Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 97%

 1012069922 Xt7.1-THdA013i18.3 - 1464 ESTs
                                                                       ....-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-THdA013i18.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACGTCGGAGAGCTGGAACTGCGGCTCCTCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGAGAAAATACTCTAATGAAGATACCCTGGCTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCTGAATACAAATTCCCCGAGGAGCTGACACAAACCTTCATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGCAAGACTGGCTTTGCCAGCGTCATCTTGTTTGGCACCAACAATGACAGCTCCATCTCCGGCGTGTGGGTGTTCAGGGGCCAGGACCTTGCATTCACACTCTCTGAAGACTGGCAAATTGACTATGAATCCTACACCTGGAGAAAGCTGGACAGCAATAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTCTGCTGGGAGGGAGACTTCAAGCACGTGGGAAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGGAGGCGATCTCTGTCCCCCTAAAATACGCGCAGAGTCTGGTTTTCACATCCGTACCAACATCCAGAGCCTTTTAACTTAACAAGACAGCAAACCGAAAATAAAAAAACTGAAATCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008221081                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGAGCTGGAACTGCGGCTCCTCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGAGAAAATACTCTAATGAAGATACCCTGGCTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCTGAATACAAATTCCCCGAGGAGCTGACACAAACCTTCATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGCAAGACTGGCTTTGCCAGCGTCATCTTGTTTGGCACCAACAATGACAGCTCCATCTCCGGCGTGTGGGTGTTCAGGGGCCAGGACCTTGCATTCACACTCTCTGAAGACTGGCAAATTGACTATGAATCCTACACCTGGAGAAAGCTGGACAGCAATAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTCTGCTGGGAGGGAGACTTCAAGCACGTGGGAAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGGAGGCGATCTCTGTCCCCCTAAAATACGCGCAGAGTCTGGTTTTCACATCCGTACCAACATCCAGAGCCTTTTAACTTAACAAGACAGCAAACCGAAAATAAAAAAACTGAAAxxAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  4     9    11    27    16    47    48    85   142   188   287   329   347   384   381   417   447   471   496   523   520   552   560   571   567   581   572   584   577   587   580   592   586   594   585   595   589   599   596   605   597   608   603   612   608   615   612   619   616   623   617   627   621   632   626   633   624   634   629   637   632   639   628   641   634   645   638   648   642   651   641   651   643   657   660   667   660   671   659   672   659   674   659   677   665   682   670   689   669   692   673   698   676   703   677   711   685   722   697   743   729   777   730   798   786   858   798   888   790   921   857   940   891   974   931  1008   934  1018   959  1039   947  1055   953  1072   981  1088   961  1074   944  1062   916  1050   930  1060   932  1057   945  1082   969  1078   939  1047   948  1049   921  1022   921  1022   939  1023   909   998   896   984   842   916   839   907   823   885   820   879   803   857   800   839   778   817   779   815   777   813   770   806   768   805   777   811   774   805   782   802   777   794   767   789   766   791   764   785   759   785   760   785   757   782   757   777   751   774   740   772   755   768   747   766   742   761   748   761   741   762   739   755   730   751   718   746   720   740   710   734   712   733   710   730   704   726   696   726   701   722   694   716   682   712   675   699   656   680   595   662   548   610   524   576    84   221    87   103    11    20     4     9
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---T-A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----------A-
                                               BLH ATG      48    1830                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                               BLH MIN      48     249                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                               BLH MPR      48     249                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                               BLH OVR      48      74                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                               CDS MIN      48      58                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                               EST CLI      46      58                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                               ORF LNG      48       8                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED = Gg ==== 2e-015     XP_428054.2 PREDICTED: similar to eukaryotic translation elongation factor 1, partial [Gallus gallus] ==========================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Sc ==== 3e-060     NP_012842.1 Translation elongation factor EF-1gamma; Tef4p [Saccharomyces cerevisiae] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Ce ==== 3e-106     NP_505800.1 glutathione S-transferase, C-terminal and Elongation factor 1, gamma chain (44.4kD) (5L447) [Caenorhabditis elegans] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Br ==== 7e-135     AAM93480.1 eukaryotic translation elongation factor 1 gamma [Branchiostoma lanceolatum] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Sp ==== 1e-136     NP_001020382.1 translation elongation factor 1B gamma subunit [Strongylocentrotus purpuratus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Dm ==== 4e-141     NP_652000.1 CG11901-PA [Drosophila melanogaster] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Dr ==== 0          NP_775370.1 eukaryotic translation elongation factor 1 gamma [Danio rerio] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Hs ==== 0          NP_001395.1 eukaryotic translation elongation factor 1 gamma; elongation factor 1-gamma;EF-1-gamma; eEF-1B gamma; translation elongation factor eEF-1 gamma chain;PRO1608; pancreatic tumor-related protein [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Mm ==== 0          NP_080283.3 eukaryotic translation elongation factor 1 gamma [Mus musculus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === ?? ==== 0          NP_001079766.1 elongation factor 1 gamma [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xl ==== 0          AAB29957.1 elongation factor 1 gamma; EF-1 gamma [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Xt ==== 0          AAH80966.1 Unknown (protein for IMAGE:6981438) [Xenopus tropicalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-THdA013i18.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  5   1   1           Tbd0 FLq                    IMAGE:5379330.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGGCATTCCTTGTGGCGGAATGCATAGAATTGCACTACAAGACAAATGCTGACTTGGAGTCTCAGATTTAAATTGGAGAGCATGTGAGCTCTGAGATGAGCTGTGAATCTTTATCATTCTACATCAAGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGAGAAAATACTCTAATGAAGATACCCTGGCTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCTGAATACAAATTCCCCGAGGAGCTGACACAAACCTTCATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGCAAGACTGGCTTTGCCAGCGTCATCTTGTTTGGCACCAACAATGACAGCTCCATCTCCGGCGTGTGGGTGTTCAGGGGCCAGGACCTTGCATTCACACTCTCTGAAGACTGGCAAATTGACTATGAATCCTACACCTGGAGAAAGCTGGACAGCAATAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTCTGCTGGGAGGGAGACTTCAAGCACGTGGGAAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGGAGGCGATCTCTGTCCCCCTAAAATACGCGCAGAGTCTGGTTTTCACATCCGTACCAACATCCAGAGCCTTTTAACTTAACAAGACAGCAAACAGAAAATAAAAAACTGAAATCAAAACCATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Gas1 FLt5                   IMAGE:6981438.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGAGAAAATACTCTAATGAAGATACCCTGGCTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCTGAATACAAATTCCCCGAGGAGCTGACACAAACCTTCATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGCAAGACTGGCTTTGCCAGCGTCATCTTGTTTGGCACCAACAATGACAGCTCCATCTCCGGCGTGTGGGTGTTCAGGGGCCAGGACCTTGCATTCACACTCTCTGAAGACTGGCAAATTGACTATGAATCCTACACCTGGAGAAAGCTGGACAGCAATAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTCTGCTGGGAGGGAGACTTCAAGCACGTGGGAAAGGCCTTTAACCAGGGCAAGATCTTCAAATGAGGAGGAGGCGATCTCTGTCCCCCTAAAATACGCGCAGAGTCTGGTTTTCACATCCGTACCAACATCCAGAGCCTTTTAACTTAACAAGACAGCAAACAGAAAATAAAAAACTGAAATCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld TbA       in                   TTbA053f20.p1kSP6 AAAATATCGGATGATGGATCGGGAATGGTTGATCCATGGACTCCCAATGTAAACTTTGACGAACTGACTTCTGGGGATTCAGATTGCAGCCACACTGTCTTTGACTCAGAATCCCTCCTTCGGGACGCATTGCTCTTATGTTTACTTCAAGGACAATCGCCAGCGACGCCCATTGATATGCCTGTATAACTGACTTCTGGAGATTCATATGGAAACATCTCTGCGTTGCTCTTATCATTACTTCAAGCCCATGCGCCGGCGGCACCCACTGATAGCCCTGTATAACTGACTTCTGGGGATTCATATGGAAGCAACACTGCTGACTGAGAATCCATTTTGCGGACTGCGTTGCTCTTATCATTACTTCAAGCCCATGGTGAAGACTTGAACAAGCTCAATGATGGACAGAACTACAATGTATCTACAGAACATTGGATGGATCCTGGGCAAAAATAACTTTTTTTGCTATAAAGCACGTCCTTAACTTATTTGACCATTGGATTCTATCTGAAATGTACAATGTAATAAATGTTAATTATCCCATTGAAAAAAAAAAAAAAAAAACCCGGGGGGGCCGGACGGGACTCTGTACACATACCCTGATAAACTGGAGGGCATACAAGCCCCTCATTGCTGCT
  5   1   2       bld Tbd0 FLq  in                    IMAGE:5379330.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGGCATTCCTTGTGGCGGAATGCATAGAATTGCACTACAAGACAAATGCTGACTTGGAGTCTCAGATTTAAATTGGAGAGCATGTGAGCTCTGAGATGAGCTGTGAATCTTTATCATTCTACATCAAGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCT
  5   1   2       chi Eye       in                         CCAX1498.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGGGAAAGAACCCACCTGTGATAGTAACTGCTCCGAAAAGGCTTTCCATCGGCAACAGTAGAAGTCATGGGTGAAAAGGCCTTCGGTTTCCAAAGTTGCGTGAAGTTGCCTGCAGGAGAAAAGCCTTTTCAGAGCGTTTACTCGCCCATGATAGCAGCGGTCTGTTGTGGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTA
  5   1   2       bld Neu0 5g                            IMAGE:6993043                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCCCGTCGCTTACACTCCTCTATTTTACGACAGCCCGTAGTCTGTTTTCGGCACCTATATTACGTCGGAGAGCTGGAACTGCGGCTCCTCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCNTGTGTTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAANGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGGAAAAGAAGAAGGCAACACCCAGCTCCTGCTCCTGCCCCANGCCCCTTGAGGATGATATGGAATGAAATCTGA
  5   1   2       bld In62 5g                         IMAGE:8956686.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTTTTTTTTTTTTTGCTTGTCTTTTTTATTTTTAAATTCGTCCCGTGCGAGCGGCGCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCTCAAGAAAGAAACTCTAGAAAGAGAAGTCAGCAAGGAGTCTAAAAAAGAAAGAGAAGAGAGCACACAGCTCTGCTCTGCCAGCCTGAGATGAATGAATGATCTGAAAGGCTTAGCAGCGAGCCTAATTC
  5   1   2   14  bld Te5  5g3  in                        CAAO12199.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTATATTACGTCGGAGAGCTGGAACTGCGGCTCCTCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCAGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCA
  5   1   2       bld 1030 5g                         IMAGE:7093206.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGTATTACGTCGGAGAGCTGGAACTGCGGCTCCTCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGATCAACCAGAATTCGTGCTGTGTTGGGAGAAGTAAGCTTTGTGAAAG
  5   1   2       bld In63 5g                         IMAGE:8958752.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TATTTTTTATTTTTAGATGATCACTTCGATTCGAATTCGTCCCCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAACTCCCAAGAAGAGAAGCCAGCAAAGAGCCAAAAAAGAAAAGAGAAAGAGACGCACACAGCTCTGCTCTGCCCAGCCCTGAGATGATATGATGATCTGAAGCTTAGCAGCAGAGCTAATCAAAGAACCATACGCACATCTACCTAAAAGCTC
  5   1   2   14  bld Te5  5g3  in                         CAAO6630.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TACGTCGGAGAGCTGGAACTGCGGCTCCTCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGA
  5   1   2       bld Tad0      in                       IMAGE:6981805                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGCAGGGGGCTGGGTACCCGCGTCCGGAATTCCCGGGGATGAAGATGGCCGGCGGGACTCTGTACACATACCTCTGATAACTGGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCAGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACATTTTGATGCTAAGAAGTTTGCCGAGATGCCGCCCCAGAAAAAAACTCCCTAGAAAGAGAAGCCAGCAATGAGCCCAAAAAAGAAAGGAGGAAAAGAAGAGGGCACACCGCTCCTGTTCTGCCCAGCCCTGAGGAGATTGGAGAATCTAAAAGGGTTTCN
  5   1   2       bld In63 5g                         IMAGE:8960824.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCTTTTTTGAGGCATTTCCTAAAAAATAAAAACGTCCCCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAACTCCTCAAGAAAGAGAAGCCAGCAAGGAGCCAAAAAAGAAAGGAGGAAAAGAGAGGCAACACCAGCTCTGCTCTGCCCAGCCCTGAGATGAATATGGATGATCTGAAAGGCTTTAGCAGCGAGTCTAATCAAAGAACCATACGCACATCTAACTAAAGCTCTTTTTGTATGAATGGAGTTAAAAGAACAATACTCTTATTGAAGATCCTTGGGCTGAGC
  5   1   2       bld In66 5g                         IMAGE:8965597.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTTTTTTTTTTTTTTTAAAATTATAATAAATTTATCCCCGCGTGAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCTCAGAAGAACTCCCAAGAAGAGAAGCCAGCAATGGAGTCTAAAAAAAGAAATGGAGGAAAAGAGATCACACAGCTCTGCTCTGCCCAGCCCTGAGATGATATGATGATCTGAAGGCTTAGCAGCGAGCTAATCAGATCATACGCCATCTACTTAAGCTCTTTTGTAATGGATGGATTTAAGAGAGAAAATTACCTCTTATTGAAAGATATCCTCTG
  5   1   2       bld Gas  5g3  in                   TGas108f08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCGGAGAGCTGGAACTGCGGCTCCTCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAG
  5   1   2       bld Te5       in                         CAAO3708.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCGGAGAGCTGGAACTGCGGCTCCTCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAGGAGGAAAA
  5   1   2       bld In63 5g                         IMAGE:8961417.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTTTTTATGCTTTTTCTCTCTTATTTTTTTCGTCCCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAGAGAAGCCAGCAAAGGAGCCAAAAAAGAAAGGAGGAAAGAGAGCACACCAGCTCCTGCTCCTGCCCAGCCCTGAGATGATATGGATGATCTGAAAGGCTTAGCAGCGAGCTAATCAAAGACCATACGCCCATCTACTAAAGCTCTTTTGTATGATGAGTTTAAGAGAAAACTCTATGAGAACCTGCTTGAGCTCTGCTATTTGGAGATGACAGAGCTGTCATTGGTACTGATCATTCGGACTGACAACTCGACGCACTTATACGATGTCACGCTAGACACTGGCCGAACTGCTTGGCAGGTAA
  5   1   2       bld In60 5g                         IMAGE:8950514.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGGAAATTAATTAAATGTAAACATTTAATTCGAATTCGTCCCGGCCGGCGGGACTCTGTACACATACCCTGTATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTTGGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCTCGTGCTGTTGTTGGGAGAAAGTCAAGCTTTTGTGACAGATGGGCACAGTTTGATGCTAAGAAGTTTGCTCGAGATGCCATCCCAAGAAAGAAACTCCCAAGAAAAGAACCCTTCACAGGTATCCTATTAAAGAAATAGTGATGAAAAAAGAATGCTACCCATCTACTGCTCCTGCTCCAGCCCTCTGAGAATGAATATGGAATGGATCTTGAAAAGGTTTTTACATGCAGACCTAAATTCATAAGGAA
  5   1   2       bld Egg  5x3  out                  TEgg038h16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGAGCTGGAACTGCGGCTCCTCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCT
  5   1   2       bld In60 5g                         IMAGE:8951912.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAAATCATCTATGACAATCTCAACTTATAAAATATCAGGCCGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAGAAGAAACTCCCAGAAAGAGAGCAGCAAAGAGCAAAAAAGAAGAGAAGGAGAGCACACAGCTCTGCTCTGCCAGCCCTGAGATGATTGAATGATCTGAAGCTTTAGCAGCGAGCTAAATCAAGACCCATACGCACATCTACTA
  5   1   2       bld In62 5g                         IMAGE:8953988.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTTTTTTTTTTTGCGGTTTTTTTTTTTATAAAAATACGTCCTGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAACTCCCAGAAGAGAAGCCAGCAAAGGAGCCAAAAAAGAAAGAGGAAAAGAGAGGCACACCAGCTCCTGCTCTGCTCCAGCTCCTGAGATGATATGGATGATCTGAAGCTTAGCAGCAGAGCTAAATCAAGGACCATACGCACATCTAACTAAGCTCTTTTGTATGGATGAGTAGAAAATACTCTATGGAAGATCCTTGCTTGTTAGCTTGGCT
  5   1   2       bld In66 5g                         IMAGE:8965031.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TATATTAGAATATTAAGGATCTAATCAGATTCAAATTCGTCCCGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAGAAACTCCCAAGAAGAGAGCCTAGCAAAGGAGCCAAAAAAGGAAAGGAGGAAAGAGAAGCAACACCAGCTCCTGCTCTGCTCTCAGCCTCTGAGATGATATTGGATGATCTGAAAGCTTTAGTCAGCGAGTCCTAAATCAAGGACCATACGCCACATCTACCTTAAAAGCCTCGTTG
  5   1   2   22  bld Tad5 5g                              XZT60878.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTGGAACTGCGGCTCCTCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGCTTTAGCAGC
  5   1   2   12  bld Tad5 5g3  in                         XZT65230.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTGGAACTGCGACTCCTCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTTCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAA
  5   1   2       bld In66 5g                         IMAGE:8963467.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTTTTTCTTTTTGGGGATTTTTTTATTTATTAATTTTCCGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAGAAACTCCCAAGAAAGAGAAGCTCAGCAAAGGAGCCAAAAAAGAAAGGAGGAAAAGAGAGGTACACTAGCTCTGCTCTGCTCCAGCTCCTGAGATGATATTGGATGATCTGAAGCTTTAGCAGCAGAGTCTAATCAAGGACCATACGCACATTCTACCTAAAAGCTCTTTTTGTAATG
  5   1   2       bld Gas  5g3  in                   TGas081n07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGGAACTGCGGCTCCTCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTG
  5   1   2       bld Egg  5g3  in                   TEgg056b13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGAACTGCGGCTCCTCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGG
  5   1   2       bld In63 5g                         IMAGE:8960118.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGTTTTTATTTTTGAAAGTATTTTTATTTTTATTTAGTCCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCTCAAGAAAGAACTCTCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAGATAGGAGGAAAGAGATGCACACCAGCTCCTGCTCTGCCTCAGCCCTGAGATGATATGGATGAATTCTGAAGCTTTAGCAGCGAGCTAAATCAAGGACCCATACGCACATTCTACTAAAGCTCTTTTTTGGTATAGGGAAGTAGAGCTAG
  5   1   2       bld In66 5g                         IMAGE:8966655.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TATTATTTTTGTATCATACAATTCAATATAAAATTCGTCCCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCTCAAGAAAGAAACTCTCAAGAAGAGAAGCCAGCAAGGAGCCAAAAAGAAAGGAGGATAGAGAGGCAACACAGCTCTGCTCTGCTCCAGCTCCTGAGATGATATGGATGATCTGAAAGCTTAGCAGCAGAGCCTAAATCAAAGGACCATACGCACATCTACTAAAGCTCTTTTGTATGATGAGTTAGAGAAATACTTATGAGAACCCTGCTTAGCTCTGCTATTCTGGAGCCTTGACAGAGCTGTCACTGTACCTGATCAATCCGAGACTGACACTCTGACTGCACTATAGGTGTTCCACGCTCTAGACACTGCCAGACTGGT
  5   1   2       bld Tad5                                 XZT12552.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGACTGCGGCTCCTCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGG
  5   1   2       bld In60 5g                         IMAGE:8950161.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TATATTAAAATAATTTATAAAATCGTTATCTTATTCGTCCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAGAGAAGCCAGCATAGGAGCCAAATAAAAGAAAAGGAGAAAGAGAAGGCAACACACTTCTTGCTTCTTGCCCCAGCCTCTGAGATGATATGGATGATTCTGAAGGCTTTAGCAGCAGATCTAAATCTAGGGACCCTACCGCACATCTACCTAAAGCTCTTTTTTGTTATGAATGATTTTTAGAAGAAATATCTAATGAGAACCTGGGCCTGATGCTCTGTACCTAATATCGTGAGGAACTGA
  5   1   2       bld In63                            IMAGE:8957698.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCAAGATATCTATTGGAGGATCTTAACAAAAAAAAAATCGCCCCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAGAAAGAGAAAGAGACGCACACAGCTCTGCTCTGCCAGCCTGAGATGATATGATGATCTGAAAGCTAGCAGCAGCCTATCAGACATACGCCAATCTACTAAGCTCTTTTTGTATGATGAATTAGA
  5   1   2       bld In63 5g                         IMAGE:8960218.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTTTTTTTATTTTGCTTTTTTTAATTATAATTTAAATCGTTCGGCGGGATCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGGAAGGAAACTCCCAGAAAGAGAGCCAGCAAGGAGCCAAAAAGATAGAGAAGAGATGCACACAGCTCTGCTCTGCCAGCCCTGAGATGATTGATGATCTGAAGCCTAGCAGCAGGCTTATCAAGACGTACGCATCTACTAAGCTCTTTTGTATTGGATGGATTAGGACAT
  5   1   2   20  bld Eye  5g                              CCAX8905.b1 .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGAACTGCGGCTCCTCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGA
  5   1   2       bld Neu  5g                        TNeu041n23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAACTGCGGCTCCTCCCTTTCTACTCGCGTGAAGAGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTG
  5   1   2       bld In54                            IMAGE:8841151.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTAATTTATTATAACAGAATGTTAATCATTTTTAGTATTCGTCCCCTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAAGAACTCCCAAGAAAGAGAAGCCAGCAAAGAGCCTAAAAAAGAAAAGAGAAAAGAAGAAGCACATCTGCTCTTGCTTCTTGCCCAGCCCCTGAAGATGATTGGATGATTCTGAATAGCTTTTATCATCTGAGCTTAATTCAAGACCCATACGCCATCTAACCTACAGGCTTCTTTGGTATGATGAAGTAAGAGAGAATAACCTTAATGAAGATACTGAACGGGACTTCGTGCCTATATTTTCTGGGAGCACCATTTTGA
  5   1   2   12  bld Tad5 5g3  in                         XZT41593.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGCGGCTCCTCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCAGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGGAGGAAAAAGAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCT
  5   1   2       bld In66 5g                         IMAGE:8965955.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAACTTTTTCTAAATTCATAAATTAAAAAATTTCCTCCGGGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAGAGAAGCCAGCAAAGGAGCCAAAAAAGAAAAGGAGGAAAGAGACGCACACCAGCTCCTGCCTCCTGCCCAGCCCTGAGATGATATGGATGATCTGAAAGCTTAGCAGCAGAGCTAATCAAAGACCATACGCACATCTACTAAAAGCTTCTTTTGTATGATGAGTAGAGAAATACTCTTATGAGATTCCTGACTGTACCTGCTAGTCAGAGCCACTTGGACAGGAAAGGCGCGTGTC
  5   1   2       bld In60                            IMAGE:8949968.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTTTTTATTAAGATCCCATAAGATTCGTATTCGTCCCCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAGAGAAGCCAGCAAGGAGCCAAAAAAGGAAAGAGAAAGAGAAGCACACCAGCTCCTGCTCCTGCCCCAGCCCTGAGATGATATGGATGATCTGAAAGGCTTAGCAGCGAGCTTAATCAAAGACTCATACGCCCATCTACTTAAGCTCTTTTTGTATTGATGAGTTTAGAGAAATACTCTAATGGAGATCCCTGACTGTTAGCTTCTGCTTTATTTTTCTTGGGGA
  5   1   2       bld Neu  5g                        TNeu140h17.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGGCTCCTCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTAT
  5   1   2       bld HdA  5g3  in                  THdA013i18.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTCCCCGGGCCCGGGGCCCGGGGGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTG
  5   1   2       bld In54                            IMAGE:8840988.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTCTGTTAAATTCAAGGGACAAGTTTTGCCTTCATTATTCGTCCGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTTGCCGAGATGCAGCCCAAGAAAGAAACTTCCAAGAAAGAGAAGCCAGCTAGGATCCAAAAAGAAAAGTAGGAAAAGAAGAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCTGAGGATGATATGGATGAATTCTGAAAAGGCTTTAGCAGCAGAGCCTAATCAATGAAACCTATACGCACATTTTACCTTAAACTCTTTTGTTATGGGATGGATTTAATAAAAAAATACCTTATTGAGGAATCCCTGTCTGGTAGCTCCTGCCTTATTTTCTGGGGTAGATCCACTTTGTAAGAGAGAG
  5   1   2       bld In66                            IMAGE:8966495.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTTTGTTTATGGGATCCAACCCATTTTTAATTCGTGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAGAAAAGGAGGAAAAGAGATGCACACCAGCTCCTGCTCCTGCCCCAGCCCTGAGGATGATATGGATGATCTGAAAGGCTTTAGCAGCAGAGCCTAATCAAAGGACCCATACGCACATCTACTTAAAGCTCTTTTTAATGATGAGTTTAAGAGAAAATACTCTAATGAAGAAACCCTGGCTGTAACTCTGCCTTATTCTGAGCCTTGACAAGAAGCTGTCATCTGTACTGAATACATCCCGAGGACTGAACTACCTATGACCGCACTAATATCCGGTGTGTCCACGGCTCTAGACAAAACTGG
  3   1   2       bld BrSp      in                     EC2BBA34BG08.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGGGCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGAATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGA
  3   1   2       bld BrSp      in                     EC2BBA11DG04.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGGCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTAGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGA
  5   1   2       bld BrSp      in                     EC2BBA34BG08.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGGCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAA
  5   1   2       bld BrSp 5g3  in                     EC2BBA34CE04.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGGCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCA
  3   1   2       bld BrSp      in                      EC2BBA6BF05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGGCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGATATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAA
  5   1   2       bld In54                            IMAGE:8944199.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACCCAATTTATCATGTGAAAAGCGCCTTTAATCCAAAAAAAATTCGTCCCCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAGAAAAGAGGAAAAGAGATGCAACACCAGCTCCTGCTCCTGCCCCAGCCCTGAGGATGATTATGGATGATCTGA
  5   1   2       bld BrSp      in                     EC2BBA11DG04.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTAGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCA
  5   1   2       bld BrSp 5g3  in                     EC2BBA12CF07.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTT
  5   1   2       bld BrSp      in                     EC2BBA19DD09.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGC
  5   1   2       bld BrSp 5g3  in                     EC2BBA20CE01.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTG
  5   1   2       bld BrSp      in                     EC2BBA25AA09.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACCGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTC
  5   1   2       bld BrSp 5g3  in                     EC2BBA31DF06.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAG
  3   1   2       bld BrSp      in                     EC2BBA32AE02.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGGCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGACCACAGAGCAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAG
  5   1   2       bld BrSp      in                      EC2BBA6BF05.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGATATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTA
  3   1   2       bld BrSp      in                      EC2BBA7DE01.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGGCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGA
  5   1   2       bld In54                            IMAGE:8841154.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTTTTTTAAGGGATCCATCGATACGAATTCGTCCCCTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAGAGAAGCCAGCAAAGGAGCCAAAAAAGAAAAGGAGGAAAGAGATGCACACCAGCTCCTGCTCCTGCTCCAGCCCCTGAGATGATATGGATGATCTGAAAATGCTTTAGCAGCGAGCTAATCAAAGACCCATACGCACATCTACTAAGCTCTTTGTAATGGATGATTAGAGAAAAACTCTAATGGAGAATCCTGCCTGTAGCTCTGCTATTCTGGGAGCACTTGG
  5   1   2       bld BrSp      in                     EC2BBA32AE02.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGACCACAGAGCAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGC
  5   1   2       bld BrSp      in                      EC2BBA7DE01.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTC
  3   1   2       bld HeRe                              EC2CAA2CB08.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAG
  5   1   2       bld In62 5g                         IMAGE:8955375.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAGCCAGCAAAGGAGCCAAAATAGAAACGAGGAAAGAGACGCACTCAGCTCTGCTCCTGCCCAGCCCTGAGGATGATTGATGATCTGAAAGCTTATAGCGAGCTAATCAAGGACCTCGCAATCTACTAAGCTCTTTGTATGATGAGTTAAAAAATACTCCATGCACATACCTGCTGAGCTCTGGCTTATTCTGGACTGACAGGAGGTGTCATGTACTGATCATCAGGATTGACACTCGACGATATACAGTGTCCGCTAACTGCCAATGCTTGCAGTCTCTGTTGGAC
  5   1   2       bld Abd0 5g                            IMAGE:7017196                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCAAAGAAAGA
  5   1   2       bld HeRe      in                     EC2CAA21CE09.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGA
  5   1   2       bld HeRe      in                     EC2CAA26CH01.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGTCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGG
  5   1   2       bld HeRe 5g                          EC2CAA32DH10.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCC
  5   1   2   12  bld Tad5 5g3  in                         XZT21389.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGACGCGTGGGCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAGGA
  5   1   2       chi 1030 5x                         IMAGE:7025711.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAACGCATGGGGCTTTTCCCACTCTGGGGGTCATGCAATACAATAAGCAAGGCCCCAAAAAAACCCAGGAGGAGAAAAAAGGGGTGCGCGGGGGTGTTTTAATATTCCCCCCAAGAAAAACCGCGGTTTCTTCCTTGGTGGGCAAAAGAGGCCCACGGCTGAATAAAAACAATAAATTTACTTTGCCTCCCCTTGCTGCGGGACTCAAATAAAACAGGGTGACTGAAAAACCCTTCCTTTTCCCCCCTGTCCAATTTTGGAAAAAAGCTAAAAAGGGTGGGGCTTGGTGAAACCTGAGGTTTAAATCTACCCCGAAACTTCTCCTGGCTTGTGGATTGGGGAAGAAAATCAAATTCTTTTGAGGAACAAAGAATGGGCACCGTTTTTGGAATGTCATAAATAATTTTTCCCGAAAAATGCAGCCCCAAGGAAAAAAAAACCTCTCAATGAAAGAAGAAACCCATCTAAAAGAATCCTCAAATTATGAATAGGGAGGCAATTA
  5   1   2   12  bld Gas7 5g3  in                          XZG3321.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAGCGTGGGCTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTT
  5   1   2   12  bld Tad5 5g3  in                         XZT69419.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCTAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGC
  5   1   2   12  bld Tad5 5g3  in                         XZT39610.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGACGCGTGGGCGGACGCGTGGGCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGGA
  5   1   2   12  bld Tad5 5g3  in                          XZT5461.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTTTTTCTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTA
  5   1   2       bld 1030 5g                         IMAGE:7091836.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAACCAGAATTCCGTGCTGTGTTGGGGAGAATCAAGCTTTGTGACAAGATGGCACATTTGAAGCCTAAAAATTTGCCAAAAGCACCC
  3  -1   2       bld Eye       in                         CCAX4262.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTTACTTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGGTATGTTACAAGTGGTTTGTGACCTGTGTGATCAGACAG
  3  -1   2       bld Eye       in                          CCAX748.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTCTACTCGCGTGAAGATGGTCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGC
  3   1   2       bld BrSp      in                     EC2BBA19DD09.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGA
  5   1   2   12  bld Tad5 5g3  in                         XZT18190.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCACGCGTCCGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCTGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAGGAGGAAAAGAA
  5   1   2       bld 1030 5g                         IMAGE:7092215.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCTACTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTNGGAGA
  5   1   2       bld Abd0 5g                            IMAGE:7017483                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCGGGATGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGA
  5   1   2       bld Tbd0 5g3  in                     NISC_nl01g04.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATCTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTT
  5   1   2       bld Neu  5g                        TNeu039h02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCGGGGGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACTACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTG
  5   1   2       bld In66 5g                         IMAGE:8962500.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACGCGTTGAAGATGGCCGGCGGGACTCTGTCACATTATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAGAAAGAAACTCCCAGAAAGAGAGCAGCAAAGGAGCTAAAAAAGAAGGAGAAAGAGAGCCACACTAGCTCTGCTCTGCTCAGTCCCTGAGATGAATTGATGATCTGAAAGCTTAGCAGCAGCCTAATCAGGACAACGCATCTACTAAGCTCTTGAATGGATGATTAAGAGAAATACTCTTAATGAAGAAT
  3   1   2       bld Neu       in                    TNeu131j02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGNGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAAAAAAAAAAAAAA
  3  -1   2       chi Tbd0 5g   in                       IMAGE:6976796                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACTCTGATAACTGTGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCATGCCACAGAACTAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGGCATTCCCTATGGGAGAGAAGGTCACGCTGGGTGGAAAAAGCAATTGCTTGCCCTCATCTGTGGCTTTATAATCAGTTCTTGGAATTTCCTCCGCCAGCCTTTAGTTATGTTTAAAGGGGGTTGGGACATGAGTGAATTATCCGAATTCCCTTGGTGTTGTCGGGATATTTTATTTTTACCCGCAATATGTATTATTGAATGGTAGAAGATCTGCACAAAAACCCCCTTGAAATATATCTGCAAAGATTATCCCTAAGGGATCAATAATTATGTGAGAAATAAATAGATTCCTATTCCTTGTTATCCATCACTTTTGAAATATCTAAGATGTGAGTATATTCATATCTTA
  5   1   2       chi Tad0 5x                            IMAGE:6983809                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGGAGTTAGGTGCTCTCTTATGTGGCTATATATAGCCGGTCTCGGAAGCATCCTTACGCCGCCCATGAGGTATATGTTACAAGGTGGTCTGTCACTGGTGATATCTTCCAGACCGCTTTATATTATGGCAAAATAAAGGTTAAGCGGACACCCACATGTTGCCCAATTTGTCTGCGCTTCCTTTCTTGGATGCGTATTCGGATCCCCCTTGTTTCTTATCACATAATACCTTAGACCGCTCCCCCCC
  3   1   2       bld BrSp      in                      EC2BBA7BF06.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGGGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAG
  5   1   2       bld TpA  5g3  in                   TTpA009j05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATNCAAGGACCCATACGCACATCTACCTAAAAGCTCTTT
  5   1   2       bld Gas1 5g3  in                     NISC_mq19b05.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAG
  5   1   2       bld Neu0 5g3  in                     NISC_ng10f01.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCTCGTGAAGATGGGCGGTGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGGTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTACGCAAGGCACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGACATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGTCACAGAACGAGCCAAGGAGGAGATAAAGGCTGTGCT
  5   1   2       bld TpA  5g                        TTpA016b03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGANAAGGCTTTAGCAGCAGAGCCTANATCANAGGACCCATACGCACATCTACCTAANAGCTCTTTTGTAATGGATGAGTTTAAGAGAAATAC
  5   1   2       bld BrSp      in                      EC2BBA7BF06.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAA
  5   1   2       bld HdA  5g3  in                   THdA004e01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACTCGCGTGAAGATGGCCGGCGGGACTCTGTACCATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATG
  5   1   2   24  bld Brn4 5g                             CAAL11192.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGA
  5   1   2   12  bld Gas7 5g3  in                         XZG29103.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCACCCAGAATTACGTGGTGTG
  5   1   2   22  bld Gas7 5g                              XZG50902.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGGCACACCAGCTCCTGCTCCCTGCCCAGCCCCTGAGGATGATATGGATGAATCTGANAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAGCTCCTT
  5   1   2   12  bld Gas7 5g3  in                         XZG53347.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAAGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGANAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAG
  5   1   2   12  bld Tad5 5g3  in                         XZT57149.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGANAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGAGAAAATACTCTAATGAGGATACCC
  5   1   2       bld Egg  5g                        TEgg139i08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCAGTGCTGTGTTGGGAGAAGT
  5   1   2       bld Egg  5g                        TEgg139i09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCAGTGCTGTGTTGGGAGAAGTCAA
  5   1   2       bld Gas  5g                        TGas005e05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCGCGTGAAGAGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGC
  5   1   2       bld Neu  5g                        TNeu016b10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCGCGTGAAGAGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGC
  5   1   2   12  bld Tad5 5g3  in                         XZT32681.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGACGCGTGGGGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCAGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCT
  5   1   2   12  bld Tad5 5g3  in                         XZT36482.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAG
  5   1   2   22  bld Tad5 5g                              XZT71795.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGACGCGTGGGGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAG
  5   1   2   10  bld Eye  5g3  in                         CCAX7132.b1 ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCA
  5   1   2       bld Neu       in                   TNeu131j02.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCGCGTGAAGATGGCCGGCGGGACTCTGTCACATACCCTGATCACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAAT
  5   1   2       bld Gas7      in                         XZG40344.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCACCCCA
  5   1   2   12  bld Tad5 5g3  in                         XZT18625.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTTGTA
  5   1   2       bld In62 5g                         IMAGE:8952867.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAGAAAGAAACTCCCAGAAGAGAAGCCAGCAAACGAGCCAAAAAAGAAAGAGAAAGAGATGCACACCAGCTCTGCTCTGCCCAGCCCTGAGATGATATGGATGATCTGAAAGCTTAGCAGCAGAGCCTAAATCAAAGGACCATACGCACATCTACTAAAGCTCTTTTGTATGGAATGAGTCGAGAATACTCTATGAGAATCCCTGGCCTGTAGCTCTGGCCTAT
  5   1   2   10  bld Tail 5g3  in                        CBSW11361.b1 ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAA
  5   1   2   10  bld Tail 5g3  in                         CBSW1196.b1 ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCT
  5   1   2       bld Tad5      in                         XZT17578.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTCGATTCGATTCGTCGACCCACGCGTCCGCGGACGCGTGGGCTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAAGAAGAAGGCAACACCCGCTCCTGCTCCTGCCCCAGCCCCT
  5   1   2   12  bld Tad5 5g3  in                         XZT19830.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATTCAAGGACCCATACGCACATCTACCTAANAGCTCTT
  5   1   2   12  bld Tad5 5g3  in                         XZT32250.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCAGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCA
  3   1   2       bld Thy1      in                        CBST4433.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACGCGTCCGGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGG
  5   1   2   10  bld Tail 5g3  in                        CBSW11821.b1 ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCC
  5   1   2       bld Tbd0 5g3  in                       IMAGE:6977898                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAAGAAAGGGAGAAAAGAAGAAAGCAACACCAGCTCCTGCTCCTGCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAAGCTTTTACAGCAGAGCCCTAATTCAAAGGACCCCTACCCACATCTTACCTAAAAGCTCTTTTTGGAAATGGATGAAGTTTAAGAA
  5   1   2       bld Gas1 5g                            IMAGE:6988650                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGGAGGAAAAGAAGAAGGCNACACCAGGCTCCTGCGTCCTGCCCCAGCCCCCTGAGGATGATATGGGATGAAATCTGGAAAAGGGCTTTTAGCAGCCAGAGCCTTAAATCCAAAGGGACCCAATTACGCAACATTCTATCCCTAAAAGGCTCCTTTTTTGTTAATGGGAAGGAGGTTTTAAAGAAGAAAAATACTCTCTAAATTGAAAGAAATACCCCTGGGGCTGGTAAGCTTCTGTGCGCCTTATTTTTCCTTGGGGGAACCAACTTTTTTGAACAAAGGGAAAGGGCCGTGGGT
  5   1   2       bld Gas1 5g                            IMAGE:6988944                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAANAAAAGAAAAGGAGGAAAAGGAAGAAGGGCAACACAGCTTCCTGCTCCCTGCCCCAGCCCCCTGAGGGATGATTATGGGATGAATCTTGAAAAGGGCTTTAGCAGGCAGAAGCCTTAAATCAAAGGGACCCATTACGCACATTCTACCCTAAAAAGCTCTTTTTGGTATGGGAAGGAGTTTTAAGGAGAAAAATACTCCTAAATGGAGGAAAACCCCTGTCGCGTGGTAGCTTCCTGGCCCCTTAATTTCCTGGGGGAAGCCACTCTTTTGGACCAAGGGA
  5   1   2       bld Neu0 5g3  in                       IMAGE:6991265                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCCTGAGGATGATATGGGATGAATCTTGAAAAGGCTTTAGCAGCAGAGCCTAAATCCAAAGGACCCATACGCACATCTACCCTAAAAAGCTCTTTTTGTAATGGAATGAGTTTTAAGAAA
  5   1   2       bld Neu0 5g                            IMAGE:6991452                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAGAAAAGAGANAAGAGAAGCAACCCAGCTCCGCTCCTGCCCAGCCCTGAGATGAATGGTGATCTGAAAGCTTACACGAGCTAATCAGACATCCCTCTCTAACCTTGTAGAGATAAGAACAGAACTGTGCTCTTTGCTGAAGGCTGGAATCGAATGAATCACACGTCNGAN
  5   1   2       bld Neu0 5g3  in                       IMAGE:6991475                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCANCCCCTGGAGATGATATGGATGAATCTGAAAAAGCTTTTAGCAGCAGAGCCTAAATCAAAAGGACCCATACGCACATCTACCTAAAAGC
  5   1   2       bld Neu0 5g3  in                       IMAGE:6991754                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCANGCTCCTGCTCCTGCCCCAGCCCCTGGAGATGAAATGGGATGAATCTGAAAAAGGCTTTAGCAGCAGAGCCCTAAATCAAAAGGACCCATACNNGCACATCTACCTAAAAAGCTCCTTTTGGTAATGGGATGGAG
  5   1   2       bld Abd0 5g                            IMAGE:7016174                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCA
  5   1   2       bld Neu0 5g3  in                     NISC_ng27b08.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACA
  5   1   2       bld HdA  5g3  in                  THdA016f04.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGAAATGGCCGGCGGGACTCTGTACACATACCNCTGATAACTGGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGAGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGATAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGATNAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCA
  5   1   2       bld Te5       in                         CAAO5458.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTT
  5   1   2   12  bld Tad5 5g3  in                         XZT29750.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCT
  5   1   2   12  bld Tad5 5g3  in                         XZT68593.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGACGCGTGGGCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCAGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCT
  5   1   2   10  bld Thy1 5g3  in                        CBST9492.fwd .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAANAGGA
  5   1   2   10  bld Spl2 5g3  in                        CBSS1003.fwd .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGNGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCCAGCAAGGAGCCAA
  5   1   2   20  bld Spl2 5g                             CBSS6843.fwd .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGAT
  5   1   2       bld Tbd0 5g   in                       IMAGE:6976796                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGTGAAGATGGCCGGCGGGACTCTGTACCATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGGGAGAAAAGAAGAAGGCAACACCAGGCTCCTGCCTCCTGCCCCAGCCCCTGAAGGATGATATGGGATGAAATCTGAAAAAGGCTTTTACCAGCCAGAGCCTAAAA
  5   1   2       bld Gas  5g                        TGas010k01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGTGAAGAGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGC
  5   1   2   12  bld Tad5 5g3  in                         XZT66470.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAGGCTTTAGCAGCAG
  5   1   2   12  bld Tad5 5g3  in                         XZT69429.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCAGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGGAGGANAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCANAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGAGAAATACTCTAATGA
  5   1   2   10  bld Thy1 5g3  in                        CBST1687.fwd ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCA
  5   1   2   10  bld Thy1 5g3  in                        CBST4451.fwd ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAGGAGGAAAAGAAGAAAGGCACACCAGCTCCTGCTCCTGCCC
  5   1   2   20  bld Thy1 5g                             CBST6125.fwd ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCA
  5   1   2   10  bld Spl2 5g3  in                        CBSS1082.fwd ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCAGTGCTGTGTTGNGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAAGGAGGAAA
  5   1   2   10  bld Spl2 5g3  in                        CBSS8600.fwd ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCA
  5   1   2   10  bld Tbd1 5g3  in                        CBXT10102.b1 ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGA
  5   1   2   10  bld Eye  5g3  in                         CCAX9445.b1 ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCA
  5   1   2       bld Brn4      out                       CAAL19394.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGANAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCCTGAGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGT
  5   1   2   14  bld Brn4 5g3  in                        CAAL23208.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGC
  5   1   2   14  bld Brn4 5g3  in                         CAAL7420.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCA
  5   1   2   14  bld Brn4 5g3  in                         CAAL9129.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCT
  5   1   2       bld Te5       in                         CAAO5232.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAANAAAGAAAAGGAGGAAAAGAA
  5   1   2   14  bld Te5  5g3  in                         CAAO9745.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCGTACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGNGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGANAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAANAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCC
  5   1   2       bld In60 5g                         IMAGE:8949880.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAGATGGCACAGTTTGATGCTAAGAGTTTGCCGAGATGCAGCCCAGAAAGAAACTCCCAGAAAGAGAGCCAGCAATGGAGCCAAAAAAGAAAGAGAAAGAGGATGCAACACAGCTCCTGCTCTGCCCAGCCCTGAGATGATTGATGATCTGAAAGCTTAGCAGCAGCTTAATCAAGACCATACCGCCATCTACTAAGCTCTTTGTAATGATGAGTAGAGAAATACCTATTGGAGGTATCCCTGCTGTACTTCGTGCCATATTCTCGATAA
  5   1   2       bld In63 5g                         IMAGE:8957569.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTGATCGGGACGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGATCAGCCAGATTCCGTGCTGTGTGGGAGAAGTCAAGCTTTGTGACAGATGGCAC
  5   1   2   10  bld Tail 5g3  in                          CBSW700.b1 .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCC
  5   1   2       bld TpA       in                   TTpA027d16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCGGGGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCGCAGTCTTCACATCCTAACCTGCAAATGAAACTTAACCGCGGCC
  5   1   2       bld Tad5      in                         XZT66772.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGACGCGTGGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGATAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCT
  5   1   2       bld In62 5g                         IMAGE:8955690.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAGATTGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCTCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAGAAAGGAGAAAGAGACGCACACCAGCTCCTGCTCCTGCCCAGCTCCTGAGATGATATGGATGATCTGAAAGGCTTAGCAGCAGAGCTAAATCAAAGACCCATACGCCCATCTACTAAGCTCTTTTGTATGATGATTAAAAAAAATACTCTATGAAATACCTGCTGATCTGCTTATTGGAGCATTTGAAGAGGTGTCATCTGTCGTGATCAATCCAGACTGACACTTCTGACTGCATATACGAGTCAGCTAAATGCAATGTGCGCCCTGTGCCAAGGACTCTCTCGGTGTGTGGGCCACGTTAAT
  5   1   2   10  bld Bone 5g3  in                        CBTC1801.fwd ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGA
  5   1   2   10  bld Tail 5g3  in                         CBSW6467.b1 ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGA
  5   1   2   10  bld Hrt1 5g3  in                         CAAQ8300.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTANATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAG
  5   1   2   10  bld Spl2 5g3  in                        CBSS3031.fwd .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGNGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGGAAAGAAGAAGGCACACCAGCTCCTGCTCCT
  5   1   2       bld Te5       in                         CAAO7059.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCCTAAAGCTCTTTTGTAATGGATGGAGTTT
  5   1   2   12  bld Tad5 5g3  in                         XZT29145.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTT
  5   1   2   22  bld Tad5 5g                              XZT48566.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCNCAGAAAGAGAAGCCAGCAAAGGAGCC
  5   1   2       bld In54                            IMAGE:8944890.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTATTTTTATTGAGGATTAATAAAATACGAATTCGTCCCGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGATGAAAAGAGACGCACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGATCTGAAAAGCTTAGCAGCGAGCTAATCAAGGACCATACGCCATCTACTAAAGCTCTTTTGTAATGATGATTTAAAGAAAATCCTATGAAGAACCTTGCTGTAGTCTGCTTATTCTGGAACGTTGACAGAAGCTGGTCCCTGGAGCTGAATAATTCTCGGAGAGCGGACGACCTCTGAC
  5   1   2   20  bld Tail 5g                              CBSW3922.b1 ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAG
  5   1   2       bld Neu0 5g                            IMAGE:6992819                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAAGATGATATGGATGAATCTGANAAGGCTTTAGCAGCAGAGCCTANATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGGAAT
  5   1   2       bld TbA       in                   TTbA023j10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGGCGGGACTCGTACACATACCCTGATAACATGGAGGGCATACAAGCCCCTCATTGCCGCTTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTCCTCCAGAAATTTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATCTGAGGGCAACGAACGGTTTTTCGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTTTCAGACAGTCACATGTCCCTCCGGCCAGCGCATGGGTCTTTCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGAATTCTCATCTGAAGACACGGACATTTCCTAGTGGGCGAGAGGGTCACGCTGGCTGAATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTTCCCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAG
  5   1   2   12  bld Tad5 5g3  in                         XZT24579.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAATGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTTATGGATGAGTTTAAGAGAAATACTC
  5   1   2   10  bld Bone 5g3  in                        CBTC5924.fwd ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCAGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAG
  5   1   2   10  bld Thy1 5g3  in                       CBST13238.fwd ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAAGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAA
  5   1   2   10  bld Thy1 5g3  in                        CBST1413.fwd ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGA
  5   1   2   10  bld Thy1 5g3  in                        CBST4857.fwd ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCC
  5   1   2   10  bld Thy1 5g3  in                        CBST8678.fwd ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGG
  5   1   2   10  bld Limb 5g3  in                        CBSU7648.fwd ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCCGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCC
  5   1   2   20  bld Limb 5g                             CBSU8749.fwd ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGA
  5   1   2   10  bld Limb 5g3  in                        CBSU9899.fwd ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGC
  5   1   2   10  bld Tbd1 5g3  in                        CBXT21486.b1 ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAGAGCCAAAAAAGAAAAGAGGAAAAGAAGAAAGCGACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGCT
  5   1   2   10  bld Tbd1 5g3  in                         CBXT4621.b1 ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGA
  5   1   2   10  bld Tbd1 5g3  in                         CBXT7209.b1 ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCTGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGGATGAATCTG
  5   1   2       bld Abd0 5g                            IMAGE:7017045                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGANAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCC
  5   1   2       bld TpA  5g                        TTpA060m18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAG
  5   1   2       bld TbA       in                   TTbA024a02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATAGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCC
  5   1   2       bld TbA  5g3  in                   TTbA036c01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTC
  5   1   2       bld HdA  5g3  in                   THdA032c08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCANCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAA
  5   1   2   10  bld Thy1 5g3  in                        CBST5936.fwd ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCC
  5   1   2   11  bld Thy1 5g3  in                        CBST9489.fwd ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GATGGCCGGCGGGACTCTGTAACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCT
  5   1   2   10  bld Tail 5g3  in                         CBSW3983.b1 ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGA
  5   1   2   10  bld Tail 5g3  in                          CBSW520.b1 ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTC
  5   1   2   10  bld Tail 5g3  in                         CBSW9165.b1 ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCC
  5   1   2   10  bld Te1  5g3  in                        CBWN17302.b1 ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCAGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCA
  5   1   2       bld Brn4      in                         CAAL7422.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGANAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTA
  5   1   2       bld Te5                                   CAAO694.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGA
  5   1   2       bld Met5      in                         CACX1329.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGACAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAG
  5   1   2       bld In60                            IMAGE:8951844.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATCCGTGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAGAGAGCCAGCAAAGGAGCCAAAAAAGAAAGGAGAGAGAGATGCACACCAGCTCTGCTCTGCCCAGCCCTGAGATGATATGGATGATCTGAAAGGCTTAGCAGCGAGCCTAATCAAGGACCATACGCCATCT
  5   1   2       bld Thy1      in                       CBST13321.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCAGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCT
  5   1   2       bld Limb      in                       CBSU10035.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCC
  3   1   2       bld Limb      in                       CBSU10035.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCC
  5   1   2       bld Limb      in                        CBSU9081.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCC
  5   1   2       bld Tail      in                         CBSW9075.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCC
  5   1   2       bld Tbd0                               IMAGE:6980065                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAGGTGGTTTGTGACCTGTGTGAATCACCCAGAATCAGTGCTGTGTTGGGAAAAGTCATGCATTGTGAACAGAATGGCTCGTTTTGATGCTAACAAGTTTGTCTACACGCCTCCTAAAAAATAGCTCTCATCACCCA
  5   1   2       bld Abd0                               IMAGE:7017359                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAA
  5   1   2       bld Abd0                               IMAGE:7017652                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAG
  5   1   2       bld Tbd0      in                     NISC_nl04g03.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTA
  5   1   2       bld Gas7                                 XZG12214.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGANAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGAGGAAAAGAAGAAGGCACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATG
  5   1   2       bld Tad5      in                         XZT26116.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTANNATCAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTA
  5   1   2       bld Tad5      in                         XZT36296.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGGAGGANAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTG
  5   1   2       bld Tad5      in                         XZT47666.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCANAGGACCCATACGCACATCTACCTAAAAGCTCTTT
  5   1   2       bld Tad5      in                         XZT48153.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTA
  5   1   2       bld Tad5      in                         XZT48514.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCA
  5   1   2       bld Tad5      in                         XZT49644.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCAGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCATAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTAC
  5   1   2       bld Tad5      in                         XZT58930.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTT
  5   1   2       bld Tad5      in                         XZT72833.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCT
  5   1   2       bld Bone      in                       CBTC11703.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAG
  5   1   2       bld Thy1      in                        CBST4175.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGC
  5   1   2       bld Thy1      in                        CBST4266.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTG
  5   1   2       bld Thy1      in                        CBST4267.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGA
  5   1   2       bld Thy1      in                        CBST4433.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGG
  5   1   2       bld Thy1      in                        CBST4625.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGAT
  5   1   2       bld Thy1      in                        CBST4710.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGA
  5   1   2       bld Thy1      in                        CBST4729.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCT
  5   1   2       bld Thy1      in                        CBST5471.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGA
  5   1   2       bld Thy1      in                        CBST9133.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCTTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAG
  5   1   2       bld Limb      in                        CBSU4983.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGT
  5   1   2       bld Limb      in                        CBSU9223.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAG
  5   1   2       bld Limb      in                        CBSU9717.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCC
  5   1   2       bld Spl2      in                        CBSS2355.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGNGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCA
  3   1   2       bld Spl2      in                        CBSS2355.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCC
  5   1   2       bld Spl2      in                        CBSS4861.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCNCAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAGAAGAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATC
  5   1   2       bld Spl2      in                        CBSS7205.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGGA
  5   1   2       bld Tail      in                        CBSW12100.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCAGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCT
  5   1   2       bld Tail      in                         CBSW2967.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAG
  5   1   2       bld Tail      in                         CBSW5264.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAANA
  5   1   2       bld Tail      in                         CBSW6683.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAANGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCT
  5   1   2       bld Te1       in                         CBWN6441.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAA
  5   1   2       bld Te1       in                         CBWN7904.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGNGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAA
  5   1   2       bld Tbd1      in                        CBXT13492.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAAAAAAAAA
  3   1   2       bld Tbd1      in                        CBXT13492.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAAAAAAAAA
  5   1   2       bld Tbd1      in                        CBXT13759.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCCTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAGAAAAGGAGGAAAAG
  5   1   2       bld Neu0      in                     NISC_ng07d03.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCA
  5   1   2       bld TpA       in                   TTpA025h03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGGCGGGACTCTGTACACTTACCCTGTATACTGGAGGGCATACGAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGGTGCCTCCTCTCCTCCAGAATTCCTGTTTGGAGTAACGAATAAGACATCCCGACTTCCTATAGAAATTCCCCTTATGCAAGGTACCAGCATTTGAGGGCAACGACAGTTTTTGCCTTTTTGAGAGCAGCACCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACGCCAAGCTCTCGTCATCCAGTGGGTCAACTTCTCAAACTGTCACATTGTCCCTCCCGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCATTACCATAAGCAGGCCACAGAACTTGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCTTCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGCGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGC
  3   1   2       bld HeRe      in                     EC2CAA26CH01.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGTCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGA
  5   1   2       bld TbA       in                   TTbA040n21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGANNAGGCTTTAGCAGC
  5   1   2       bld HdA       in                   THdA053a01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGANAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGAGAAATACTCTAATGAAGATACCCTGGCTGTAGCTCTGCCTTATTTC
  5   1   2       bld Brn4      in                        CAAL11282.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATG
  5   1   2       bld Te5       ?                          CAAO4557.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTANATCANAGGACCCATACGCACATCTACCTAAAAGCTC
  5   1   2       bld Ovi1      in                         CABI6602.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATCGATTCGCTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCANAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGAGAAAATACTCTAATGAGGATACCCTGGCTGTAGCTCTGCCTTATTTCTGGGAGCACTTTG
  5   1   2       bld Tad5      in                         XZT13691.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTC
  5   1   2       bld Tad5      in                         XZT22746.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAG
  5   1   2       bld Tad5      in                         XZT48725.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCAGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAAGAG
  5   1   2       bld Tad5      in                         XZT48848.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGAATGAGTT
  5   1   2       bld Tad5                                 XZT58697.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAG
  5   1   2       bld Tad5      in                         XZT66654.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCAGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGANAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTC
  5   1   2       bld Tad5      in                         XZT69459.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAAATCT
  5   1   2       bld In66                            IMAGE:8962809.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGAGTGAATTTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCTCAAGAAAGAAACTCCCAGAAGAGAAGCCAGCAAGGAGCCAAAAAAGAAAGGAGAAAGAGAGGCACACCAGCTCTGCTCTGCCTCAGCCCTGAGATGATATGGATGATCTGAAAGCTTAGCAGCGAGCTAATCAAGGACCTACGCATTACTAAGCTCTTTTGTATGATGAGTTAGAGAAAATACTCTATTGAGGATACCTGGGCTGTACTTTGCT
  5   1   2       bld Thy1      in                        CBST5440.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCAGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGA
  5   1   2       bld Limb      in                        CBSU4752.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAA
  5   1   2       bld Spl2      in                        CBSS1524.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAA
  5   1   2       bld Spl2      in                        CBSS2160.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAA
  5   1   2       bld Spl2      in                        CBSS3696.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAANGCAACACCAGCTCCTGCTACTGCCCCAGCCCCTGAGGATGATATGGATGAATC
  5   1   2       bld Spl2      in                        CBSS8958.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAA
  5   1   2       bld Tail      in                         CBSW4470.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCA
  5   1   2       bld Tail      in                         CBSW4511.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGCCGGCGGGACTCTGTAACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCAGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGA
  5   1   2       bld Tail      in                         CBSW7853.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGNGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCC
  5   1   2       bld Te1       in                        CBWN12815.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGGTTTGTGACCTGTGTGAATCAGCCAGAATTCAGTGCTGTGGTG
  5   1   2       bld TpA       in                   TTpA002n17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGANAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGGAGATGATATGGATGAATCTNGAAAGGCTTTAGCAGCA
  5   1   2       bld TpA       in                   TTpA012i19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCC
  5   1   2       bld Neu                            TNeu009b05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 NAATCCCCGGGCCTGTACACATACCCTGNTAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTGCTCTCCTGCAGATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTGCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGGTTCTGAGACAGTGACATTGTGCCTGCGGGCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCGGTACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTGTAGATTCTGATCTGAAGACACGGACATTGCTAGTGGGCGAGAGGGTCACGCTGGCTGA
  5   1   2       bld TpA       in                   TTpA033b04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGTCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGANAAGGCTTTAGCAGCAGAGCCCTAATCANAGGACCCATACGCACATCTACCCTAAAGCTCTTTTGTAATGGGATGAGTTTAGAGAAAATACTCTA
  5   1   2       bld TpA       in                   TTpA062f05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAGAAGAAGAAAGGCACACCAGCTCCTGCTCCCTGCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCCTAATCANAGGACCCATACGCACATCTACCTAAAAGCT
  5   1   2       bld TbA       in                   TTbA047b11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGGTGGTTTGGTGACCTGGTGTGAATCAGCCAGAATTCCGTGCTGTGTTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCA
  5   1   2       bld Brn4      in                        CAAL18525.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGANAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGC
  5   1   2       bld Te5       in                         CAAO8029.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGGACCCATACGCACATCTACCTAAAAGCT
  5   1   2       bld In62                            IMAGE:8954161.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGGAACTCTTGTTACACATTTTTCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCTAGAAGAGAAGCCAGCAAGGAGCCAAAAAAGAAAAGGAGGATAGAGACGCACACAGCTCTGCTCCTGCCCAGCCCTGAGATGATATGGATGATCTGAAAAGCTTAGCAGCAGAGCTAATCCAAGGACCATACGCACATCTTACTTAAAA
  5   1   2       bld In62                            IMAGE:8954375.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCTCAAGAAAGAAACTCCCAGAAGAGAAGCCAGCAAAGGAGCCAAAAAAGAAAAGGAGAAAGAGTGCACACAGCTTCTGCTCTGCTCAGCTCCTGAGATGATATGATGATCTGAAGGCTTAGCAGCGAGCTAATCAAGACCATACGCCATCTACTAAAGCTTTTTTGTATGATGATTAGAGAAATACTCTATGAATCTGCTGAGCTGCTTATTCGGACATTGACAGAGCTGTCATCTGTCGTGAATACATTCCAGAACTGACACACCTTTCTGA
  5   1   2       bld Limb      in                         CBSU864.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCT
  5   1   2       bld Spl2      in                        CBSS6134.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAA
  5   1   2       bld Neu       in                   TNeu065b03.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCGGCGGGACTCTGTCACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTT
  5   1   2       bld Neu       in                   TNeu089j08.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCTACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGGTGGTTTGTGACCTGTGTGAATC
  5   1   2       chi TpA       out                  TTpA059m11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAAAAACAAAACAAAAAATAAAGACCAATTGCAAACCCCTTTCTGAATAATTTGCCTTCTTCTTCTTCTGCTTCTTTCAAGCTCTCAAAGAGGGTGGGGGTCGTTGACCCCAGCAACACTTCTTTAGCTATTCAATCCCCCTACTGTTAATATTCCAGGCTTTTGTTAAAACCACTGGTTGCAAAGGTAAAAAAAGGCCCTAGCAACGAGATAGTTACTGAAATTCCAAACTGAAGattcagcagctaatctgcccatgtatgggcactaccgacgggcctgcccgactgacatctggcctgaaatcggccagatatcgatcgggcaggttaaaaaatcgtcggatcggggaccgaatcggcttgttgatgcggtccctggaccaactttgcctatacccgccgttataattcgatcgtttggccccacgatctaattagcctgaattctcccgatattgcccacccgtaggtggaggatatcgggagaaTATACGCTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCATAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGACAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTG
  5   1   2       bld HdA       in                   THdA020h14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCGGCGGGACTCTGTACCATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAGTTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAATAGGAGGAGAAGAAGAAGGCAACACCTGCTCCTGCTCCTGCCCCAGCCTCTGAGGATGATATGGATGAATC
  5   1   2       bld Met5      in                          CACX708.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTANATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTT
  5   1   2       bld Gas7                                  XZG8977.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCGGCGGGACTCTGTACCATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAG
  5   1   2       bld Tad5      in                         XZT18306.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGANAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCATACGCACATCTACCTAAAAGCTCTTT
  5   1   2       bld In62                            IMAGE:8955592.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCTCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAGAAAGGAGGAAAGAGAGGCAACACCAGCTCTGCTCCTGCCCCAGCTCCTGAGATGATATGGATGAATCTGAAAGGCTTTAGCAGCAGAGCTAATCAAGGACCATACGCCATCTACTTAAGCTCTTTTTATGATGATTAGAGAAATACTCTATGAGATACCTGGCTGTAGCTCGCTTATTCTGGAACACTTGACAGGAGCTGTCATCTGTACCTGATACAATTCCCGAGGACGGACACTCTGACTGACTATACGAGTTCAGGCTGACACTGCAGTGTTGCCGCCTTTGTGCACATGAGCTTCTCGGGGTGGGTCGGGCA
  5   1   2       bld In62                            IMAGE:8955883.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTGTGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCTATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAGAGAAGCCAGCAAGGAGCCAAAAAAGAAAGGAGAAAGAGATGCACACTAGCTCTGCTCCTGCTCTAGCCCTGAGATGATATGGATGATCTGAAAGCTTTAGCAGCAAAGCTAATCAAGACCTTACGTCATCTACTAAAGCTCTTTTTGAATGATGAGTAGAAACTCTATGGAGATCTGCTGATCTTGCTATTTCTGAGCATTGACAGGAGGGCTGTTCAC
  5   1   2       bld In66                            IMAGE:8967232.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGGAACTTCTAGTACACATACCCTAGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAGAGAAGCCAGCAAGGAGCCAAAAAAGAAAGGAGGAAAGAGAGGCACACCAGCTCCTGCTCTGCCCAGCCCTGAGATGATATGGATGATCTGAAAGCTTAGCAGCAGAGCTAAATCAAGACCATACGCACATCTACTAAGCTCTTTGTATGATGATTAGAGAAAATACTCTAATGAGAAACCTTGCCTGTAGTCTTGC
  5   1   2       bld Tad5      in                         XZT44969.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCT
  5   1   2       bld Tad5      in                         XZT48616.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGTTGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAANAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCT
  5   1   2       bld Thy1      in                        CBST9402.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCA
  5   1   2       bld Limb      in                        CBSU4436.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGA
  5   1   2       bld Tail      in                         CBSW3130.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGC
  5   1   2       bld Tail      in                         CBSW9167.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAG
  5   1   2       bld TpA       in                  TTpA022b09.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCACCCCTGAGGGATGATATGGGATGAATCTGAAAAGGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCT
  5   1   2       bld Tbd0      in                     NISC_nl21f05.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTA
  5   1   2       bld TpA       in                   TTpA059m10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAAATCTGAAAGGCTTTAGCAGCAGAGCCTANATCANAGGACCCATACGCACATCTACC
  5   1   2       bld Brn4      in                        CAAL18546.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATG
  5   1   2       bld Met5      in                         CACX1517.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAG
  5   1   2       bld Tad5      in                         XZT65660.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCAGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAA
  5   1   2       bld Tad5      in                         XZT72924.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAANATCAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAG
  5   1   2       bld Limb                                CBSU9256.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGA
  5   1   2       bld Tail      in                        CBSW10026.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCGGGACTCTGTATACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGNGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTC
  5   1   2       bld Tail      in                         CBSW4759.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATG
  5   1   2       bld Tbd1      in                        CBXT10148.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCTGAGGATGATATGGATGAATCTGAAAAGGCTT
  5   1   2       bld Tbd0      in                       IMAGE:6976777                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGACTCTGTACACATACCCTGATAACTGGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAANAGGGAGAAAAGAAGAAGGCACACCAGCTCCTGCTCCTGCCCAGCCCCTGGAGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATCCGCACATCTACTTAAAAGCTCTTTTTGGTAATGGATGAGTTTAAAGAGAAAATACTCTTATGGAGAATACCCTTGGGCTGTAGCTCTTGCCTTAATTTCTGGGGAGCATCTTTTGAAAAAGGAAAGGCCGGGCTCCATTCTGGGTACGCCGGAAATACAAAATTTCCCCCGAAGGGAGACTGGCCACAAAC
  5   1   2       bld TpA       in                   TTpA029n19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAGACTCCCAAGACAGAGAAGCCAGCATAGGAGCCAAAAAAAGAAAAGGAGGATAAGAAGAAAGGCACACCAGCTCCTGCTCCTGCCNCAGCCCCTGAGGATGATATGGATGAATC
  5   1   2       bld TpA       in                   TTpA053b09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAA
  5   1   2       bld TpA       in                   TTpA057i02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGANAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTANATCAAAGGACCCATACGCACATCTACCTAAAGCTCTTTTGTAATGGATGAGTTTA
  5   1   2       bld TbA       in                   TTbA029k17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGGACTCTGTACACATACCCTGATCACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCT
  5   1   2       bld Brn4      ?                         CAAL19345.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGGACCATACGCACATCTA
  5   1   2       bld Te5       in                         CAAO2910.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCT
  5   1   2       bld Te5       in                         CAAO5517.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGANNAGGCTTTAGCAGCA
  5   1   2       bld Ovi1      in                        CABI10429.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATG
  5   1   2       bld Met5      in                          CACX714.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCT
  5   1   2       bld Spl2      in                        CBSS9482.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGA
  5   1   2       bld Tail      in                         CBSW4141.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGC
  5   1   2       bld Tail      in                         CBSW9449.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAA
  5   1   2       bld Te1       in                         CBWN9605.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGA
  5   1   2       bld Te1       in                         CBWN9902.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGA
  5   1   2       bld TpA       in                   TTpA009l16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGGACTCTGTACACATACCCTGATTTTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGATAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTT
  5   1   2       bld Gas1 FLt5 in                       IMAGE:6981438                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGGACTCTGTACACATACCCTGATAACTGGAGGGATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCCAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGGAAAAGAAGAAGGCAACACCAGCTCCCTGCTCCTGGCCCAGCCCCCTGGAGGATGATATTGGATGAAATCTTGAAAAGGCTTTTAGCAGCAGAAGCCTAAAATCAAAGGGACCCCATACGGCACAATCTACCCTAAAAAGCTCTTTTTTGTAA
  5   1   2       bld Abd0      in                       IMAGE:7000181                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGACTCTGTACACATACCCTGATAACTGGTAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCNAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAGAAAAGGAGGAAAAGAANGAAGGCACACCAGCTCCTGCTCCTGCCCAGCCCCTGAGGATGATATGATGATCTGAAAGGCTT
  5   1   2       bld Abd0                               IMAGE:7016018                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGGACTCTGTACCATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTG
  5   1   2       bld Gas                            TGas009j19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGNACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCT
  5   1   2       bld In62                            IMAGE:8955576.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCTCAAGAAAGAAACTCTCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAGAAAAGGAGAAAGAGCGCACACCAGCTCCTGCTCCTGCTCCAGCCCTGAGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCGAGCCTAAATCAAAGACCCATACGCCCATTCTACTTAAAGCTCTTTTTATGATGAGTTAAAAGAAATACTCTAATGAGATACCCTGCTGTAGCTCTGCTTTTTTCGGAGACATTGAAAGAAGCTGTCATCTGTACCTGAATCATCCGAGGACTGAACAACTTCTGACGCCTATACGATGTCAGGCTGACACTGCAACGGTGACGCATCTTGTTGACATGGAGCTCTATTCTCGGTGTGGG
  5   1   2       bld Thy1      in                        CBST8392.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCTCAAGANAGAGAAGCCAGCANAGGAGCCAAAA
  5   1   2       bld Ova1      in                        CABE13103.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGAGGTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAG
  5   1   2       bld Tad0                               IMAGE:6985807                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCTGTACACATACCCNTGATAACTGGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCCAGCAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAA
  3   1   2       bld BrSp      in                     EC2BBA25AA09.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGACACAGTTTGATGCTAAGAAGTTTGCCGAGA
  5   1   2       bld Lun1      in                         CABD2055.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGATAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGANAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGT
  5   1   2       bld HdA       in                   THdA011p06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATCTGTACCATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTC
  5   1   2       bld Ovi1      in                         CABI1140.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTA
  5   1   2       bld TpA       in                  TTpA048l14.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GACTCTGTACCATACCCTGAGTACTGGAGGGCATCAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCGTCAAGGGTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGGGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGGGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCA
  5   1   2       bld Eye                                  CCAX3519.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTTGCCTTTTTTGAA
  3   1   2       bld Bone      in                       CBTC11703.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCC
  5   1   2       bld Limb      in                        CBSU3027.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAA
  3   1   2       bld BrSp      in                     EC2BBA23AB02.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGA
  5   1   2       bld Spl2      in                        CBSS4419.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTT
  5   1   2       bld Tail      in                         CBSW5871.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAAGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGG
  5   1   2       bld BrSp      in                     EC2BBA23AB02.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGC
  5   1   2       bld Limb      in                        CBSU4506.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGTAACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAA
  5   1   2       bld Spl2      in                        CBSS5407.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCCGCACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGAT
  5   1   2       bld Spl2      in                        CBSS7441.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGG
  5   1   2       bld Tail      in                         CBSW1396.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCCGCACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGC
  5   1   2       bld Gas7      in                         XZG62038.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCTCCTGAGGATGATATGGATGAATCTG
  5   1   2       bld Tad5      in                         XZT22899.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTA
  5   1   2       bld Tad5      in                         XZT51597.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCAGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGATCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTT
  5   1   2       bld Limb      in                        CBSU1520.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTT
  5   1   2       bld Tail      in                         CBSW4396.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGA
  5   1   2       bld Te1       in                         CBWN6964.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGA
  5   1   2       bld Te5       in                        CAAO10909.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTT
  5   1   2       bld Te5       in                         CAAO4102.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGGAGGANAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGANAAGGCTTTAGCAGCAG
  5   1   2       bld Lun1      in                         CABD9187.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAA
  5   1   2       chi In54                            IMAGE:8945273.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCTGAGATGCAGCCCAAGAAGAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAGAAACGAAGAAAAGAAGACGGCACACCACTTCTGCTCTGCCAAGCCCTGAGATGAATTGATTGATCTGAAAGGCTTTAGCAGCGAGCTAGTCTAGGACTAACGACATCTACATAGGTTCTTGTATTGGAGAGCTTAAGAGAATACTACTGAGATCCTGCTGTAGCTCGTCCTTATTTTGGTAGACTATGTA
  5   1   2       bld In54                            IMAGE:8946628.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAGATAGGAGGAAAGATGAGGCAACACCAGCTCCTGCTCCTGCCCAGCCCTGAGATGATATGGATGAATCTGAAAGGCTTTAGCAGCGAGCTAAATCAAAGGACCCATTACGCACCATCTAACCTAAAAGCTTCTTTTGGTATTGGGAGTGAAGTTTA
  5   1   2       bld Ovi1      in                         CABI5550.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGAGAAAATACTCTAATGAGGATACCCTGGCTGTAGCTCTGCCTTATTT
  5   1   2       bld Ski1      in                        CABJ12108.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCAATTCGGCACGAGGCTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCANAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGAGAAAATACTCTAATGAGGATACCCTGGCTGTAGCTCTGCCTTATTCTGGGAGCACTTTTGACAGGAAGGCTGGTCCATCTG
  5   1   2       bld Tad5      in                          XZT4178.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGAGAAAATACTCTAATGAAGATACCCTGGCTGTAGCTCTGCCCTTATTTCGGG
  5   1   2       bld In62                            IMAGE:8955378.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCTCAAGAAAGAAACTCTCAAGAAAGAGAAGCTAGCAAAGGAGCTCAAAAAAGAAAAGGAGGAAAAGAGCGCAACACCAGCTCCTGCTCCTGCTTCAGTCTCTGAGGATGATATGGATGATCTGAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACTCATACGCCCATCTACTAAAGCTCTTTTGTATGATGAGTTTAGAGAAATACTCTATGAAAACCCTGCTGTACTCTGCTTATTCTGGGAGCACTTTGACAGAGCTGGTCCTCTGTACCTGAATCAATCCCGAGGACTGAACAACTTCTGACTGCACTATCGAAGTCCAGGTAACTGCGACTGCTGCCAGCTTCTGTGACAATGAACTACTCGTG
  5   1   2       bld Thy1      in                       CBST13076.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGATAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGA
  5   1   2       bld TpA       in                   TTpA020b06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCCGGGCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGANAAGGCTTTAGCAGCAGAGCCTAAATCANAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTNNAGAGAAATACTCTAATGAAGATACCCTGGCTGTAGCTCTGCCTTAT
  5   1   2       bld Te5       in                         CAAO1981.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCANAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTA
  5   1   2       bld Tad5      in                         XZT26749.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCC
  5   1   2       bld Tad5      in                         XZT32862.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTG
  5   1   2       bld Tad5                                 XZT57762.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCTATCGTTTACACCAAGCTCAGGTCATCCCGTGGGTCAGCTTCTCAGACAGTCACA
  5   1   2       bld Thy1      in                        CBST6223.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACAC
  5   1   2       bld Thy1      in                        CBST8190.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAA
  5   1   2       bld Spl2      in                        CBSS2100.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGA
  5   1   2       bld Te1       in                        CBWN12102.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGA
  5   1   2       bld Tbd1      in                        CBXT18227.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCA
  5   1   2       bld Te5       in                        CAAO11168.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGANAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTT
  5   1   2       bld Spl1      in                         CABK9790.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATCCATCGATTGAATTCGGCCGAGGTAAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCT
  5   1   2       bld Tad5      in                         XZT10151.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAAGAAAAGGAGGAAAAGAA
  5   1   2       bld Tad5      in                          XZT1285.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAA
  5   1   2       bld Tad5      in                          XZT3807.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCT
  5   1   2       bld Tad5      in                           XZT466.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGG
  3  -1   2       chi Abd0      in                       IMAGE:6999218                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTACCCTGATAACTGGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACCTGCTCTCTTCTGTGGCTCTATAAGCAGGTTCTGGGAACATCCCTCCCCCCACCCTTTGGTAATGATACAGGGGGGTTTGGGACCGTGGGAATCCCCCCAAAATTCCCGGCTGGGTTGGGAAAAAATAACCTTTTTGGAAAAAAGGGGCCCTTTTTGTGGCCAAAAAATTTTCCCCAAGAATCCCCCCCCAAAAAAAAAAACCCCTCAAAGAAAAAAAGCCCCCCCGGAGGGGCCAAA
  5   1   2       bld Liv1      in                         CAAR2633.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATCGATTCAATTCGGCCGAGGATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTTAGAGAAAATACTCTAATGAGGATACCCTGGCTGTAGCTCTGCCCTATTTCTGGGAGCACTTTGACAGGAAAGGCTGGTCCATC
  5   1   2       bld Tad5      in                         XZT10808.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGGAGGANAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCNCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCANAGGACCCATACGCACATCTACCTAAAAGCTC
  5   1   2       bld Tad5      in                         XZT10960.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCAGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTT
  5   1   2       bld Tad5      in                          XZT6724.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCT
  5   1   2       bld Lun1      in                        CABD11516.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCGAGGTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTTA
  5   1   2       bld Mus1      in                         CABH5137.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATCGGCACGAGGCTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGANAAGGCTTTAGCAGCAGAGCCTAAATCANAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGAGAAAATACTCTAATGAGG
  5   1   2       bld Tad5      in                          XZT7346.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCAGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCANAGGACCCATACGCACATCTACCTAANAGCTCTTTTGTAATGGATGAGTTTA
  5   1   2       bld In66                            IMAGE:8965849.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACCCTGGATAACTGGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCTGAGATGCAGTCTCAAGAAAGAAACTCTTAGAAGAGATGCTCAGCTAAAGGAGTTAAAAAAGATAGAGAAAGAGATGCACACCAGCTCTGCTCTGCTTCAGCCCTGAGATGATATGGATGATCTGAAAGCTTAGCAGCTGAGCTAATCAGAATCGATACGTCCATCTAACTTAAGCTCTTTTGTATGGATGATTAGAGAAAAATACTCCAATGAAAATCCTTGGGCGTGACTCCTC
  5   1   2       bld In66                            IMAGE:8966113.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCTTGAATAACTGGAAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAGTTTGCCGAGATGCAGCCCAAGAAGAAACTCCCAAGAAGAGAGCCAGCATAGGAGTCAAAAAAGAATGGAGGATAGAAGAGGCAACACCAGCTCCTGCTCTGCCCAGCCCTTGAGATGATATGATGATTCTGAATGCTTAGCAGCGAGCTTAATCAAGGACCCATACGCCATTCTACCTAAAGCTCTTTGGATGATGACTCAAGAAATACCTAATGGAGAATTCTTGCTGTAGCTCTGCCTTAT
  5   1   2       bld Tbd1      in                        CBXT21352.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAG
  5   1   2       bld Gas7      in                          XZG3638.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TACCCTGATACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGAGAAAATACTCTAATGAGG
  5   1   2       bld Lun1      in                         CABD6690.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAAGAAGAGAAGCCAGCA
  5   1   2       bld In66                            IMAGE:8962893.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAATAAACTAGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTTTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCCTTCCGCCAGCCATTTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCTCTAGAAGAACTCCCAGAAAGAGAGCTAGCAAGGAGCTAAAAAGACATGAAGAAGAGATGCAACACTAGCTCTGCTCTGCCCAGCCCTGAAGATGATTGGATGATCTGAAAGCTTAGCAGCAAGCTAGTCAGACCGTACGCCATCTACCTAAGCTCTTTTGTATGGCATGGATTTAGGAGCAC
  5   1   2       chi Tad5      in                          XZT5840.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTATGAACCTCGTTGaatcctattgtttcttcctccacatctgccatttcacccctgaatgttagtggcggattGGAACGATCGCACAAAAGATCAAAAATCGCCACGTGTGTGGCCACCTTTAGACTTGTCACATATGTCTCATACTTTCTCTGACTTGGTGTTAATAGGAAACCTAATTCTCACCTCTCACATATTTCTCTGACAGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCAGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCA
  5   1   2       bld Hrt1      in                        CAAQ12962.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCAATTCGGCACGAGGTACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAANAGCTCTTTTGTAATGGATGAGTTTA
  5   1   2       bld Lun1      in                         CABD7880.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAATTCGGCACGAGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGANAAGGCTTTAGCAGCAGAGCCTANATCANAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTTAG
  5   1   2       bld Ski1      in                         CABJ1314.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCAATTCGGCACGAGGATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGA
  3   1   2       bld Limb      in                        CBSU4506.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCC
  5   1   2       bld Abd0      in                     IMAGE:6998924.b                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGANCAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCANGAAAGAAACTCCCCAGAAAGAGGAGCCCGCAAAGGAGCCAAAAAAGAAAGGGAGAAAAGAGAGGCACNCNNCTCTGCTCTGCCCAGCCCTGAGATGATTGGTGATCTGAAAGCTTTACACAAGCTATCAAGGACTTCCCCTCC
  5   1   2       bld Int1      in                         CAAP6160.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCGCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAG
  5   1   2       bld Lun1      in                        CABD14763.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCAATTCGGCACGAGGTACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTANATCANAGGACCCATACGCACATCTACCTAANAGCTCTTTTGTAATGGATGAGTTTA
  5   1   2       bld Spl1      in                          CABK856.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCANAGGACCCATACGCACATCT
  3   1   2       bld HeRe      in                     EC2CAA21CE09.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAA
  5   1   2       bld Lun1      in                         CABD6738.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGATTCGGCACGAGGTACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTT
  5   1   2       bld Ski1      in                          CABJ621.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATAACTGGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCCTAATCANAGGACCCATACGCACATCTACCTAAAAGCTCTTTTTGTATGGATGAGTT
  5   1   2       bld Spl2      in                        CBSS2230.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTG
  5   1   2       bld Tbd1      in                          CBXT717.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCTGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCTTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGA
  5   1   2       bld TpA       in                   TTpA066h10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGANAAGGCTTTAGCAGCAGAGCCTNAATCAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATG
  5   1   2       bld Ski1      in                         CABJ9747.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATCGGCACGAGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGANAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGA
  5   1   2       bld Spl1      in                        CABK10680.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGCACGAGGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGANAAGGCTTTAGCAGCAGAGCCTANATCANAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGAGAAAATACTCTAATGAAGATACCCTGGCTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGAC
  5   1   2       bld Tad5      in                          XZT9414.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAANAGCTCTTTTGTAATGGATGAGTTTAAGAGAAATACTCTAATGAGGATACCCTGGCTGTAGCTCTGCCTTATTTCT
  5   1   2       bld Liv1      in                        CAAR10617.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGAGGGGAGGGCATACAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCNAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGAGAAAATACTCTAATGAGGATACCCTGGCTGTAGCTCTGCCTTATTTCT
  5   1   2       bld In62                            IMAGE:8954609.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTGTGATGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAGAAAAGGAGGAAAAGAGATGCACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGATGATATGGATGATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAGACCATACGCACATCTACTAAAGCTCTTTTGTTATGATGGAGTTTAAGAGAAAATACTCTTATGGAGGATACCTTGCCTGTAGCCTTCTGTCCCTAA
  5   1   2       bld Abd0                               IMAGE:7016363                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCCAGCAAGGAGCCAAAANAAGAAAAGGAGGAAAAGAAGAAGGCACACCAGCTCCTGCTCCTGCCCAGCCCCTGAGGATGATATGGATGAATCTN
  3  -1   2       bld Lun1      in                         CABD8231.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCCAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAG
  5   1   2       bld Tad5                                  XZT9851.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCAAAAAAAGAAAAGGAGGANAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGA
  5   1   2       bld Ovi1      in                         CABI8470.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTCCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAANAGCTCTTTTGTAATGGATGAGTTTAAGAGAAAATACTCTAATGAGGATACCCTGGCTGTAGCTCTGCCCTTATTCTGGGAGCACTTTGA
  5   1   2       bld Tad5      in                         XZT57130.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGANAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGA
  5   1   2       bld Thy1      in                        CBST8694.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTT
  5   1   2       bld Sto1      in                         CABG5663.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCATCGATTCGCAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGAGAAAATACTCTAATGAGGATACCCTGGCTGTAGCTCTGCCTTAT
  5   1   2       bld Spl1      in                         CABK6185.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCATCGATTCACAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTG
  5   1   2       bld Thy1      in                       CBST12759.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAG
  5   1   2       bld Tail      in                        CBSW11457.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATC
  5   1   2       bld Lun1      in                        CABD13700.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCGAGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCANAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGAGAAAATACTCTAATGAGGATACCCTGGCTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGAC
  3  -1   2       bld Lun1      in                         CABD8313.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGANAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGA
  5   1   2       bld Tad5      in                         XZT71285.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGANAAGGCTTTAGCAGCAGAGCCTANATCANAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGAGAAAATACTCTAATGAAGATACCC
  5   1   2       bld In62                            IMAGE:8955116.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAGAACTCCCAAGAAGAGAAGCCAGCAAAGGAGCCAAAAAAGAAAGGAGGAAAGAGAGGCACACCAGCTCCTGCTCTGCCCAGCTCCTGAGATGATATGGATGATCTGAAAGGCTTAGCAGCGAGCTAATCAAAGACCCATACGCACATCTACTAAGCTCTTTTGTATGATGAGTTAAGAGAAATACTCTATGAAGACCTGCTGTAGCTCTGCTTATTCGGAGCACTTGACAGAGCTGTCTATCTGTACGCTGAACATCCCGAGGACTGACACTTCTGACTGATATTACGGTATGTTCACGCTACACCTGCACGCTGCCGTCACTTGTGACAATGAGCTCACTCGTGTTTTCGCAAACTTACCG
  5   1   2       bld Spl2      in                        CBSS1532.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTG
  5   1   2       bld Te1       in                         CBWN4971.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGA
  5   1   2       bld Te1       in                         CBWN5900.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAA
  5   1   2       bld Eye       in                         CCAX7669.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAGCCAGCAAAGGAGCCAAAAAAGAAAGGAGG
  5   1   2       bld Tbd0                               IMAGE:6976247                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGAGGGCATACAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGGAAGAAAAGAAGAAGGCAACACCANGCTCCTGCTCCTGCCCCAGCCCCCTGAAGATGATATGGGATGAAATCTGGAAAAGGGCTTTAGCAGCAGGAGCCCTAAATCAAAGGGACCCCATAACGCACATTCTACCCTAAAAAGCTCTTTTTGTTAATGGAATGAAGTTTAAAGAGAAAAAA
  5   1   2       bld Liv1      in                        CAAR13242.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCGAGGCATACAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGANAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCT
  5   1   2       bld Ovi1      in                         CABI6541.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCANAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGAGAAAATACTCTAATGAAGATACCCTGGCTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGT
  5   1   2       bld Ski1      in                        CABJ11806.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGANAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTA
  5   1   2       bld Gas7      in                          XZG1263.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGTATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAAGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAA
  5   1   2       bld Thy1      in                       CBST13229.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGAGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGATAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTT
  5   1   2       bld TpA                            TTpA062i23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTAGTGTCGACGCGGCCGCTGTTGCTCTTTTTTCTTGGGTACCGCATCAAGGTTGCCTCCTCGCCTCCAGAGTTCCAGTTTGGAGTAGCGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTATGCAAGGTACCATCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAGGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACGGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACATAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGATAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGATAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAANAGGCTTTAGCAGCAGAGCCTANATCAAAGGACCCATACGCACATCTACC
  5   1   2       bld Liv1      in                          CAAR643.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCAGCCCCTGAGGATGATATGGATGAATCTGANAAGGCTTTAGCAGCAGA
  3   1   2       bld TpA       in                    TTpA027d16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGCATACAAGCCCCTCATTGTTGCTCGGTATTGGGGGTTCCCCATCAAGGTTGCCTCCTTTCCTCCAGAATCCCATGTTGGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCTTTAGGCAAGGTACCAGCATTTGAGGGCAAGGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCTTTATGTGGGCAATGATGAGCTCGGGGGAACCAATCGTTTACCCCAAGCTCAGGTCATCCAGGGGGTCAGTTTTTCAGACAGTCACATTGTCCTTCCGGCCAGCGCAGGGGTTTTTCCCACTTTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCGGGGTGTTTTAGATTTTCTTTTGAAGACACGGACTTTCTTAGTGGGCGAGAGGGTCACGCTGGTTGATATAGCAGTTACTTGCTTTTTTTTGTGGCTTTATAAGCAGGTCCTGGAACCATCTTTCCCCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGCCCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGTTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAATTCCCAAGAAAGAAAAGCCAGCCAAGGGGGCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld TbA       in                   TTbA039l12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGGGCATACAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGANAAGGCTTTAGCAGCAGAGCCTANATCANAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTTAGAAGAAATACTCTAATGAGG
  5   1   2       bld Tad5                                 XZT42715.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCAGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGAGAAAATACTCTAATGAAGATACCCTGGCTGTAGCTCTGCCTTATTTCT
  5   1   2       bld Thy1      in                       CBST13433.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGC
  5   1   2       bld Sto1      in                        CABG10764.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCANAGGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGAGAAAATACTCTAATGAGGATACCCTGGCTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGAC
  5   1   2       bld Mus1      in                         CABH2786.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGANAAGGCTTTAGCAGCAGAGCCTAAATCANAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGA
  5   1   2       bld Thy1      in                       CBST11590.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCATACAAGCCCCTCATTGCTGCTCAGTATTCAGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGG
  5   1   2       bld Eye                                  CCAX3231.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAG
  5   1   2       bld TpA       in                   TTpA041g13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGCATACAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGANAAGGCTTTAGCAGCAGAGCCTANATCANAGGACCCATACGCACATCTACCTAANAGCTCTTTTGTAATGGATGAGTTTAAGAGAAAATACTCTAATGAAGATACCCTGGCTGTAGCTCTGCCTTATTTCT
  5   1   2       bld TbA       in                   TTbA002p05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGCATACAAGCCCCTCATTGCTGCTCATATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGANAAGGCTTTAGCAGCAGAGCCTACATCANAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTA
  5   1   2       bld Lun1      in                         CABD4236.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGANAAGGCTTTAGCAGCAGAGCCTAAATCANAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGAGAAATACTCTAATGAAGATACCCTGGCTGTAGCTCTGCCTTATTTCTG
  5   1   2       bld Mus1      in                        CABH10812.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTA
  5   1   2       bld Ovi1      out                        CABI6092.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTTAGAGAAAATACTCTAATGAAGATACCCTGGCTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAG
  5   1   2       bld Ovi1      in                         CABI2577.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGAGAAAATACTCT
  5   1   2       bld Ski1      in                         CABJ3574.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGANAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGAGAAAATACTCTAATGAGGATACCCTGGCTGTAGCTCTGCCTTATTTCTGGG
  5   1   2       bld Spl1      in                         CABK4190.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CATCGATTCGCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGAGAAAATACTCTAATGAAGAT
  5   1   2       bld Hrt1      in                         CAAQ8333.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGANAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTTAGAGAAAATACTCTAATGAGGATACCCTGGCTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGACAGGAAGGC
  5   1   2       bld Mus1      in                         CABH8507.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACTCATACGCACATCTACCT
  5   1   2       bld In54                            IMAGE:8944522.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAGAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAATGGAGGAAAAGAGAACGCACACCAGCTCTGCTCTGCCCAGCCCTGAGATGATATTGGATGATCTGAAAAGCTTAGCAGCGAGCTAAATCAAAGACGTACGCACATCTACTAAAGCTCTTTTGTATGGATGGAGTTAGAGAAAAATACTCTAATGGAAGAATA
  5   1   2       bld Liv1                                 CAAR9791.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAG
  5   1   2       bld Lun1      in                         CABD4336.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAG
  5   1   2       bld Mus1      in                         CABH4007.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGAGAAAATACTCTAATGAAG
  5   1   2       bld Ovi1      in                         CABI5713.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCATCGATTCGCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAANAGCTCTTTTGTAATGGATGAGTTTAAGAGAAAATACTCTAATGAAGATACCCTGGCTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCTGAATACAAATTC
  5   1   2       bld Ovi1      in                         CABI8686.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTANATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGAGAAAATACTCTAATGA
  3  -1   2       bld Ski1      in                         CABJ7592.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGAGAAAATACTCTAATGAGGATACCCTGGCTGTAGCTCTGCCTTATTTC
  5   1   2       bld Hrt1      in                        CAAQ11180.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGAGAAAATACTCTAATGAGGATACCCTGGCTGTAGCTCTGCCTTATTTCTGGGGAGCACTTTGACAAAG
  5   1   2       bld Hrt1      in                         CAAQ8444.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGANAAGGCTTTAGCAGCAGAGCCTANATCANAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTA
  5   1   2       bld Hrt1      in                         CAAQ8147.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTTGTATGGATGAGTTTA
  5   1   2       bld Fat1      in                        CABC11092.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTNATGGATGAGTTTAAGAGAAAATACTCTAATGAGGATACCCTGGCTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGACAA
  3  -1   2       bld Mus1      in                        CABH10711.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAANAGCTCTTTTGTAATGGATGAGTTTAAG
  5   1   2       bld Ovi1      in                        CABI10417.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTTAGAGAAAATACTCTAATGAAGATACCCTGGCTGTAGCTCTGCCTTATTTCTGGG
  5   1   2       bld Ovi1      in                        CABI13607.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGNAAAGGCTTTAGCAGCAGAGCCTAAATCANAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGAGAAAATACTCTAATGAGGATACCCTGGCTGTAGCTCTGCCTATTTCTGGGAGCACTTTG
  5   1   2       bld Ovi1      in                         CABI4276.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTT
  5   1   2       bld Ski1      in                         CABJ1948.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCANAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGAGAAATACTCTAATGAGGATACCCTGGCTGTAGCTCTGCCT
  5   1   2       bld Tad5      in                         XZT44157.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCAGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTANATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGAGAAAATACTCTAATGAAGATACCCTGGCTGTAGCTCTGCCTTATTTCTGG
  5   1   2       bld Hrt1      in                        CAAQ12744.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGA
  5   1   2       bld Mus1      in                         CABH6739.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGAGAAATACTCTAATGAGGAT
  5   1   2       bld Gas8      in                          st19i06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAG
  5   1   2       bld Gas1      in                       IMAGE:6990956                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTTGTAATGGATGAGTTTAAGAGAAAATACTCTAATGAAAGATACCCTG
  5   1   2       bld Hrt1      in                        CAAQ12728.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CATCGATTCGGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGAGAAATACTCTAATGAGGATACCCTGGCTGTAGCTCTGCCCTATT
  5   1   2       bld Ovi1      in                         CABI2421.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCATCGATTCGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGAGAAAATACTCTAATGAGGATACCCTGGCTGTAGCTCTGCCTTATTTCTGGGAGCACTTTGA
  5   1   2       bld Spl1      in                         CABK3810.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CATCGATTCGCTGCTCAGTATTCNGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAANAGCTCTTTTGTAATGGATGAGTTTAAGAGAAAATACTCTAATGAGGATACCCTGGCTGTAGCTCTGCCTTATTTCTGGGA
  5   1   2       bld Thy1      in                       CBST11842.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTNGAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGA
  5   1   2       bld Limb                                CBSU9430.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGGGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGANAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAAT
  5   1   2       bld Int1      in                        CAAP12968.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCGATCGAATTCGGCACGAGGTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGANAAGGCTTTAGCAGCAGAGCCTANATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTAATGGATGAGTTTAAGAGAAAATACTCTAATGAGGATACCCTGGCTGTAGCTCTGCCCTATTTCTGGGAGCACTTTGACAAGGA
  5   1   2       bld Fat1      in                         CABC2035.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGGTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTCTGGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCANAGGACCCATACGCACATCTAC
  5   1   2       bld Lun1      in                        CABD13366.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCCTCATTGCTGCTCAGTATTCGGGGTTCCCCATCAAGGTTGCCTCCTCTCCTCCAGAATTCCAGTTTGGAGTAACGAATAAGACATCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAACGACGGTTTTTGCCTTTTTGAGAGCAGCGCCATTGCTCATTATGTGGGCAATGATGAGCTCCGAGGAACCAATCGTTTACACCAAGCTCAGGTCATCCAGTGGCTCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTCTTTCCCACTTTAGGGATCATGCAATACAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATAAAGGCTGTGCTGGGTGTTTTAGATTCTCATCTGAAGACACGGACATTCCTAGTGGGCGAGAGGGTCACGCTGGCTGATATAGCAGTTACTTGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCATTTGGTAATGTTACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTCAAGCTTTGTGACAAGATGGCACAGTTTGATGCTAAGAAGTTTGCCGAGATGCAGCCCAAGAAAGAAACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCAAAAAAAGAAAAGGAGGAAAAGAAGAAGGCAACACCAGCTCCTGCTCCTGCCCCAGCCCCTGAGGATGATATGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTANATCAAAGGACCCATACGCACATCTACCTAAAAGCTCTTTTGTA