATCACAGTCATGCACTAAAGCAAATATCTGCTCTTGCTGAACTAGAAGTCTTACGTTGGAGACAGTTGCAGCCTGAGGGGGCGGTACAAGCAGACAGTGACTGCACTAGGCTCCGCCCACTGGGCAGCAGTTGGATCCAGTGGAAAAGTAAAAAACACTATTGAGCCCCAAAACTTCTGCCTCTAAATTCACTGACGAAAAGTCCGGAGCAGATCCATTAACTCTAGAAGCAAAAAGGCCTCGATTGTATTGTACAGAGAACAGCACAGGCATCACTTACACTTTTATATTAGGGCAGGAGAACATGTGGCTTCCTTCTATTATGAATTAAAGGGCCACACACATTCCGATGAAGACAGCCATTACTGGAGGCTGCTGGGGGTTAGAATTCAGCAACAAACAGAGGCTCCCTGATAAAGCACTGAATAGAAATAGTGATTGGCTGCCTTTCTGGGTTCTGTGAGCACCCATTGGTCCAATCCTAAGGAAGTGGGCGGGCACACTGGCTGGAAAGCAGGTTACAGTCCCGCCTTGTCTTTATAAGATGCTCTTTCTCAGGTACAAATCTACCCAGTGTTTTGTAAATAGACAGATG
  3   1   2       add Em10      in                    IMAGE:7982041.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGACCCAGGATTCAATAATCATGCGAGGGGACCTGGAGCGGGTTCTGGACTTCTGAGAATGAGCCCAGAGCTGCTGCTACATCACAGTCATGCACTAAAGCAAATATCTGCTCTTGCTGAACTAGAAGTCTTACGTTGGAGACAGTTGCAGCCTGAGGGGGCGGTACAAGCAGACAGTGACTGCACTAGGCTCCGCCCACTGGACAGCAGTTGGATCCAGTGGAAAAGTAAAAAACACTATTGAGCCCCAAAGCTTCTGCCTCTAAATTCACTGACAAAGTCTGGAGCAGATCCATTAACTCTAGAAGCAAAAAGGCCTCGATTGTATTGTACAGAGAACAGCACAGGCATCACTTACACTTGTATATTAGGGCAGGACAACATGTGGCCTCCTTCTATTATGAATTAAAGGGCCACACACACATTCCGATGAGGACAGCCATTACTGGAGGCTGCTGGGGGTTAGAATTCAGCAACAAACAGAGGCTCCCTGATAAAGCACTGAATAGAAATAGTGATTGGCTGCCTTTCTGGGTTCTGTGAGCACCCATTGGTCCAATCCTAAGGAAGTGGGCGGGCACACTAGCTGGAAAGCAGGTTACAGCCCCGCCTTGTGTTTATAAGATGCTCTCTCAGGTACAAATCTACCCAGTGTTTTGTAAATAGACAGATGTGTCTTATATTGTATTTCCTATAAAAAAAAAAAC
  3   1   2       bld DMZ       in                         xl272e02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGCGGATTCTGGACTTCTGAGAATGAGCCCAGGGCTGCTGCTACATCACAGTCATGCACTAAAGCAAATATCTGCTCTTGCTGAACTAGAAGTCTTACGTTGGAGACAGTTGCAGCCTGAGGGGGCGGTACAAGCAGACAGTGACTGCACTAGGCTCCGCCCACTGGGCAGCAGTTGGATCCAGTGGAAAAGTAAAAAACACTATTGAGCCCCAAAACTTCTGCCTCTAAATTCACTGACGAAAAGTCCGGAGCAGATCCATTAACTCTAGAAGCAAAAAGGCCTCGATTGTATTGTACAGAGAACAGCACAGGCATCACTTACACTTTTATATTAGGGCAGGAGAACATGTGGCTTCCTTCTATTATGAATTAAAGGGCCACACACATTCCGATGAAGACAGCCATTACTGGAGGCTGCTGGGGGTTAGAATTCAGCAACAAACAGAGGCTCCCTGATAAAGCACTGAATAGAAATAGTGATTGGCTGCCTTTCTGGGTTCTGTGAGCACCCATTGGTCCAATCCTAAGGAAGTGGGCGGGCACACTGGCTGGAAAGCAGGTTACAGTCCCGCCTTGTCTTTATAAGATGCTCTTTCTCAGGTACAAATCTACCCAGTGTTTTGTAAATAGACAGATGTT
  3   1   2       add Tbd7      in                         XL052p03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTTCTGAGAATGAGCCCAGAGCTGCTGCTACATCACAGTCATGCACTAAAGCAAATATGTGCTCTTGCTGAACTAGAAGTCTTACGTTGGAGACAGTTGCAGCCTGAGGGGGCGGTACAAGCAGACAGTGACTGCACTAGGCTCCGCCCACTGGACAGCAGTTGGATTCAGTGGAAAAGTAAAAAACACTATTGAGCCCCAAAGCTTCTGCCTCTAAATTCACTGACAAAGTCTGGAGCAGATCCATTAACTCTAGAAGCAAAAAGGCCTTGATTGTATTGTACAGAGAACAGCACAGGCATCACTTACACTTGTATAGGGCAGGAGAACATGTGGCCTCCTTCTATTATGAATTAAAGGGCCACACACACATTCCGATGAGGACAGCCATTACTGGAGGCTGCTGGGGGTTAGAATTCAGCAACAAACAGAGGCTCCCTGATAAAGCACTGAATAGAAATAGTGATTGGCTGCCTTTCTGGGTTCTGTGAGCACCCATTGGTCCAATCCTAAGGAAGTGGGCGGGCACACTAGCTGGAAAGCAGGTTACAGCCCCGCCTTGTCTTTATAAGATGCTCTTTCTCAGGTACAAATCTACCCAGTGTTTTGTAAATAGACAGATGTTTTCTTATATTTGTATTTTCCTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)