Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TTpA031f08.5.5                       44 END     2           0        4                superoxide dismutase 2, mitochondrial [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 221.0    0Xt7.1-XZG65675.3                            2 PI      100       918     1033                Ci-NF45 [Ciona intestinalis]

 This cluster: approximate FL confidence score = 97%

 1012070007 Xt7.1-XZT70818.5 - 884 ESTs
                                                                       .........-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZT70818.5                                                                                                                                                                                                                                                                                                                                                                                                                TGTGGAACCGGTCGTTATAGCCAATAGGAAAGGAGTTTGTTGGTCTAGTGTGGCTGTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCCGGCTCAGTTGGCATCACTGACCCCTGTGAAAGTGGCAACTTTAGGGTTCATACAGTCATGACTCTGGAGCAGCAGGACATGGTTTGCTACACTGCCCAGACGTTGGTCCGTATTCTCTCCCACGGGGGCTTCCGGAAGATATTGGGCCTGGAGGGAGATGCCAGCGCTCTTGCCACGGAAATGTCTACCTGGGACGGAGTCATCGTGACCCCTTCAGAGAAGGCCTATGAGAAGCCCCCCGAGAGGAAGGAGGGAGAGGAGGATGAGAACCAGGATATCCCAGAGGGGGCGGAAGAGGAGGAGAGCATGGAGACACAGGAGTGATACTTATTTAAAGATTTCAGTTGGTCTGGATCCCCCTCTGCCGGCGCCGAACACATTGGGTCTATTTGTGGACCAAATGCCACGAGTTCCTGTTTTATTTTCATTCGTTCTTAGCTTGTCATGTGACTTGTTTTATACTGTAGGGATACATTGTATTTTTTTTTTTTTTTTGCCAGCAATAAATTTTTATTTCGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008221149                                                                                                                                                                                                                                                                                                                                                                                                                      ACCGGTCGTTATAGCCAATAGGAAAGGAGTTTGTTGGTCTAGTGTGGCTGTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCCGGCTCAGTTGGCATCACTGACCCCTGTGAAAGTGGCAACTTTAGGGTTCATACAGTCATGACTCTGGAGCAGCAGGACATGGTTTGCTACACTGCCCAGACGTTGGTCCGTATTCTCTCCCACGGGGGCTTCCGGAAGATATTGGGCCTGGAGGGAGATGCCAGCGCTCTTGCCACGGAAATGTCTACCTGGGACGGAGTCATCGTGACCCCTTCAGAGAAGGCCTATGAGAAGCCCCCCGAGAGGAAGGAGGGAGAGGAGGATGAGAACCAGGATATCCCAGAGGGGGCGGAAGAGGAGGAGAGCATGGAGACACAGGAGTGATACTTATTTAAAGATTTCAGTTGGTCTGGATCCCCCTCTGCCGGCGCCGAACACATTGGGTCTATTTGTGGACCAAATGCCACGAGTTCCTGTTTTATTTTCATTCGTTCTTAGCTTGTCATGTGACTTGTTTTATACTGTAGGGATACATTGTATTTTTTTTTTTTTTTTGCCAGCAATAAATTTTTATTTCGAxAxxxxAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                     3     4     3     5     4     7    14    19    35    45   131   151   218   255   272   314   323   375   382   414   407   424   419   431   424   435   427   437   427   440   432   446   439   449   445   451   444   452   446   458   450   461   448   464   449   465   455   466   462   473   468   475   464   476   473   479   470   479   470   479   477   481   473   485   477   488   477   492   473   493   485   498   480   500   489   504   490   509   494   512   490   512   499   518   496   519   498   519   487   514   484   513   465   506   474   508   466   502   475   506   467   503   463   503   465   503   461   501   460   506   456   497   466   517   456   501   431   481   413   456   391   445   388   436   378   432   385   447   399   462   399   472   391   472   387   469   390   473   387   465   372   463   367   452   370   454   349   441   353   432   360   430   374   428   346   423   349   402   305   394   353   390   350   388   352   384   351   384   352   381   341   372   347   370   335   362   344   367   320   365   345   365   329   358   336   358   312   361   318   360   284   359   328   356   326   350   321   348   318   342   325   339   313   339   293   340   303   338   307   333   274   331   297   333   317   331   279   330   261   325   217   315   230   317   228   314   217   310   227   302   226   299   216   296   223   294   197   287   185   276   145   269    73   256    56   207    47    78    48    54    21    32    12    21     6    14
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ---T-T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -T---------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ---------C-C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    C-----------
                                               BLH ATG     114    2835                                                                                                                                                                                                                                                                                                                                                                                                                
                                               BLH MIN     114     261                                                                                                                                                                                                                                                                                                                                                                                                                
                                               BLH MPR      99     261                                                                                                                                                                                                                                                                                                                                                                                                                
                                               BLH OVR     114      76                                                                                                                                                                                                                                                                                                                                                                                                                
                                               CDS MIN     114      62                                                                                                                                                                                                                                                                                                                                                                                                                
                                               EST CLI      57      62                                                                                                                                                                                                                                                                                                                                                                                                                
                                               ORF LNG     114       8                                                                                                                                                                                                                                                                                                                                                                                                                
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ce ---- 6e-050     NP_506614.1 NF45 protein like [Caenorhabditis elegans] -------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Dm ==== 5e-117     NP_650196.1 CG5641-PA [Drosophila melanogaster] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Ci ==== 6e-125     BAE06575.1 Ci-NF45 [Ciona intestinalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED - Sp ---- 1e-130     XP_001201253.1 PREDICTED: similar to Interleukin enhancer binding factor 2, 45kDa [Strongylocentrotus purpuratus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = Gg ==== 0          XP_423437.2 PREDICTED: similar to Interleukin enhancer binding factor 2, 45kDa [Gallus gallus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Dr ==== 0          NP_998401.1 interleukin enhancer binding factor 2 [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Mm ==== 0          NP_080650.1 interleukin enhancer binding factor 2 [Mus musculus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Hs ==== 0          NP_004506.2 interleukin enhancer binding factor 2; nuclear factor of activated T-cells,45-kDa [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED = Xl ==== 0          AAH43981.1 Similar to interleukin enhancer binding factor 2, 45kDa [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === ?? ==== 0          NP_001080575.1 interleukin enhancer binding factor 2, 45kDa [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xt ==== 0          CAJ81376.1 interleukin enhancer binding factor 2 [Xenopus tropicalis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZT70818.5                                                                                                                                                                                                                                                                                                                                                                                                                                        TAG------------------TAG---------------------------------------------TGA------------TGA---ATG------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG---------------------------------------------------------------------------------ATG------------------ATG---------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG------------TGA---------------------------------------------------------------------------------------------------------------TAG------ATGTGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  5   1   1           Tad0 FL                     IMAGE:5380574.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCCGGCTCAGTTGGCATCACTGACCCCTGTGAAAGTGGCAACTTTAGGGTTCATACAGTCATGACTCTGGAGCAGCAGGACATGGTTTGCTACACTGCCCAGACGTTGGTCCGTATTCTCTCCCACGGGGGCTTCCGGAAGATATTGGGCCTGGAGGGAGATGCCAGCGCTCTTGCCACGGAAATGTCTACCTGGGACGGAGTCATCGTGACCCCTTCAGAGAAGGCCTATGAGAAGCCCCCCGAGAGGAAGGAGGGAGAGGAGGATGAGAACCAGGATATCCCAGAGGGGGCGGAAGAGGAGGAGAGCATGGAGACACAGGAGTGATACTTATTTAAAGATTTCAGTTGGTCTGGATCCCCCTCTGCCGGCGCCGAACACATTGGGTCTGTTTGTGGACCAAATGCCACGAGTTCCTGTTTTATTTTCATTCGTTCTTAGCTTGTCATGTGACTTGTTTTATACTGTAGGGATACATTGTATTTTTTTTTTTTTTTGCCAGCAATAAATTTTTATTTCGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Egg  FL                     TEgg033l23.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCTGGCTCAGTTGGCATCACTGACCCCTGTGAAAGTGGCAACTTTAGGGTTCATACAGTCATGACTCTGGAGCAGCAGGACATGGTTTGCTACACTGCCCAGACGTTGGTCCGTATTCTCTCCCACGGGGGCTTCCGGAAGATATTGGGCCTGGAGGGAGATGCCAGCGCTCTTGCCACGGAAATGTCTACCTGGGACGGAGTCATCGTGACCCCTTCAGAGAAGGCCTATGAGAAGCCCCCCGAGAGGAAGGAGGGAGAGGAGGATGAGAACCAGGATATCCCAGAGGGGGCGGAAGAGGAGGAGAGCATGGAGACACAGGAGTGATACTTATTTAAAGATTTCAGTTGGTCTGGATCCCCCCTCTGCCGGCGCCGAACACATTGGGTCTGTTTGTGGACCAAATGCCACGAGTTCCTGTTTTATTTTCATTCGTTCTTAGCTTGTCATGTGACTTGTTTTATACTGTAGGGATACATTGTATTTTTTTTTTTTGCCAGCAATAAATTTTTATTTCGACACCTCAAAAAAAAAAAAAAA
  0   1   1           Egg  FL                     TEgg021l09.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCCGGCTCAGTTGGCATCACTGACCCCTGTGAAAGTGGCAACTTTAGGGTTCATACAGTCATGACTCTGGAGCAGCAGGACATGGTTTGCTACACTGCCCAGACGTTGGTCCGTATTCTCTCCCACGGGGGCTTCCGGAAGATATTGGGCCTGGAGGGAGATGCCAGCGCTCTTGCCACGGAAATGTCTACCTGGGACGGAGTCATCGTGACCCCTTCAGAGAAGGCCTATGAGAAGCCCCCCGAGAGGAAGGAGGGAGAGGAGGATGAGAACCAGGATATCCCAGAGGGGGCGGAAGAGGAGGAGAGCATGGAGACACAGGAGTGATACTTATTTAAAGATTTCAGTTGGTCTGGATCCCCCTCTGCCGGCGCCGAACACATTGGGTCTATTTGTGGACCAAATGCCACGAGTTCCTGTTTTATTTTCATTCGTTCTTAGCTTGTCATGTGACTTGTTTTATACTGTAGGGATACATTGTATTTTTTTTTTTTTTTTGCCAGCAATAAATTTTTATTTCGAC
  3  -1   2       bld Te1       in                         CBWN9318.g1 ATGACTTCTCCAATTACATTGAGTAGGAAAAATAAGAGCTAGTCTAAAAGCAGTGCTTTTGTACAGTGCTGGCTTTTTGAAAGCTCAGGTTTAGGCACAATGAACTGAAAGGGCTGCCTACACACCAATATTACAACTAAGTGGGACATTTTTAGCAGTGCCGTGTCAAGGAGTTGTTTTCTTGTTACCTTCCCATTGCTCTGGGGGTTACAGAGCAATGAAGTTTATCAGTCACATGGCTGGGGGCACCTGGAAAACTAAAAAAAAGTCTAGCCCCATGTTGAAGTTACTAATAAATAATAAAAAATGTATTTGCTCTTTCAATGCACAGTTCTGCTGGAGGAGCGCTATTAAATGATGCATTTTGTAAAAAAAAAAAAAAACGTGATGCTGATTGGCTGTGGAACCGGTCGTTATAGCCAATAGGAAAGGAGTTTGTTGGTCTAGTGTGGCTGTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCAC
  5   1   2       chi Egg                            TEgg079l12.p1kSP6                                                                                                                                                                                                                                                                            GGGCAGTTAAGGGGGGGTCACTATATATAAATATATAAGGGGGGGGCAGTAATGAAATAGAGAAAGTATAGGGGAGAGCGACTAAGTGTGGGACTCTCGCACAGAAGAGCTTGCAGTCTAATGAAGAGACATGTTGGATTCATTATTTGCCAGACACGTGAGGATTCGGATCAGCGCCAGACCCCCCCCCCCCTTGTGCCTCATTACCATGGTTATCTCTCTGTAAGACCCTTCCACCCCAGGAATGAAATGGGTGAACAAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCAT
  5   1   2       bld Gas1 5g   ?                      NISC_mq06c01.y1                                                                                                                                                                                                                                                                                                                                                                                   GGAGTTGACTGTTCGTGATGCTGATTGGCTGTGGAACCGGTCGTTATAGCCAATAGGAAAGCAGATTGTTGGTCTAGTGTGGCTGTATCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAACATGAGGGGTGAACG
  5   1   2       bld Neu  5g3  in                   TNeu090d03.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                      GCTGATTGGCTGTGGAACCGGTCGTTATAGCCAATAGGAAAGGAGTTTGTTGGTCTAGTGTGGCTGTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGG
  5   1   2       bld In62 5g                         IMAGE:8957110.5p                                                                                                                                                                                                                                                                                                                                                                                                                         GTTTTATTAAAATTGCCCATAATTTAAATATAATATAAACATCCCCTGTTCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGGCCGCCATCAGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGTTTTATTCCGGTGTTGAAAGACTTGAGAGTCGTTTCCTGATTTGAGCCTCTGACTCCTGATCTGAACTCTTGGGCATTATGCCGTCATGAAACACCCCCACCAGGCAGCCGCTGCACACTCAATGTG
  5   1   2       chi In54                            IMAGE:8944874.5p                                                                                                                                                                                                                                                                                                                                                                                                                               GGGAGAGTTTTTTGCGGATCCACTCAAATACGAATTCGTCCCATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCACGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGTTTTAATCCGGTTGTTGAAAGACTTGAGAGTCGTTTCCTGGATTTGAGCCTCTGACTCCCTGATCCTGACTCTTGGGGCATTATGCCGTCATGAACACCCCACAGCAGCCGCTGCACTCATGTGTCTACAACGCTGCCTACGATGCTCGCCGCGCTTTCCTCCGCTCAGTGCATCTGACCTGTGAGGGCCACTTAGTCTACGTCTGACTGGACACGAACTTGTTGCTACTGCAACTTGTTCGATTCTCAGGGCTCGGAATTGCTGAGATGCGCTGCGAAGTTCTGGGAGGATCGCTGAC
  5   1   2       bld 1030 5g                         IMAGE:7094576.5p                                                                                                                                                                                                                                                                                                                                                                                                                                     GAATAGGAAAGGAGTTTGTTGGTCTAGTGTGGCTGTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGGAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTTGCGCCCCATCTGCGCAAGCTGGAACCCGAGTTGCATTTGG
  5   1   2       bld Egg  5g3  in                   TEgg070p18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGAAAGCAGATTGTTGGTCTAGTGTGGCTGTATCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAG
  5   1   2   12  bld Tad5 5g3  in                         XZT69067.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................GGAAAGCAGATTGTTGGTCTAGTGTGGCTGTATCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTG
  5   1   2       bld Egg  5g                        TEgg104l17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                           GAAAGGAGTTTGTTGGTCTAGTGTGGCTGTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAG
  5   1   2       bld TbA  5g                        TTbA051h10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGAGTTTGTTGGTCTAGTGTGGCTGTATCGAGGGCCGACAGGGTGTCCATTGTGCGGGAATGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACTGGTTTCAGACCCTTCATCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGAGGATAGCTCATTCAGCGAGTCACTGCTCTAACTAAACCAAGATCTGGCCCCCATCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTATCCCCGGGAAACTTTGAAGTGCAAATTGAAGAAGTGCGACAGGTGGGCTCCTACAACAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAACAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCATGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCT
  5   1   2   22  bld Tad5 5g                              XZT69562.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................GCAGATTGTTGGTCTAGTGTGGCTGTATCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCCTCTGGGGCATTATGCCGTCATGAACAACCC
  5   1   2   20  bld Spl2 5g                             CBSS9021.fwd ..............................................................................................................................................................................................................................................................................................................................................................................................................................................GCAGATTGTTGGTCTAGTGTGGCTGTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGC
  5   1   2       bld Egg  5g                        TEgg097m20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGATTGTTGGTCTAGTGTGGCTGTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCATATTGAGGAGGTGCTACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACATGCCATAATGTTGCAGACTTGGTCGTCATCCTATAGATCCTTCCCACACTGTAAGCCGTTTCTGCTTTG
  5   1   2       bld Neu  5g                        TNeu032h09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGATTGTTGGTCTAGTGTGGCTGTATCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCANGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGAT
  5   1   2       bld Tbd0 5g                            IMAGE:6978370                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGTTTGTTGGTCTAGTGTGGCTGTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGNCAGCTGGACCCCGAGTTGCATTTGGGACATCAAGTTCTGCAGAGCGCACTGGCCCGCATCAGGCACGCACGGTGGGTCGAGGAGAACGCTCCCATCTACAGTGAGGTTTAATCCNGNTGTGAAAGACTGAGGAGTCGTTTCTGGATTGAGCTCTGATCCTGATCTGGACTCTTGGCATATGCGTCTGACAACCCCCAGCACGCTGCATCATGTCTAAACCTGCC
  3  -1   2       bld Gas6      in                         ANBT3082.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTAAGGGCTCGAGCCCTTTAGTGTATCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTT
  5   1   2       bld 1030 5g                         IMAGE:7094767.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                  AACCCCCCCGCTAGTGTGGCTGTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGAAGAAAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATGTGGCCCCCAGGAGAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAATAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAATTGTAATTTCTCACTATGTTGACAAATGAAACTGGCTTTAAATCAGCTCACAAAACCCACGGGAAAGATCTTATCATACTGTGCCGCCCATTTTCTCTACTGGACCCCAATTGTTTTGGACTTTA
  5   1   2   34  bld Te3  5x3  out                        CAAM7404.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................TTGTTGGTCTAGTGTGGCTGTATCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGA
  5   1   2       bld Neu  5g3  in                   TNeu071o23.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCCATCGATTCGCCCGGGGATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCTGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCAT
  5   1   2       bld HdA  5g                       THdA029m02.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTGGTCTAGTGTGGCTGTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAANCACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTT
  5   1   2       bld 1030 5g                         IMAGE:7093041.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTCTAGTGTGGCTGTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAG
  5   1   2       bld 1030 5g                            IMAGE:7026783                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCTAGTGTGGCTGTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCTATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGANCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGGAGAACCCCTCCCCTTCTACAGTGGAAGGTTTTAAATCCGGTTTGTTGAAAGAACTTGAGGGAGTCCGGTTTCCTGGGATTTGAAGCCCTCTGGAACTCCCCTGGGGATCCCTGGGACCCCCCTTGTGGGGGCAATTTTTGCCCCGTTCCATGTAAAAAAAACCCCCCCCCCGAGGGGCT
  5   1   2       bld 1030 5x                         IMAGE:7029185.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTAGTGTGGCTGTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGCGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCCATCAGCGAGTCACTGGCTCAACCAAACCCAGATCTGGGCCCCAGCACAAGCGAACAAGCCTCAATCCTTTCTTTGGTCAACCAAATCCACCACCGTATTCGACAATTGATCGTAACCCCCGGAAACTTTGAAGTGGCAATTGAAAGAAGTGGCACAAGTGGGGCTCTCTACCAAAAAAGGACCCTTGAGCCCCGGGCCTTATGGTGCACAAATTGGGTCTGTCCTCCCTAAGAATTCTTTCTCACACCTGGGAAAACCCTTTTCTGCGCTTTGGGGCCTTTAAAGGGGGGTCCAAAAACCCCCAAGGGGGCCCGGGGGTTCCCCCTTTTTTTTTTAAGAGGGGCCCCCCCCCCCCGGGGGGGAAAACTTGGGCCCCTGGGCCCCAACTTGTGTTTTTTGGGCGCCCTATAAAGGGGGGTCTCCCAAAAAAAGCGCCTTTTCCCTCCCCAAAATTTTTTCCCAAAAAAAAAAAAAATTATTTTTTTTCCCCGGCGCTTCTCCCAAGGTTGGGGGGGGTGTGTGGCCCCACACCCCCTCTCCCACAGGGGGGGTCTTTTTATTCAACAAACCCCCGGGGAGGAACCCGGGAAAAAATAATTTTCTCCTCTCGCGCGCCCCACCA
  5   1   2       bld 1030 5g                         IMAGE:7094272.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTAGTGTGGCTGTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCACCAGACGCCACGGTGAAATCCTTATCACAACTGTGCCGCCCAATCTGCCCAGCTGGACCCCGAGTGCATTTGGACTCAAATTTCTCAAACCCCTGGCCGCCTCAGGCCGCCCGGGGTTCAGGA
  5   1   2       bld 1030 5g                         IMAGE:7093107.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTAGTGTGGCTGTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGC
  5   1   2       chi 1030 5x                         IMAGE:7026840.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTAGTGTGGCTGTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAAGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCCCACTGGAAGCCCGTTTCTGCTTTGGGCATTTAGGGGGGTCGAGACCCCTAGGGACGCCAGGATCCAGCCTGAAGTTCTCACAATGGCTGAACAAACAAAACTGGGCTTTTGAGAATCAGCCTCCAACCAAAACCCCCCGGGGGGGAAAAATCCTTTATTCCCGAACTGGGTTGCCGCCCCAAATTTTGGGCCCAAGGCTGGGGAACCCCCGAAGTTGGCTTTTTGGGGACAAT
  5   1   2       bld 1030 5g                         IMAGE:7028722.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTAGTGTGGCTGTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAG
  5   1   2       bld 1030 5g                         IMAGE:7025787.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTAGTGTGGCTGTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAAAGCGCGCTGGCCGCCATCAGGCACGCCCGGTGGGTTCGAAGAAGAACGCCCTTCCATTTCTACAGTGGAAGGTTTTTAATCCCGGTTGGTTGAAAAAACTTGGAAGGAAATCGGGTTTCC
  5   1   2       bld 1030 5g                         IMAGE:7091552.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTAGTGTGGCTGTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAG
  5   1   2       bld Egg  5g3  in                   TEgg002k13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCGGGGATTCCCCGGGGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGA
  5   1   2       bld 1030 5g                         IMAGE:7092020.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTAGTGTGGCTGTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCGCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAG
  5   1   2       bld 1030 5g                         IMAGE:7092272.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTAGTGTGGCTGTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGANCAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCAATCTGCGCAAGCTGGACCCGAGTTGCATTTGGACATCAAGTTCTGCAGACGCACTGGCCGCATN
  5   1   2       chi 1030 5x                         IMAGE:7026540.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTAGTGTGGCTGTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCCTACAAGAAAGGGGACCATGAGCACCGGGCCATAATGGTTGCAAGACTTTGGCCGGTCATTCCCAAAAAAAATCCCTTTCCCCCCCAATTTGGGAAAACCCCCTTTTTCCTGGCGTTTTTGGGGGCCATTTTAAGAGGGGGGGGGCCCAAAAAACCCCCCCCTAAAGGGGGAGCCCCCCGGGGGGTTATCCCCCCCCGCTGAAGAAGTTTTTCCCCCCCCAAAAGTTGGGGGTAGACAAAAAGAAAGGGAAAAAATCCGGGGGGGGTGTTTTATTGTAAAAAATAAAAAGGGCACACGATTGACCAGACAGAAAATCCACCCCCCCCCCCGGGGGGGGGGGGGATAAAAAAAAGGGCCACCCGGTCTTTGGCGACAGCCCCACCCGTTTTTTTTGTTTTTCCACCCCGCCCACCCAATCTTAACTCCTTATGT
  5   1   2       bld 1030 5g                         IMAGE:7026014.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTAGTGTGGCTGTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACNGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGGTGGTTCGAGGNAGACGCCTCCCATTTCTACAGTGGAAGTTTTTAATCCCGGTTGTTTGAAGGACCTGGAGGAAGTCGGGTTTTCCTGGGNATTTGAGGCCTCNNTGGACTCCC
  5   1   2       bld Tad0 5g3  in                       IMAGE:6981861                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCCCGGGGATGTATCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCATGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCTCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAGACTTTGAGAGTCGGTTTCTTGAAT
  5   1   2   12  bld Tad5 5g3  in                         XZT34167.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGACGCGTGGGTCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAA
  5   1   2       bld Tad5      in                          XZT4428.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGTGTGGCTGTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCC
  5   1   2       bld 1030 5g                         IMAGE:7093030.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGTGTGGCTGTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCATACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGAATCCGCTGAAGTTCTCACCAATGGTGACCAAACGAGACTGGCTTTGAGATTAGCTTACAGACGCCACGGGGGAAATCCTTATCTCAATGTCCCCCCTAACTGCGCAGCTGGACCCGAATTGCTTTGGAAATCAAATTCTGCTAACGCCTGGC
  5   1   2       bld 1030 5g                         IMAGE:7029128.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGTGTGGCTGTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAG
  5   1   2       bld 1030 5g                         IMAGE:7091313.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGTGTGGCTGTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTCTGCAAAGCGCGCTGGCGCCCTCANGACGCACGGTGGTTCA
  5   1   2       bld 1030 5g                         IMAGE:7028517.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGTGTGGCTGTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAG
  5   1   2       bld Neu  5g3  in                   TNeu051p08.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATCCCCGGGATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCTGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGATCCAGCTGAAGTTCTCACAATGCTG
  5   1   2       bld TpA  5g3  in                   TTpA019c08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATCCCCGGGCGACGCGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCC
  5   1   2       bld In66 5g                         IMAGE:8966025.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTTATTAAAGAACAGAATCTCACTAAAAAAAAAAACGCCCGTGTGAGGAACGAAGATCTGAAACATGAGCGGCGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGTCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGTCCTCTCATTCTACAGTGAAGGTTTTAATCCGGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGATTTGAGTCTCTGACTCCCTGGATCCTGGACCTCTGGGGCATATGCTCGTCATGACACCCTCACAGGCAGCCGCTGGCACTCAATGTGTCCTTACAACGCTGCTAACGATGCCTCGCCGCGACTTTCCTCCCTGACTCCAGTTGGCATCCCCTGGAACCCCCTGGGTGAAGAGTGGCCACCT
  5   1   2       bld Egg  5g                       TEgg126c05.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATCCCCGGGCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGA
  5   1   2       bld Tbd0 5g                            IMAGE:6978487                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCCGGGATATCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAATGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGNGAGACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCNGTTTCCTGGNATTGAGCCTCTGACTCCCTGGATCCTGGGACTNNCTGGGCAT
  5   1   2       chi Tbd0 5g                            IMAGE:6979001                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTGGCTGTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCCGCCATCTGCGCAGCTGGACCCGAGTGCATTGGACTCAAGTCTGCGAGCCGCTGGCGCATCAGCACGCACGTGTCGAGAGACGCTCCATCACATGAGGTTATCCGTGTGAAGCTGAGATCGGTCTGATGAGCCGATCTGACTGACCTGGCATTGCTTGAACCACAGACCTGCT
  5   1   2       bld In60 5g                         IMAGE:8948325.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGAAATTTAAAACAAAGAACAGTCATTCGCTAACTTATTCGTCCCGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGGCCGCCATCATGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAAGTTTTAATCCTGGTTGTTGAAAGACTTGAGGAGTCGGTTTCTTGGAATTGAGCCTCTGACTCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGCACTCATGGTTCCTACAAACGCCTGCCTTACGAATCTCGGCCGCCCGGCCTTTCTCCCCGGCCTCAGT
  5   1   2       bld Egg0 5g3  in                         dad66e08.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTCCTGGGGTATCGAGGGCCTTGGGGGTGTCCATTGTGCGGGAGGCCGGGAACGAAACTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGNCGNCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTT
  5   1   2       bld Gas1 5g3  in                     NISC_mq21g09.y2                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATCTGTATCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGG
  5   1   2       bld Gas  5g3  in                   TGas128o01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCCCCGGTCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCTGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTC
  5   1   2       bld Gas1 5g                            IMAGE:6988480                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCTGTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTTGAGCNCTCTTGACTCCCTGGGATCCCTGGACCCTCTTTGGGGGCATTTATGCCCGGTCATGGAAACAA
  5   1   2       bld Neu  5g                        TNeu043e06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCCGGGATCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGACTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGC
  5   1   2   20  bld Thy1 5g   ?                        CBST11833.fwd ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGCTGTATCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAA
  5   1   2       bld Tbd0 5g                            IMAGE:6980535                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCGGGATCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGACGCCTCCATTCTACAGTGAGGTTTTATCCGNTGTTGAAAACTGAGGATCGGTTCTGGATTAGCTCTGCTCCTGATCTGACTCTGGGCATATGCTCTGACACCACAG
  5   1   2       bld Gas1 5g                            IMAGE:6989060                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTGTATCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAATGTTTTAATCCGGTTGTTTGAAGACTTGAAGAATCTGTTTCCGGGATTGAGCCCCTGACTCCCTGGATCCTGA
  5   1   2       bld Gas1 5g3  in                       IMAGE:6990332                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCTGTATCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCANAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGACGCCCTCCATCTACAGTGAAGGTTTNTATCCNNGTGTGAAGNACTGAGGAGTCGTTCCTGGATTGAGCTCTGACTCCTGGATCCTGACTCTTGGGCATATGCC
  5   1   2       bld HdA  5g3  in                   THdA021f15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCGGGGCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCG
  5   1   2       bld Egg  5g                        TEgg104n21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCGGGCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCC
  5   1   2       bld Neu  5g3  in                   TNeu056g06.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AATCCCCGGGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGT
  5   1   2       bld Neu  5g3  in                   TNeu074m16.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AATCCCCGGGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCG
  5   1   2       bld Neu  5g                        TNeu094k15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCGGGCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTGAGATCAGCTC
  5   1   2       bld Neu  5g                        TNeu115d14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGTATCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGACTGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCGGGGGGCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTGATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAAGTGGTCGAGACCCTAAAGACGCAAGATCCAGCTGAAGTTCTCACAATGCTGA
  5   1   2       bld Neu  5g                        TNeu142h15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTAT
  5   1   2       bld Gas0 5g                              dad34h12.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGGNATCGAGGGCCGTTTGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTGCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCGCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAGCGTTATCGACAATGTGATCGTCTCCCCGGGAAACTCCGAAGTG
  5   1   2       bld Tbd0 5g                            IMAGE:6976657                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGTATCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTTCACAGTGAAAGTTTTAATCCCGGTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTTGAGCTCTGACTCCCTGGATCCTGGGACCTCTGGGGGCATTATGCCGTTCCTGAAACACCCCCACCAGGCACCCGCTGGCACCTCAT
  5   1   2       bld Tbd0 5g3  in                       IMAGE:6977129                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGTATCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAAAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGGTTGTTGAAAGGACTTGAGGGAGTTCGGTTTCCTTGGATTTGAGCCCTCTGACTCCCTGGGATCCTGGGACCTCTTGGGGGCATTATGCCCGGTCATGAAACAACCCCCACCCAAGCACCCGCCTGGGCACCTCATGG
  5   1   2       bld Tbd0 5g                            IMAGE:6978747                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGTATCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCTAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCANGCACGCACGGTGGTTCGAGGAGAACGNCCTCCATTCTACAGTGAAGGTTTTAAATCCGNNTGTGAANGACTTGANGAGTCNGTTTCCTGGATTNNGAGCTCTGACTCCCTGGATCCTGGANNCTCTGGGGCAATATGCGTCATGAACACCCNACAAN
  5   1   2       bld Neu0 5g3  in                     NISC_ng11d07.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGTATCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGC
  5   1   2   34  bld Brn4 5x3  out                        CAAL5608.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTC
  5   1   2   22  bld Tad5 5g                              XZT69970.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGTATCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGNGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAA
  5   1   2   10  bld Tbd1 5g3  in                        CBXT12274.b1 ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGTATCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGA
  5   1   2       bld Gas  5g3  in                   TGas126e10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTT
  5   1   2       bld Neu0 5g                            IMAGE:6995606                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGATTCGAGGGCCGAGAGGTTGTCCATTGTGCGGGATGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTTGCATTTGGACATCAAAGTTTCTGGCAAAGCGCACTGGCCCGCCCATCAAGCCACGCCACGGGTGGTTTCGAGGAAGAAAACGCCTCCCCAATTTCTACAAGTGAAAGGTTTTTAAATCCCGGGTTTGTTTGGAAAGGACCTTGGAAGGGAGATCGGGTTTTTCCCCTGGAATTTTTGGAAGCCCTCCTAAACTTCCCCTTGGGATTCCCTGGGAAACCCTCTTTGGGGGGGGCATTTAATGCCCCTTTCCTTGGGAAAAAAACCCCCCACCCCAGGGGCAAGCCCCGCCCCTGGGCCACCTCAAAATGTGGGGTCCCTTAACAAAAAACGCCTTGGCCCCTAACGAAAATGGTTTTTGCCCCGTCCCCGGGGCCCTTTTTTTTCCTCCCCCCGCGGGGGCTTTCAAAGTTT
  5   1   2       bld Tbd0 5g3  in                     NISC_nl14b09.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAATATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTG
  5   1   2       bld Neu  5g                        TNeu020g24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTGTATCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGACTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCTGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGG
  5   1   2       bld Neu  5g                        TNeu030a12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGGCTGTATCGAGGGCCGACGGGGGTCCTTGTGGGGAGTGTGAGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACCGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACA
  5   1   2       bld Gas1 5g3  in                       IMAGE:6990184                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGATCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCATTCTACAGTGAAGGTTTTATCCGNGTTGTGAAAGACTGAGAGTCGGTTCCCTGATTGAGCTCTGACTCCTGGANNNCTGACTCTGGGCATATGCGTCTGAACACCCACAGCAGCGC
  5   1   2       bld Neu0 5g   ?                      NISC_ng05d01.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTATCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGT
  5   1   2       bld TpA  5g                        TTpA063f12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TATCGAGGGCCGAGAGGTTGTCCATTGCTGTGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGA
  5   1   2   12  bld Gas7 5g3  in                         XZG56360.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCA
  5   1   2       bld Tad5      in                         XZT11756.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTATCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGNGGCATTATGCCGTCATGAA
  5   1   2   12  bld Tad5 5g3  in                         XZT67356.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTATCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCC
  5   1   2   20  bld Limb 5g                             CBSU1030.fwd ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAA
  5   1   2   10  bld Spl2 5g3  in                        CBSS4478.fwd ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTG
  5   1   2       bld TbA  5g                        TTbA053f18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCGGGGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTNGAGGAGTCNGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTNCATGTGTCCTACAAACGCTGCCTACAGATGCTCGC
  5   1   2       bld TbA  5g3  in                   TTbA011c05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGC
  5   1   2       bld TbA  5g3  in                   TTbA049c18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTNCATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCGGCTCAGTTGGCATCACTG
  5   1   2       bld HdA  5g                        THdA050i04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGAACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTANCAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTC
  5   1   2       bld Gas7 5g3  in                         XZG17790.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTT
  5   1   2   12  bld Gas7 5g3  in                         XZG22688.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTC
  5   1   2   12  bld Gas7 5g3  in                         XZG25921.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAG
  5   1   2   12  bld Gas7 5g3  in                         XZG32480.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAA
  5   1   2       chi Gas7 5x3  in                         XZG50057.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGGTAAGTTGCTACGTCTTTAATACGAataatgtaccccctactgtaaatgataaggatattagcagtcactgaggggttctgtgccccccatataaaggcacaaggctgcaggctgagttatacagggaactctgagtatccctcatgtattataagggataatgtaccccctactgtaaatgataaggatattagcagtcactgaggggttctgtgccccccatataaaggcacaaggctgcaggctgagttatacagggaactctgagtatccctcatgtattataagggataatgtaccccctactgtaaatgataaggatattagcagtcactgaggggttctgtgccccccatattaaagcacaaggcCGGTTATAAGGATATAATTTACAGGATATTCAGGGCTCCTGTGTTTGTTTCCCTGTAGCAAATTGAGGAGGTGCGACAGGT
  5   1   2   12  bld Gas7 5g3  in                         XZG60296.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATCGAGGGCCGACAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCA
  5   1   2   12  bld Gas7 5g3  in                         XZG62691.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAAC
  5   1   2   22  bld Tad5 5g                              XZT54567.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAG
  5   1   2   12 seed Tad5 5g3  in                         XZT70818.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGNGGCATTATGCCGTCATGAACAACCTCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTTCCT
  5   1   2   12  bld Tad5 5g3  in                         XZT71321.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGA
  5   1   2   10  bld Tbd1 5g3  in                        CBXT21101.b1 ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTT
  5   1   2   20  bld Tbd1 5g                              CBXT2598.b1 ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGTGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCAGGAAACTTTGAAGTGCAAATTGAAGAGGTGAGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTGAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGA
  5   1   2   20  bld Eye  5g                              CCAX3230.b1 ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGGTTCGAGGAGAACG
  5   1   2   20  bld Eye  5g                              CCAX9014.b1 ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGAC
  5   1   2   20  bld Eye  5g                              CCAX9594.b1 ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCAT
  5   1   2       bld Egg  5g3  in                   TEgg065c01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTG
  5   1   2       bld Egg  5g                        TEgg085j15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCGAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTG
  5   1   2       bld Neu  5g3  in                   TNeu106o18.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTT
  5   1   2       bld Neu0 5g   ?                      NISC_ng13f08.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCT
  3  -1   2       bld Gas7      in                         XZG25214.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCTGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCT
  5   1   2   20  bld Spl2 5g                             CBSS9316.fwd .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGC
  5   1   2   10  bld Spl2 5g3  in                        CBSS9679.fwd .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCTGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGT
  5   1   2   20  bld Tbd1 5g                              CBXT2178.b1 .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGTGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCAGGAAACTTTGAAGTGCAAATTGAAGAGGTGAGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTGAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGA
  5   1   2       bld Neu  5g3  in                   TNeu093m10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCGCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCT
  5   1   2       chi Tbd0 5x                            IMAGE:6976870                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTTTCAGCGAGTCACTGGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGNTTATCCGACAATTTTTGATCCTTAGCCCCCCGGGAAAACTTTTGGAAGGGGGCAAATTTTGGGGGGGGGGGGGCCCAACCCGGGGGGGGGGCCCCCCCCCCCCCCCAAAAAAAAAGGGGGGGGGGGTTTTTTTTTTCTACCCCCCGCGCCCCCTCCCGTTTTTTTTTTTTTTTTGTTCGTTGTGCCTCCCCTCTCTTTGCCCCTCCCCNCTGCTTCTCCTCGTCTTCTTTCTCTTCATTCTCTTAATTTCTTGTGNAAGGGTGATATTGGGGAGCGGTATTTGCGAACCGGGGGGTAGGCNTTCTTNGGCTGGGGGN
  5   1   2       bld Tbd0 5g                            IMAGE:6978894                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCCGCATCAAGCACGCACGGGTGTTTCGAGGAAGACGCTTCCCATTCTACAGTGAAAGTTTTTNTCCCGGTTGTTTGAAGACTTGAGGAATCGGTTCCCTGGATTGAGCCTCTGACCCCTGAATCCTGAACCTCTGGGGCATATGCGTCTTGAACACCCAACAGCAGCGCTTGCCN
  5   1   2       bld Tbd0 5g                            IMAGE:6979653                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCCGCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCATTCTACAGTGAAGGTTTTTATCCNGTTGTTGAAGACCTGANGAGTCGTTTCCTGAATTTGAGCTCTGACTCCTGATCTGGACTCTTGGCATATGCGTCTGACACN
  5   1   2       bld Tbd0 5g                            IMAGE:6980493                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCCTCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTTCCTGAATCTGGACCTCTTGGGGCN
  5   1   2       bld Tbd0 5g                            IMAGE:6980841                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCGNGTTTGTGAAAGACTTGANGAGTCGGTTTCCTGGATTTGA
  5   1   2       bld Gas1 5g                            IMAGE:6987400                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGGTTGTGAAAGACTTGAGGAGTCGGTTTCCTGGAATTGAGCTCTGACTCCCTGGATCCTGGACTTCTGGGGCATATGCC
  5   1   2       bld Neu0 5g3  in                       IMAGE:6991421                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCATCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCCGGTTGTTGAAAGACTTGAGGAAGCCGGTTTTCCTGGGATTTGAGCCCTCTGAACTCCCTGGAATCCTGGACCTTTTGATGGCATTTATGGCCGTCATGGAACAACCCCCACCCAGGCAAGCCGCCTGGACACTCCAATGGGGGTCCCTACAAACGGCTGGCCTAATAAAGGCTTCCCCCCGCCGGGCCCTTTTCCTCCCCGGGGTT
  5   1   2       bld Neu0 5g3  in                       IMAGE:6992756                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGGGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCGGGATTTGAGGCTTCTGACTCCCTGGATCCCGGGACCTCTGTGGGGCATTAATGCCCGTCATGGAACAACCCCACCAGGGCGACCGCTGGCACCTCAAGGGGTCCCTACAAAAGCTGCCCAACAGAAGGCTCGCCCGCCGGGCCTTTTTCCTCCCCGGCA
  5   1   2       bld Neu0 5g                            IMAGE:6994625                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCCCCCAGGGCAGCCGCTGGGCACCTCAATGTGGTCCCA
  5   1   2       bld Neu0 5g                            IMAGE:6995564                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGAATCCCCGGATCCTGGACCCTTGTGGGGTTATTTTGCCGTCATGAACCAACCCCCCCAGGCAGGCCCCTGGCACCTCAATGGGGGTCGCAAACAACGCCTGACCATACAAAATGATTTGCCCGCCCGGCCCTTTTTTCCTCCCCCC
  5   1   2       bld Neu0 5g                            IMAGE:6995810                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGGTTTAATCCGGTTGTTGAAAGACTTGAAGAAGCCGGTTTTCCTGGAATTTGAGCCCTCTGGACTCCCTGGGATCCCTGGGACCTTCTCTGGGGGGCATTTATGCCCGGTCATGGAACAAACCCCCACCCAGGGCCAGCCCGCTGGGGCACTTCCAATGGTGTT
  5   1   2       bld Gas1 5g3  in                     NISC_mq26c10.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTG
  5   1   2       bld Neu0 5g3  in                     NISC_ng13d07.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCT
  5   1   2       bld Neu0 5g                          NISC_ng20f08.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCG
  5   1   2       bld Neu0 5g3  in                     NISC_ng28g11.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGC
  5   1   2       bld Tbd0 5g3  in                     NISC_nl02c04.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGG
  5   1   2       bld Tbd0 5g3  in                     NISC_nl04a01.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTG
  5   1   2       bld Tbd0 5g3  in                     NISC_nl10e01.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAG
  5   1   2       bld Tad0 FL   in                    IMAGE:5380574.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATC
  5   1   2       bld Neu  5g                        TNeu042i13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGGGGCCGAGAGGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGG
  5   1   2       bld Neu  5g                        TNeu043b10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TATCGAGGGCCGAGAGGGTGTCCATTGTGCGGGATGTGAGAACGAAGACTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCAT
  5   1   2       bld Neu  5g                        TNeu049m18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGTTCGGGGCCGAGAGGTGTCCATTGTGCGGGATGTGAGAACGAAGACTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGC
  5   1   2   12  bld Gas7 5g3  in                         XZG36147.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATG
  5   1   2   12  bld Gas7 5g3  in                         XZG43819.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTA
  5   1   2   22  bld Tad5 5g                              XZT65919.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGNGGCATTATGCCGTCATGAAACACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGGCTTTTCCTCCCCGGCTCAGTTGGCATCAC
  5   1   2   10  bld Eye  5g3  in                         CCAX5386.b1 ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTT
  5   1   2       bld Egg  5g3  in                   TEgg004c15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCT
  5   1   2       bld Gas1 5g3  in                       IMAGE:6981323                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGAGGGCCGAGAGGTTGTCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTTTGTGAAGACNTTGAGAGTCGGTTNCCTGGATTTGAGCCTCTGACTCCCTGGATNCCTGGACTCNTGGGGGCATATGCGTCATGAACAACCCCCACAGCAGCCGCTGCACTCATGTGTCTACAACGCTGCTACAN
  5   1   2       bld Gas1 5g                          NISC_mq02f07.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCGAGGGCCGAGAGGGGCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTG
  5   1   2       bld Gas1 5g3  in                     NISC_mq16b02.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAA
  5   1   2       bld TpA  5g3  in                   TTpA075k22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGGGCCGAGAGGGTGTCCATTGTGCGCGGTGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTTGAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCC
  5   1   2       bld HeRe 5g3  in                     EC2CAA12AH06.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAGCATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATTAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGATATCAGCTCAGCAGACCCCACGGTGAAAGA
  5   1   2       bld HeRe 5g3  in                     EC2CAA12BH06.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATTAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCC
  5   1   2       bld HeRe 5g3  in                     EC2CAA13AH06.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATTAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCATGCACGCACGGTGGTTCG
  5   1   2       bld HeRe 5g3  in                      EC2CAA9AH06.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATTAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCAGAGTTGCATTTGGA
  5   1   2       bld Gas8 5g                               st18b04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGNAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTT
  5   1   2   10  bld Tbd1 5g3  in                        CBXT16465.b1 ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGC
  5   1   2       bld Egg  5g3  in                   TEgg002c14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAA
  5   1   2       bld Egg  5g                       TEgg053k11.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAA
  5   1   2       bld Egg  5g                        TEgg128e12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGGCCGAGAAGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAAGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAAGTGGTCGAGACCCTAAGGACGCAAGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGC
  5   1   2       bld Gas  5g                        TGas084h15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCT
  5   1   2       chi Gas  5x                        TGas123b08.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAACTTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCTGGCTCAGTTGGCATCACTGACCCCTGTGAAAGTGGCAACTTTAGGGTTCATACAGTCATGACTCTGGAGCAGCAAGACATGGGTTTGCTACACTGCCCAGACGTTGGTCCGTATTCTC
  5   1   2       bld Neu  5g3  in                   TNeu072i20.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGATGGGTGAACGATGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCATACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCATCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAATGTGGTCGAGACCCTAATGACGCATGATCCAGCTGAAGTTCTCACAATGCTGA
  5   1   2       bld Neu  5g                        TNeu100m14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGC
  5   1   2       bld TpA  5g3  in                   TTpA008o02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCCGGCTCAGTTGGCATCACTGACCCCTGTGAAAGTGGCAACTTTAGGGTTCATACAGTCATGACTCTGGAGCAGCAGGACATGGTTTGCTA
  5   1   2       bld Tbd0 5g3  in                       IMAGE:6977462                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGGAGAACGCCCTCCATTTCTCAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGGAGGAGTCGGGTTTCTGGGATTTTGACCTTCTGACTCCCTGGAATTCTGGGAACTCCTGGGGGCATTATGGCCGTCATGAAACAACCCCCCCCGGGCAGGCCCCTGGCACCTCAATGGGTCCCTAACAAAC
  5   1   2       bld Tad0 5g3  in                       IMAGE:6981962                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGGGCTGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCCTGGGGGCATTATGCCCGTCATGAAACACCCCCACCCAGGCAGCCCGCTTGGCACTCAAATGTGTCCCTAACAAACGGCTGCCCTACAGAATGGCTCGCCCGCCCCGGCCCTTTTTTCCTC
  5   1   2       bld Gas1 5g                            IMAGE:6987639                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGGTGGTTCGAGGGAGACGCCTCCCATTCTACAGTGAAGGTTTTTAATCCGGTTGTTGAAAGACTTGANGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCCACCAGGCAGCCGGCTGGCACTCCATGTGTTCCTACAAACGGCTGGCTTACAGGATGGCTCGGCCGCCGGGCCTTTTTCCCTCCCCCGGGCTTCANTTTGGCCAATCACCTGGAACCCCCTGGTGGA
  5   1   2       bld Neu0 5g3  in                       IMAGE:6991329                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCCACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGAACTCCTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGGCCTACAAAAGCTGCCCTACAGATGCTCGCCGGCCG
  5   1   2       bld Gas1 5g3  in                     NISC_mq22g03.y2                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCC
  5   1   2       bld Tbd0 5g3  in                     NISC_nl02g11.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATC
  5   1   2       bld Egg  5g                       TEgg138f22.p1kSP6w                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCA
  5   1   2       bld Neu  5g                        TNeu045b21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCGAGGCCGAGAGTTGTCCATTGTGCGGGAGTGTGAGAACGAAGACTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAA
  5   1   2       bld TpA  5g3  in                   TTpA020k20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACACCNCACCAGGCAGCCGCTGGC
  5   1   2       bld TpA  5g                        TTpA056l09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTA
  5   1   2       bld TbA  5g                        TTbA003m02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGNGGCATTATGCCGTCATGAACAACCCCATCAGGCAGCCGCTGG
  5   1   2       bld TbA  5g                        TTbA008g09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGC
  5   1   2       bld TbA  5g3  in                   TTbA017i22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTC
  5   1   2       bld HdA  5g                        THdA048h22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAA
  5   1   2   22  bld Gas7 5g                              XZG14701.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTNGAAGACTTGAGGAGTCGGT
  5   1   2   12  bld Tad5 5g3  in                         XZT37073.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCCGGCTC
  5   1   2       bld Gas8 5g                               st19b04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCANGCACGCACGGTGGTTCGAG
  5   1   2   10  bld Bone 5g3  in                        CBTC7985.fwd ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTAACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATT
  5   1   2       bld Egg  5g                        TEgg107c15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGA
  5   1   2       bld Egg  5g                        TEgg132p18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTG
  5   1   2       bld Gas1 5g3  in                       IMAGE:6990250                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGACGCCCTCCATTCACAGTGAGGTTTTATCCGGTGTTGAAGACTTGAGAGCGGTTCCTGGATTGACCTCTGACTCCTGATCTGGACTCTGGGCTTTGCGTCTGACACCCACAGCAGCCTGCCTCAGGTCTAACCTGCTCGA
  5   1   2       bld Gas1 5g3  in                     NISC_mq13b09.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAATATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTG
  5   1   2   22  bld Gas7 5g                              XZG17906.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCG
  5   1   2       bld Gas  5g                        TGas060c17.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATT
  5   1   2       bld Gas  5g                        TGas109g10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCCACGGTGAAGATCCTTATCACGACT
  5   1   2       bld Neu  5g3  in                   TNeu098d17.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCGCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCT
  5   1   2       bld Neu  5g3  in                   TNeu115b13.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGA
  5   1   2       bld Neu  5g3  in                   TNeu116i03.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGATCCAGCTGAAGTTCTCACAATGCTGACAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACA
  5   1   2       bld Gas1 5g                            IMAGE:6987608                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAAAGCGCACTGGCCGCCATCAAGGACGCACGGGGGTCCAGGAAAACCCCTCCCATTTACAGTGAAAGGTTTAATCCGGTTGTTGAAAGACTTGAGGAGGCCGGTTCCTGGAATTGAGCCTCTGACTCCCTGGATCCTGAACTCTGGGGGCATAAACT
  5   1   2       bld Gas1 5g                            IMAGE:6988171                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGGGCCGAGAGGTGTTTCTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAAGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCCGAGTTGCATTGGGACATCAAAGTTCCTGCAAAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAAAACGCCCTCCATTCTACAGTGAAAGGTTTTAATCCCGGTTGTTTGAAAGGACTTGGGGGACTCCGGGTTTCCTGGAAATTGGAGCCCTCTGAACTCCCCTGGAATCCTTGGGACCTCCTTGGGGGCATTAATGCCCGGTTTTTGAAAAACCCCCACCCCAGGCACACCCGCCCTGGCCACCTCAAAGGGTGGTGCCTACCAAAAACGCCGTGCCTTACCAAGAATGCCTTGTGCCTCCCCCGGCGCTTTTTTTCTCCCATCCCCGCGGCTCTCATTTAGGGGCCATTCATCTGGGAACCCCCCCGTGGTTGAAAAAAGTGGGGGGACAGACTTGTTTATGGGGGGTGTTTTCCATAAAAAAGGTTCTATATGTGAGACGCTCTCTGGGGAAGGCAGCCACTCTCG
  5   1   2       chi Gas1 5x                            IMAGE:6988399                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAAGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGGCACGGTGAAGATCCTTATCACGACTGTGCCCCCCCATCTGCGCAAGCTGGACCCCAAGTTGCATTTGGGACATTCAAAGTTTGTGCAAAACGCACTGGGCCCCCCTTTCGGGCCCCCCCGGGGGGGTTCAAGGAAAAAACCCCCCCCCTTTTCTTAAAGGGAAGGGTTTTTAAACCCCGGTTTGTTTTAAAAAAAACTTTTGAGAAAACCCGGGTTTTCCCGGGGAATTTTTGAAGACCCCCTTGAGAAACCCCCCGGGGAGAATTCCCGGGGGA
  5   1   2       bld Neu0 5g                            IMAGE:6994880                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTTCCTGGATTTTGAGCCTCTTGACTCCCCTGGGATCCTGGGGACCTCCTTGGGGGCAATTATGGCCCGTCATGGAAACAAACCCCCACCCAAGGCCAACCCCGCCTGGGCCACTTCCAATGGGTGGTCCCCTAAAAAAAACCGGCCTTGGCCCCTC
  5   1   2       bld Gas1 5g3  in                     NISC_mq13a09.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAATATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCG
  5   1   2       bld Gas1 5g3  in                     NISC_mq23a05.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATGGCGAAGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCT
  5   1   2       bld Gas1 5g   ?                      NISC_mq26d07.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTT
  5   1   2       bld Gas1 5g                          NISC_mq27d06.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGCCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGC
  5   1   2       bld Gas  5g                        TGas009e10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGGGCCGAGNGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAACTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCTGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCG
  5   1   2       bld TbA  5g   out                  TTbA071c22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTC
  5   1   2   14  bld Neu5 5g3  in                         ANHP2045.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACA
  5   1   2   24  bld Neu5 5g                              ANHP2889.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATG
  5   1   2   14  bld Neu5 5g3  in                          ANHP661.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTC
  5   1   2       bld Egg  5g                        TEgg005a02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAG
  5   1   2       bld Neu  5g                        TNeu088e09.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTT
  5   1   2       bld Neu  5g                        TNeu117c15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTAACAAACGAGACTGGCTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCT
  5   1   2       bld Gas  5g                        TGas016l04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGANAGGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAA
  5   1   2       bld Neu  5g                        TNeu046c13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGG
  5   1   2       bld HdA  5g3  in                  THdA029i18.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGAGAGGTTGTCCATTGTGCGGGAGTGCTGATGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCT
  5   1   2   24  bld Neu5 5g                              ANHP1528.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGTAAGCGGCCGGCTTGAAGGTTTGAGC
  5   1   2   12  bld Gas7 5g3  in                         XZG45794.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTNCATGT
  5   1   2   20  bld Spl2 5g                             CBSS3649.fwd ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCT
  5   1   2   20  bld Tail 5g                              CBSW2270.b1 ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTAACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACC
  5   1   2       bld Gas  5g3  in                   TGas061m15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCTGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGC
  5   1   2       bld Gas1 5g                            IMAGE:6987803                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGAGAGGTTGTCCATTGTGTGGCAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCNGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCAACAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCCGCCCTTTTCCTCCCCGGCTCAGTTGGGCATCACTGAACCCCTGTGGAAAGTGGCAACTTTTAGGGTTTCATTACAGTCATGGACTC
  5   1   2       bld Gas1 5g3  in                     NISC_mq01b07.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGG
  5   1   2       bld Neu0 5g   ?                      NISC_ng07e04.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGC
  5   1   2       bld Tbd0 5g3  in                     NISC_nl08d01.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCA
  5   1   2       bld Gas  5g                        TGas007l03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGGCCGAGAGGGTGTCCATTGTGCGGGATGTGAGAACGAAACTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAA
  5   1   2       bld Neu  5g                        TNeu024n09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGACTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGNCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGC
  5   1   2       bld Neu  5g                        TNeu028j05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGAGAGGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGACTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTNTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGG
  5   1   2       bld HdA  5g                       THdA013h12.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCNGTTTCCTGGATTTGAGCCTCTGACTCCCTG
  5   1   2       bld HdA  5g3  in                   THdA021m09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAAT
  5   1   2       bld HdA                            THdA039j02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGATCGAGGACGCTGGACGTGGTCCGCTGTTGGCTCCTTATGTGGGACCTTGCTCTGGTTTCCCAACCTTCTTCCCTCTGATTCCCTTTGATTTCCATCTGCGTGAATGTGGCCTTCCCGCTTGTGATACCCTCCCCCGATCATATCTCGTTCAACGAGTCACTGCTCAAACCAAACCAACATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGATGAGGTGCGACAGGTGGGCTCCTACATGAAAGGGACCATGATC
  5   1   2       bld HdA  5g3  in                   THdA046n02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCNGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTC
  5   1   2   10  bld Thy1 5g3  in                       CBST10258.fwd ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCT
  5   1   2       bld Egg  5g3  in                   TEgg078a17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCT
  5   1   2       bld Gas  5g                        TGas085j06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGG
  5   1   2       bld Gas8 5g                              st101i16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCGTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCANGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCANCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTG
  5   1   2       bld Egg  5g                        TEgg112m11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGG
  5   1   2       bld Gas1 5g   ?                      NISC_mq10d04.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATC
  5   1   2       bld Gas1 5g                          NISC_mq24a03.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGATACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCT
  5   1   2       bld Neu  5g                        TNeu001l16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCGANAGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGACTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTC
  5   1   2       bld Neu  5g                        TNeu045p10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCGAGAGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGACTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCTGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTG
  5   1   2       bld Egg  5g3  in                   TEgg001h07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCA
  5   1   2       bld Gas  5g                        TGas035o21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCCATTGTGCGGGAGTGTGAGGAACGAAGACTGAAACATGAAGTGCGGGGGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGC
  5   1   2       bld Gas  5g                        TGas038m08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCGAGAGGTGTCCATTGTGCGGGAGTGTGAGAACGAANACTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCG
  5   1   2       bld Neu  5g                        TNeu017j20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCGANGGTTGTCCATTGGCGGGAGTGTGAGAACGAANATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGG
  5   1   2       bld HdA  5g3  in                   THdA011d03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCGGGGGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGGTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGG
  5   1   2   14  bld Te5  5g3  in                         CAAO1556.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCCTCTGGGGCATTATGCCGTCATGAACAA
  5   1   2   12  bld Gas7 5g3  in                         XZG51197.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGNGGCATTATGCCGTCATGAACAA
  5   1   2   22  bld Gas7 5g   ?                          XZG57745.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTC
  5   1   2   10  bld Eye  5g3  in                         CCAX9279.b1 ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGA
  5   1   2       bld Neu  5g3  in                   TNeu069o12.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGAGAGGTGTCCATTGTGCGGGAGTGTGAGGACGAATTCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGATCCAGCTGAAGTTCTCACAATGCTGACAACGAAACTGGCTTTGAGATCAGCTCAGCA
  5   1   2       bld Tbd0 5g3  in                     NISC_nl15f08.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGATTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGC
  5   1   2       bld Gas  5g                        TGas039h06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTA
  5   1   2       bld Egg0 5g3  in                         dad76f01.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGGGGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGA
  5   1   2       bld Gas1 5g                            IMAGE:6989860                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGGAGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCNGTTTCCTGGATTTGAGCCTCTGACTCCC
  5   1   2       bld TpA  5x3  out                  TTpA052f22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATTGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCANGCACGCACGGTGGTTCGAGGAGACGCCTCCCATCTACAGT
  5   1   2       bld TbA  5g3  in                   TTbA014p22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGGTGTCCATTGTGCGGGTGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGC
  5   1   2       bld HdA  5g                        THdA008a19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAA
  5   1   2       bld 1030 5g                         IMAGE:7092022.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAGACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTGACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAG
  5   1   2       bld Gas1 5g                            IMAGE:6988913                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAAATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCATCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAAGCACGCACGGTGGTTCCAAGGAGAACCCCTCCCATTTCTACAGTTGAAAGTTTTTAATCCGGGTTGTTGAAAGACTTGGAGGAGTCCGGTTTCCTGGGATTTGAGCCTCCTGACTCCCCTGGATCCTTGGGACCTCCTGGGGGCACTTATGCCCGTCATGAAACAAACCCCCCCCAGGCAACCCGCTTGGCACTCCAATGTTGTCCTTAAAAAAACGCTTGGTCCTAACAAAATAGCTCGCCCGTCCCGGGCCCTTTTTTCCTCCCCCCGGGGATCACAATTGGGGCATCTACCTTGAACCCCCCCTGGGTGAAAAAGGTGCCCAACTCTTTTAGAGGGGTTCTATAACAAGGTTCATTGAAAACTCCTG
  5   1   2       bld Gas  5g                        TGas040m02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTNTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGNCCAATCTGCGCAAGCTGGACCCCGAGTTG
  5   1   2       bld Neu  5g                        TNeu040h21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGACAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCCCCCCCGACGATAGCTCATTCAGCTAGTCACTGTTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAACAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTTTCCCCGGGAAACTGTCAACTGCAAATTGAACATGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGATCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAATGTGGTCGATACCCTAACGACGCACGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGTCCAATCTGCGCAAGCT
  5   1   2       bld Neu  5g                        TNeu048c20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGACTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCAT
  5   1   2   14  bld Te5  5g3  in                         CAAO6297.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTC
  5   1   2       chi Gas7 5x3  in                         XZG48614.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGCCTGGAGGGAGATGCCAGCGCTCTTGCCACGGAAATGTCTACCTGGGACGGAGTCATCGTGACCCCTTCAGAGAAGGCCTATGAGAAGCCCCCCGAGAGGAAGGAGGGAGAGGAGGATGAGAACCAGGATATCCCAGAGGGGGCGGAAGAGGAGGAGAGCATGGAGACACAGGAGTGATACTTATTTAAAGATTTCAGTTGGTCTGGATCCCCCTCTGCCGGCGCCGAACACATTGGGTCTATTTGTGGACCANATGCCACGAGTTCCTGTTTTATTTTCATTCGTTCTTAGCTTGTCATGTGACTTGTTTTATACTGTAGGGATACATTGTATTTTTTTTTTTTTTTTGCCAGCAATAAATTTTTATTTCGAC
  5   1   2       bld Neu  5g                        TNeu137e08.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTGTCCATTGTGCGGTTAGTGTGAGGAACGAAGATCTAAAACCGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGGCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTGGGGGGGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGGCCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGGTTCTGCTTTG
  5   1   2       bld Gas8 5g                               st11p18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTG
  5   1   2       bld Gas1 5g3  in                       IMAGE:6989442                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGATCTTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTTATCCGGNTTGTGAANNGACTGAGGAGTCNGTTTCCCTGGATTNGAGCTCTGACTCCCTGGATCCCTGGACTCTGNGGGCATATGCGTCATGAACAACCCCCACAGCAG
  5   1   2       bld Neu  5g                        TNeu002f23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGG
  5   1   2       bld Neu  5g                        TNeu032c06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCATTTGGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGG
  5   1   2       bld Neu  5g                        TNeu033d05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTGTCCCTTGTGCGGGAGTGTGAGGAACGAAATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGAC
  5   1   2   14  bld Neu5 5g3  in                         ANHP1589.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAAC
  5   1   2   14  bld Neu5 5g3  in                         ANHP2920.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAA
  5   1   2       bld 1030 5g                         IMAGE:7091322.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAG
  5   1   2       bld Gas  5g3  in                   TGas088k12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGAGGTCG
  5   1   2       bld Tad0 5g                            IMAGE:6985325                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCTTGAACTCTTGG
  5   1   2       bld Gas  5g                        TGas048o23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGTCCATTGTGCGGGAGTGTGAGGAACGAGGTCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGAGGGGGCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCANCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCT
  5   1   2   12  bld Gas7 5g3  in                         XZG31407.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCCTCTGNGGCATTATGCCGTCATGAAC
  5   1   2   12  bld Gas7 5g3  in                         XZG44467.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCCGCGGNCTTTTCCTCCNCGGCTCAGTTGGCATCACTGACCCCTGTGAAAG
  5   1   2   10  bld Thy1 5g3  in                         CBST563.fwd ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCTGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGA
  5   1   2   10  bld Tbd1 5g3  in                        CBXT18359.b1 ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGG
  5   1   2       bld Neu  5g                        TNeu099g09.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGATCCAGCTGAAGTTCTCACAATGCTGACAAA
  5   1   2       bld TpA  5g                        TTpA053c02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGT
  5   1   2       bld TbA  5g                        TTbA018o06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCCTTGTGCGGGAGTGTGAGGAACGACGTTCTTTTTACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCANAGTTCTGCAGAGCGCGCTGGCCGCCA
  5   1   2   14  bld Brn4 5g3  in                         CAAL8280.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGNGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCG
  5   1   2       bld Gas8 5g                               st40c02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCAC
  5   1   2       bld Neu  5g                        TNeu006d07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTGTCCATTGTGCGGGATGTGAGAACGAAACTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGC
  5   1   2       bld TpA  5g3  in                   TTpA077m01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCCTTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGNGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTNCATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCC
  5   1   2       bld TbA  5g                        TTbA002b06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGC
  5   1   2       bld TbA  5g                        TTbA034d03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCCTTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTNCATGTGTCCTACAAACGCTGCCTACAGATGCT
  5   1   2       bld TbA  5g3  in                   TTbA054f05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCNCTGGCTCAGTTGGCATCACTGACCCCTG
  5   1   2       bld Gas7      in                         XZG10820.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCTGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTNCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCACCAGGCAGCCGCTGGCACTCAATG
  5   1   2   22  bld Gas7 5g                               XZG8679.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCG
  5   1   2       bld Gas8      out                         st83e14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAG
  5   1   2   10  bld Thy1 5g3  in                        CBST5682.fwd ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCNCATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGG
  5   1   2       bld TpA  5g3  in                   TTpA011e10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCTCCCTGGCTCAGTTGGCATCACTGACCCCTGTGAAAGTGGCACTTTANGGNTCATACAGTCATGACTCT
  5   1   2       bld Gas1 5g3  in                     NISC_mq03h08.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCA
  5   1   2   22  bld Gas7 5g                               XZG8505.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGNGGCATTATGCCGTCATGAACAACCCCA
  5   1   2       bld Gas8 5g                               st31e18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAA
  5   1   2       bld Gas8 5g                              st111b04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCANAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACA
  5   1   2       bld Gas8 5g                               st24d16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTT
  5   1   2       bld Gas8 5g                               st99i16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGG
  5   1   2       bld Gas8 5g                              st100i16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCGTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGA
  5   1   2       bld Gas8 5g                               st79c08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAA
  5   1   2       bld Gas8 5g                               st88b13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAA
  5   1   2   10  bld Eye  5g3  in                         CCAX7866.b1 ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGGAGAACGCCTCCCATTCTA
  5   1   2       bld Gas  5x3  out                  TGas141k14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGTGCGGGAATGTGAGGAACGAAAATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCAT
  5   1   2       bld Neu0 5g                            IMAGE:6995866                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACCACCCCACCAGGGCAGCCGGCTGGGCACTTCAATGTGGTCCCTACAAAACGGCTGCCCTAACAGAATGGCTCGGCCCGCCGGC
  5   1   2       chi 1030                            IMAGE:7028408.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGACTTCCCGCGTGTGAAACCCGCCCCCGACGATATTTTATTCAGCGAGTCACTGCTCGAACTAAACCAAGATTTGGTCCCCAGCACAGCCGAGTAGGCCTCAATCCTTTCTTTGGTCACCAAAATGAACAACGTTATCGACAATTTGGTCGTACCGCCCGGGTAAACTTTTGAGAGGGCTGTATTTGAGGTAACGTGGCCGACAAGGGGGGGTCTTCCTGTCCTAGGCAGGAGGGGTACCCGCGTGGGGTTTTATACGGCCTTATGGGACTGGGATCGCGGGCAAAATTTTTGTGGGATCACCCCTTCGTTTCTGGGTTAAAGGGAAATTCGCCGCATGTACTCGCAATATTACGGTTTATAAAAAAATAAGATCTGCTCAAATATCTGGCGTCCACTTGGCGCGCCCTTTTCCGTCGTGATAGGAGGGGGTGGTTCTAATCTCATCGTTTTANTCCGCCCCGTGGCCTGGTATACCGCGTTTATCTCGCCGATTTAAACAAATTTATACGAAGGGCGGCCATGCTCCTGATTATCATAAAAACGCCCGTATCACCCACTATACTCTCCATAGACGAGGGGACTTATATTTTGATCTGTTAGTAAAAGCCTCGGGGGATCCTGGCGGGTTATTTATGTTGCGCCTCCCGCGAACAAGTAGCGGTGAAATGTGCGCGACCCCGCTATATAATACTTTATACCTCTCGCGCGTTCGCCCGTTATATTACGGTGGGCGGGTAACACGCTCTAAAATATCTCGCCCGACCTTACCACCCTCCCCCGTTTCTTTAGTCCGCTGGACGCACCCTTTCTCTCGTCGCGTGTTTTCGAGGGATCTAGNTTTATTACGGCGCATTTCGCGTACCTATTTGGGGCCGGACACAACACGGGAGTCTGCGCTACTCAATGGCACGCAGAACTACAGTGCGTAGCCTCTCAACCGN
  5   1   2       bld Gas8 5g                               st58m15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAG
  5   1   2       bld Gas8 5g                               st97e01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGT
  5   1   2       bld TpA  5g   ?                    TTpA014a01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCGGGAGTGTGAGGAACGAAGATCTGACACATGAGGGGTGAACGAGGACGTGGACGTGGCCGACTTTGGCTCCAGAGTGGGACCTAACACGGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAACTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAGAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGCGGCATTATGCCGTCATGAAC
  5   1   2   12  bld Tad5 5g3  in                         XZT36713.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGNGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTC
  5   1   2   12  bld Tad5 5g3  in                         XZT59817.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACACCCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCT
  5   1   2       bld Gas8 5g                               st89b13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTGCGGGAGTGTGAGGAACGAAGATCTGANACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTT
  5   1   2       bld Egg  5g                        TEgg139m11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGC
  5   1   2       bld TpA  5g3  in                   TTpA041a22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCTGGCTCAGTTGGCATCACTGACCCCCTGT
  5   1   2       bld HeRe 5g                          EC2CAA37CD07.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAAATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCCAAAT
  5   1   2       bld Te5       in                         CAAO2394.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAAC
  5   1   2   22  bld Gas7 5g                              XZG51810.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCC
  5   1   2       bld 1030 5g                         IMAGE:7030623.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAG
  5   1   2       bld Neu  5g3  in                   TNeu071n07.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCGGGAGTGTGAGGAACGAAGATCTGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGC
  5   1   2       bld Neu  5g3  in                   TNeu102d20.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCGCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGG
  5   1   2       bld 1030 5g                         IMAGE:7028601.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTG
  5   1   2       bld Neu  5g3  in                   TNeu068l17.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCT
  5   1   2       bld Gas  5g3  in                  TGas089c22.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCTGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCA
  5   1   2       bld Gas1 5g3  in                     NISC_mq17g03.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGC
  5   1   2       bld Gas  5g                        TGas044p02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCTGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCAT
  5   1   2   14  bld Gas6 5g3  in                         ANBT3273.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGNGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTTCCTCCCCGGCTC
  5   1   2   12  bld Gas7 5g3  in                         XZG34419.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCT
  5   1   2       bld Egg  5g                        TEgg052h21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGGAGTGTGAGGAACGAAGATCTGAAAATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCG
  5   1   2       bld Gas1 5g3  in                       IMAGE:6990393                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATCCGGGAGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCNGTTTCCTGGATTTGAGCCTCTGAACTCCCTGGATCTGGACCTCTGNGGCATTATGCGTCATGAACACC
  5   1   2       bld Gas1 5g3  in                       IMAGE:6990461                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGGGATGTGAGGAACGAAGATCTGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTTAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGNNACTCTGNGGCATTATGCCGTCATGAACAACCCCACCANNGCAGCGCTGGGCACTCATGTGTCCTACAACGCTGCCTACGATGCTCGCGCN
  5   1   2       bld Neu0 5g                            IMAGE:6995788                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAAGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATTCCGGAACCTCTTGGGGGCATTTATGCCGTCATGAAAACAACCCCACCAGGCAACCCGCTGGGCGCCTCCATGGTGTCCCTACAAAACGGCTGGCCCTACAAGAA
  5   1   2       bld Neu  5g                        TNeu047e22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCCCCGGGGTGAGGAACAAGACTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGG
  5   1   2       bld Tbd0 5g                            IMAGE:6976396                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGGAGGTTTTTAATCGGTTGTTGAAAGACTTGAAGAGTCGGTTTTCTGGGATTTGAGCCTCTGACTCCCCGGGATCCTGGAACTCCTGGGGGCAATATGCCCGTCCTGAACAACCCCCCCAGGGCAGCCGCTGGGCCCCCAATGGGTTCTAAAAAAGGCTTCCCTACAAAAGCTCG
  5   1   2       bld Gas1 5g                            IMAGE:6987163                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGAGTGTGAGGAACGAAGATCTGAAACTGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAAGAGTCGGTTTCCTGGANTTGAGCCTCTGACTTCCTGGGATCTGGACCTCTTGGGGCATTATGCCGTCATGACA
  5   1   2       bld Neu0 5g                            IMAGE:6993620                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGAGTGTGAGGAACGAAATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGGACCTCTTGGGGCATTATGCCGTCATGGACAACCCCACCAGGCAGCCGCTGGGCACTCAATGTGGTCCTACAAAACGCTGCCCTACAGGATGCTTCCCCG
  5   1   2   12  bld Gas7 5g3  in                         XZG60179.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTGCAAAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTC
  5   1   2   14  bld Te5  5g3  in                         CAAO1172.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCCGGCTC
  5   1   2       bld 1030 5g                         IMAGE:7027594.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAG
  5   1   2       bld TbA  5g                        TTbA038k01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGTGTGAGGAACGAAGATCTGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCANAGTTCTGCAGAGCGCGCTGGCCGCCATCANGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTA
  5   1   2   14  bld Neu5 5g3  in                         ANHP2417.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCG
  5   1   2   22  bld Gas7 5g                              XZG62658.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGA
  5   1   2       bld Tbd0 5g3  in                       IMAGE:6977529                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGGCATTATGCCCGTCAGGAACAACCCCACCAAGGAAGCCCGCTGGCACTCAATGGGGTCCTAAAAACGCTGCCCAACAAAATGCTCGCCGCCGGCC
  5   1   2       bld HdA  5g                       THdA016n09.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGTGAGGAACGAAGATCTGAAACATGAGCGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCATAGCGCGCTGGCCGCCATCAAGCAGNCACGGTGAGTTCGAGGAGAACGCCTCCCATTCTACAGGTGAAGGTTTTAATGCCGAGTTGTTGATAGACTTGAAGGAGTCAGTTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCTTGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTAC
  5   1   2       bld HdA  5g                       THdA037c15.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGTGTGAGGAACGAAGATCTGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCCGNCACGGGTGGTTCGAGGAGAACGCCTCCCATTNCTACAGTGAAGGTTTTNAATCCGGGTTGTTGAAAGACTTGANGGAGTCGGTTTCCTGGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCT
  5   1   2   20  bld Ski1 5g                              CABJ9067.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATCGGCACGAGGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCCGCGGCCTTTTCCCTCCCGGCTCAGTTGGCATCACTGACCCCTGTGAAAGTGGCAACTTTAGGGGTCATACAGTCATGACTCTGGAGCAGCAGGACA
  5   1   2       chi Gas7 5x3  in                         XZG50657.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTGTAAGTGCCGCTGTGTCCGGGCAGTCAGCTGACCCGCTGCGTACCCCCCATTCTCGCTAACACCCTTTCCTCCTTACAGTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTC
  5   1   2       bld Tad5      in                          XZT4204.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGNGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTTCTCCCCGGCTCAGTTGGCATCACTGACCCCT
  5   1   2   10  bld Tbd1 5g3  in                         CBXT2949.b1 .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCT
  5   1   2       bld Egg  5g                        TEgg060n05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGGGGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCAT
  5   1   2       bld Neu0 5g3  in                       IMAGE:6991383                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGGACTCTTGGGGCATTATGCCGTCATGAACAACCCCCACCAGCAGCCGCTGGCACTCAATGTGGTCCTACAACGCTGCCTACAGAGGCTCGCCGGCCGGCCTTTTTCTCCCCGGGCTCAATTGGCATCACTGAACCCCTGGGGAAAGT
  5   1   2       bld Neu0 5g                            IMAGE:6994762                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTGTGAGGAACGAAGATCTGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTTCATGGTGTCTACAAACGCTGCCTACAGATGCTCGCCGCCCGGCCTTTTCTTCCCCGGCTCATTTGGGCATCCCTGACCCCCGGTGAAAGGTGGCCACTTTTTAGGGTCATTACCGGTCTT
  5   1   2       bld HdA  5g3  in                  THdA010h19.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTTCTCCCTGGCTCAGTTGGCATCACTGA
  5   1   2       bld HdA  5g                        THdA047p22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCNCTGGGCTCAGTTGGCATCACTGACCCCTGTGAAAGTGGCAACTTTTAGGGTTCATAC
  5   1   2   24  bld Gas6 5g                              ANBT2463.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGNGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCG
  5   1   2       bld Gas8 5g                               st39j21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCANG
  5   1   2       bld Neu  5g                        TNeu016m03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGATTCCCTCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTAACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCT
  5   1   2       bld Neu  5g                        TNeu039m13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCTAATGATTCCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGG
  5   1   2       bld HdA       in                   THdA021b17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGAGGAACGAAGATCTGAAACATGAGGCGGTGTACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAAACACCCCACCAGGCAGCCGCTGGCACTCAATGTGTTCTACAAACGCTGCCTACAGATGC
  5   1   2   20  bld Tbd1 5g                              CBXT9252.b1 ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGC
  5   1   2   20  bld Eye  5g                              CCAX8795.b1 ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGGCACTGGGCCGCCATCAGCACGCACGGTGGTTCGAGGAGA
  5   1   2       bld Egg  5g                        TEgg125a08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCG
  5   1   2       bld Neu  5g3  in                   TNeu056b06.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTT
  5   1   2       bld Gas1 5g                            IMAGE:6989116                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGAGGAACGAAGATCTGAAACTTCAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTTATGCGTCATGAAACAACCCCCCCAGGCCAGCCGCTGGGCACTCAATGGGTTCTTACAAACGCCTGCCTAACAAATGCTTCGCCCGCCGGGCCCTTTTTCTTCCCCCGGGCTCAATTTGGGCATCCCCTGAACCCCCTGTGTGAAAAGTGGGCAAACCTTTTAGGGGGTTTCATAACCAGGTCCATGGAACTTCTTGGGGAACACACCCC
  5   1   2       bld Neu0 5g3  in                       IMAGE:6991715                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTGAGGAACGAAGATCTGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGANGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGNACTCTTGGGGCATTATGCCGTCATGAACAACCCCCACCAGGCAGCCGCTGGCACTCAATGTGGTCTACAAACGCTGGCCTACAGAATGCTCGCGCCGGGCTTTTTCCTCCCCGGGCTTCAATTGGCATCACCTAACCCCCTGGTAAAAGTGGGCAACTTTAGGGGTTCCATACAG
  5   1   2       bld Gas  5g                        TGas001a09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGG
  5   1   2       bld HdA  5g3  in                   THdA021b15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGC
  5   1   2   20  bld Eye  5g                              CCAX5699.b1 ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGA
  5   1   2       bld Egg  5g                        TEgg094n22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCAC
  5   1   2       bld Gas1 5g                            IMAGE:6987287                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACT
  5   1   2       bld TpA  5g3  in                   TTpA045i19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGGAACGAAGATCTGAAACATGAGGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCTGGC
  5   1   2       bld Egg  5g3  in                   TEgg044b03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGAGGACGAAGACTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACG
  5   1   2       bld Gas  5g                        TGas056m22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAAGTGGTCGAGACCCTAAAGACGCAAGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGG
  5   1   2       bld Gas  5g3  in                   TGas064g05.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCTGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGC
  5   1   2       bld Gas  5g3  in                   TGas067m11.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGG
  5   1   2       bld Gas  5x3  out                  TGas118f13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGAACCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCG
  5   1   2       bld Gas  5g3  in                   TGas126g22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCTGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGC
  5   1   2       bld TpA  5g3  in                   TTpA034c23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGC
  5   1   2       bld Neu0 5g3  in                       IMAGE:6992878                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTTCCTCCCGGCTCAGTTGGCATCACTGAACCCCTGTGAAAGG
  5   1   2       bld Neu0 5g   ?                      NISC_ng27g04.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGC
  5   1   2       bld Neu  5g                        TNeu048d07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGAGAACGAAACTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGG
  5   1   2   12  bld Gas7 5g3  in                         XZG53707.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGGCTACAGATGCTCGCCGCCCGC
  5   1   2   12  bld Tad5 5g3  in                         XZT68817.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCG
  5   1   2       bld Neu  5g3  in                   TNeu105i14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACA
  5   1   2       chi Tbd0 5x                            IMAGE:6979554                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GATCGAAATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCGTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCTTCCTTATGATTCTTCCCACACTGGAAGCCTTTTCTGCTTCATGCATTTATGTGAGTCTGTACTTCTAGGACGCCATATCTTTCTTCATACTCCTTGAACGATTCCTATATCGTACGCCTTTTATTTCTTCTCTTTTTATTGTACTCTCTCGATCTCTAAGATCTCTCTCCCTCACATCATTGTATATAGATTCGCACATTATCTTTTTCCGAAATCTAGACAGTCACCACAAATATTCACTTTGACCTTATCAACCACATACTCGATTCTTATGATAACCTTATCTTCTCCATTCTCTGTTACTTCTCATCTCTACATTCCACCACTATAACTTTCTTGGATTTGTTTT
  5   1   2       bld Neu  5g                        TNeu003a14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGAACGAAACTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTG
  5   1   2       bld Neu  5g                        TNeu044i10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGACGAANTCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTAACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCAC
  5   1   2       bld HdA  5g                        THdA052b13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCCGGCTCAGTTGGCATCACTGACCCNCTGTGAAGTGGCAACTTTAGGGTTCATACAGTCATGACTCTGGA
  5   1   2   14  bld Te5  5g3  in                        CAAO10054.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAA
  5   1   2       bld Te5       in                         CAAO4292.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGNGGCATTATGCCGTCATGAACAACCCCCACAGGCAGCCGCTGGCA
  5   1   2       bld Egg  5g3  in                   TEgg035e01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCAT
  5   1   2       bld Gas  5g                        TGas007o01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAACGAAGACTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCTGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCAT
  5   1   2       bld TpA  5g                        TTpA074i12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGG
  5   1   2       bld Gas8 5g                               st63k10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTG
  5   1   2       bld Neu  5g3  in                   TNeu069k24.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGATTCTGCTTTGGGCA
  5   1   2       bld HdA  5g3  in                   THdA007k09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AACGAAGATCTGAAACTGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTT
  5   1   2       bld Gas8 5g                              st107p06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGT
  5   1   2       bld Egg  FL   in                   TEgg033l23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACGCTTCGTCCCTCACATTCCCTTTGATTTCCACGATGTGTGAAATGGCCTTCCCGCATGTGAAACCCGCCCCCGACGATAGCTCATTCATCGAGTCACTGCTCAAACGAGACCGAGATCTGGCCCCCAGCACAGGCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGAATCCCCGGGAAACTTTGAAGTGCAGATTGAACAGGTGCGACAGGTGGGCTCCTACTAGAAAGGGACCATGAACACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCAAGACCCTAAGGACGCTCGATCCAGCTGAAGTTCTCACGATGCTGACTAACGAAACTGGCTTTGAGATCAGCTCATCAGACGCCACGGTGAAGATCCTTATCACGACTGAGCCGCACAATCTGCGCAAGCTGGACCCCGAGTTG
  5   1   2       bld Egg  5g                        TEgg098g09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACGAAGATCTGAAAATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGC
  5   1   2       bld Gas1 5g                            IMAGE:6987516                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACGAAGATCTGAAACTGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCCGTTTCCTGGATTTGAGCCTCTGACTCCCGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGACAAACCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAC
  5   1   2       bld TbA  5g3  in                   TTbA069p03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACGAAGATCTGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGNGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTNCATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCTCCC
  5   1   2       bld HdA  5g3  in                  THdA018k09.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGAGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCGGCTCAGTGGCATCACTGACCCCTGTGAAAGTGGCAACTTAGGGTTCATACAGTCATGACTCTGGAGCAG
  5   1   2   12  bld Gas7 5g3  in                         XZG40581.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTCCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTGGGGCATTATGCCGTCATG
  5   1   2   22  bld Gas7 5g                               XZG9179.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GACGAGATCTGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCTGGCTCAGTTGGCATCACTGACC
  5   1   2   22  bld Tad5 5g                              XZT32754.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGNGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCCGGCCTTTCCTCCCCGGCTCAGTTGGCATCACTGACCCCT
  5   1   2       bld Gas  5g                        TGas059l08.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAG
  5   1   2       bld Gas  5g                        TGas046g13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTNTAATCCGGTTGTTGAAAGAC
  5   1   2       bld Neu  5g                        TNeu031m14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACT
  5   1   2   22  bld Gas7 5g                              XZG13711.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGAGATCTGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTC
  5   1   2       bld 1030 5g                         IMAGE:7091635.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAG
  5   1   2       bld Gas  5g3  in                   TGas115g20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGCGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCTGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTC
  5   1   2       bld Egg  FL   in                   TEgg021l09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGACTGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGG
  5   1   2       bld Tad5      in                          XZT4706.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGATCTGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCGGCTCAGTTGGCATCACTGACCCCTGTGAAAGTGGCAACTTTAGGGTTCATACAGTCATGACTC
  5   1   2       bld Gas8 5g                               st18e14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATCTGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTG
  5   1   2       bld Egg0 5g                              dad72f09.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTG
  5   1   2       bld Neu0 5g                            IMAGE:6994609                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGAAAATGATGGGTGAACGACGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAGACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCACGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAACGTTTTAATCCGGTTGTTGACAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATACTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCCACAGGCAGCCGCTGGGCACTCAATGTGTCCTACAAACGCTGCCTACAAAATGCTCGCCGCCCGGGCTTTTTTCCTCCCCCGGGCTCCGTTTGGCAATCACTTGACCCCTTGTGAAAAATGGGGCAAACTTTTAGGGGGTTCATTACACCTCT
  5   1   2       bld Neu0 5g                            IMAGE:6995315                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGGCAGCCGCTGGCACTCAATGTGTTCCTACAAACGCTGCCCTACAGATGGCTCGCCCGCCGGCCTTTTTCCNTCCCCCGGCTTCAATTTGGCCATCCACTGAACCCCCTGGG
  5   1   2       bld Gas  5g                        TGas024p15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCTGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGG
  5   1   2       bld Gas  5g                        TGas044d04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGC
  5   1   2       bld Gas  5g                        TGas044n23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCC
  5   1   2       bld Neu  5g                        TNeu019m02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCTCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGNCCAATCTGCGCAAGCT
  5   1   2       bld Te5                                  CAAO3738.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGAAAATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGG
  5   1   2   22  bld Gas7 5g                              XZG27121.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCTGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCCGGTTGTTGAAAGACTTGAGGGAGCGGG
  5   1   2       bld Gas8      out                        st108p06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTGCCCCGGGCTGGTGCTGTTTTCTCCTAACAGGGGCACCAGCCCGGGGTACGAGGTAAGCGGTTAAAGTCACTTGGGGGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACNATAGCTCATTCANCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTANCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAA
  5   1   2       bld Gas8 5g                               st34j02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCC
  5   1   2       bld Gas8 5g                               st36a22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGG
  5   1   2       bld Gas8 5g                               st44b21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCCAATCCTTTCTTTGGTCACCAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTNGANGTGCAAAT
  5   1   2       bld Gas1      in                     NISC_mq11g01.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCAC
  5   1   2       bld Gas                            TGas036i22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTTATTTGGCTTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCATCACATCTGAGCATGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGCTACCCCGGGAAACTTTGAATTGCAAATTGAATAGGT
  5   1   2       bld Gas7                                 XZG43984.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGNGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACANGATGCTCGCGCCGGCCTTTTCCTCCTGGCTCANTGGCATCACTGACCCCTGTGAAGTGGCAACTTAGGGTTCATAC
  5   1   2       bld Spl1      in                         CABK1733.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCCGGCTCAGTTGGCATCACTGACCCCTGTGAAAGTGGCAACTT
  5   1   2       bld In62                            IMAGE:8954268.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGGTTGAACGAGGACTGGACTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGACGCCATCAGGCACGCACGGTGGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCCGGTTGTTGAAAAACTTGAGGAGTCGGGTTTCTGGAATTGGAGCTTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATAATGCCGTCATGAACATCCACACAAGGCAGCCGCTGGCACTCAAAGTGGTCTAACAACGCTGCCTACGAATGCCCGCCCGCCGACTTTTCCTCCTGGGCCAATGGCATACTGACCCTGGGAAAGGCACTTAAGGTCTAACAGTCTGAACTTGGAAGCAGAGACTGGTTGCAACTGGCAAGACTGTCGGTATTCCTCCAGTGCTTCGGAAATTGGGCCTGAGAGGATATAGCCACGCTCTCTGCACAG
  5   1   2       bld Gas                            TGas016p22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTG
  5   1   2       bld Brn4      in                        CAAL23231.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGGCGCCGGCCTTTTCCTCCCCGGCTCAGTTGGCATCACTGACCCCTGTGAA
  5   1   2       bld Gas7                                 XZG45464.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGC
  5   1   2       bld Tbd1      in                        CBXT21043.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCCGGCT
  5   1   2       bld Hrt1      in                         CAAQ6868.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTT
  5   1   2       bld Lun1      ?                          CABD9101.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGNGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTTCCTCCCCGGCTCAGTTGGCATCACTGACCCCTGTGAAAGTGGCAACTTTAGGGTTCATACAGTCATGACTCTGGAGCAGCAGGACATGGTTTGCTACACTGCC
  5   1   2       bld Sto1                                CABG10109.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCCGGCTCAGTTGGCATCACTGACCCCTGTGAAAGTGGCAACTTTAGGGTTCATACAGTCATGACTCTGGAGC
  5   1   2       bld Gas                            TGas014h04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCTGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGG
  5   1   2       bld TpA       in                   TTpA019i19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GACGTGGCCGCATTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGATAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCC
  5   1   2       bld Gas8                                   st4d15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGTGGCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCC
  5   1   2       bld Gas8      out                        st111e20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCGCTTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCCCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTANCCCCGGGAAACTTTGAAGTGCANATTGAGGAGGTGCGACAGGTGGGCTCCTACAANAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAGAGTTCTGCAGAGCGCACTGGCCGCCATCAG
  5   1   2       bld Lun1      in                          CABD664.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGCTTTGGCTCCGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCCGGCTCAGTTGGCATCACTGACCCCTGTGAAAGTGGC
  5   1   2       bld TbA                            TTbA003e23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTGGCTCCAGAGTGGGACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAGACCCGCCCCCGACGATAGCTCATTCGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACTGGTGGGCTCCTACCAGAAGGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGTGTTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAATGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCAGTTTCCTGGATTTGAGCCTCTGACTCC
  5   1   2       bld Gas7      in                         XZG39997.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGAGTTTGTTGGTCTAGTGTGGCTGTATCGAGGGCCGAGAGGGTGTCCATTCCCTTTGATTTCCACGTGTGTGAAATGGCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTGCAAAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGC
  5   1   2       bld TbA                            TTbA075l09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACCTAACACAGGTTTCAGACCCTTCGTCCCTCACATTTCCTTTGATTTTCCACGCGTGTGAAATCGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTTCAGCGAGTCACCGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTTTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTTCCACACTGGAAGCCGTTTTTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGAC
  5   1   2       bld Thy1      in                        CBST1560.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCTGTATCGAGGGCCGAGAGGTTGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCCCCCGGCTCAGTTGGCAT
  5   1   2       bld Gas7      in                         XZG51878.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTGGCTGTATCGAGGGCCGAGAGGGTGTCCATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCG
  5   1   2       bld Gas       in                   TGas055g05.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCGAGGGCCGAGAGGGTGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGT
  5   1   2       bld Gas7                                 XZG13487.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCCGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCCGGCTCAGTTGGCATCACTGACCCCTGTGAAAGTGGCAACTTTAGGGTTCATACAGTCATGACTCTGGAGC
  5   1   2       bld Gas1      in                       IMAGE:6981207                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGAGGGCCGAGAGGTTGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCCGGCCTTTTCCTCCCCGGCTCAGTTTGGCATCACTGACCCCCTGTTGAAAGTGGCAAACTTTTAGGGTTTCAATACAGTCCATGGACTTCTGGGAGC
  5   1   2       bld Spl1      in                         CABK7831.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGGTTTAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCCGGCTCAGTTGGCATCACTGACCCCTGTGAAAGTGGCAACTTTAGGGTTCATACAGTCATGACTCTGGAGCAGCANGACATGGTTTGCTACACTGCCCAGACGTTGGTCCGTATTCTCTCCCACGGGGGCTTC
  5   1   2       bld Gas8      out                         st97h17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATNGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACNGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGG
  5   1   2       bld TbA                            TTbA011c02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCCGGCTCAGTTGGCATCACTGACCCCTGTGAAAGTGGCAACTTTAGGGTTCATACAGTCATGACTCTGGAGCAGCAGGACATGGTTTGCTACA
  3   1   2       chi Gas7      in                         XZG47771.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCACGCGTCCGATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGGGGGCGGAAGAGGAGGAGAGCATGGAGACACAGGAGTGATACTTATTTAAAGATTTCAGTTGGTCTGGATCCCCCCTCTGCCGGCGCCGAACACATTGGGTCTGTTTGTGGACCAAATGCCACGAGTTCCTGTTTTATTTTCATTCGTTCTTAGCTTGTCATGTGACTTGTTTTATACTGTAGGGATACATTGTATTTTTTTTTTTTGCCAGCAATAAATTTTTATTTCGACACCTCAAAAAAAAAAAAAAAGG
  5   1   2       bld HeRe      in                     EC2CAA13DE07.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGGCCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCG
  5   1   2       bld Gas1                             NISC_mq14b06.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCAT
  5   1   2       chi Gas7      in                         XZG47771.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGGGGGCGGAAGAGGAGGAGAGCATGGAGACACAGGAGTGATACTTATTTAAAGATTTCAGTTGGTCTGGATCCCCCCTCTGCCGGCGCCGAACACATTGGGTCTGTTTGTGGACCAAATGCCACGAGTTCCTGTTTTATTTTCATTCGTTCTTAGCTTGTCATGTGACTTGTTTTATACTGTAGGGATACATTGTATTTTTTTTTTTTGCCAGCAATAAATTTTTATTTCGACACCTCAAAAAAAAAAAAAAAGG
  5   1   2       bld Gas1                               IMAGE:6989219                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTNCATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGGCTTTTTCTCNCCGGCTCAGTTGGCATCACTGACCCCTGTAAAGTGGCACCTTAGGGTT
  5   1   2       bld Tad5      in                         XZT25353.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGATTTCCACGTGTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCCGGCTCAGTTGGCATCACTGACCCCTGTGAAAGTGGCAACTTTAGGGTTCATACAGTCATGACTCTGGAGCAGCAGGACATGGTTTGCTACACTG
  5   1   2       bld Gas7      in                         XZG20708.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCCGGCTCAGTTGGCATCACTGACCC
  5   1   2       bld Gas7      in                         XZG31357.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          gcagcttccgggaaaccaaagtctttgggttccggggggagtatggttgcaaagctgaaacttaaaggaattgacggaagggcaccaccaggagtggagcctgcggcttaatttgacccaacacgggaaacctcacccggcccggacacggaaaggattgacagattgatagctctttctcgattctgtgggtggtggtgcatggccgttcttagttggtggagcgatttgtctggttaattccgataacgaacgagactcctccatgctaactagttacgcgacccccggcggtcggcgtccaacttcttagagggacaagtggcgttcagccacacgagatccagcTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCGGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCTGGCTCAGTTGGCATCACTGACCCCTGTGAAAGTGGCAACTTTAGGGTTCATACAGTCATGACTCTGGAGCAGCAGGACAT
  5   1   2       bld Neu                            TNeu128h06.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGTGAAATGGCCTTCCCGCGTGTGAAACCCGCCGGGGAGGGGGGCTCATTCAACGAGTCACTGCGCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGGGACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTAACTGCAAATTGAGGAGGTTGGACAAGTGGGCTCCTACAAAAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCGTTAAGGTGGGCGAGACCCT
  5   1   2       bld Gas                            TGas058b14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAATGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGT
  5   1   2       bld BrSp                             EC2BBA32DD09.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGCCTTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCGCAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCACCAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACCCTGGAAGCC
  5   1   2       bld Gas       in                   TGas081k08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCATTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCTGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCG
  5   1   2       bld Egg       in                   TEgg015g07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATG
  5   1   2       bld Egg       in                   TEgg051c04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTCCCGCGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCA
  5   1   2       bld Neu                            TNeu137e17.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGTGTGAAACCCGCCCCCGACGATAGCTCATTCAGGGAGTGGGCTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGGCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGGGGGGGACAAAAAGGGGCCATGAGCACAGGCCATAATGTGGCAGACTTGGTCGTGATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCGTTAAGGTGGTGGAGACCCTAAGGAGGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATC
  5   1   2       bld Neu       in                   TNeu091f04.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCC
  5   1   2       bld Neu       in                   TNeu117m10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAACCCGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTG
  5   1   2       bld Ovi1      in                         CABI8893.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGCCCCCGACGATAGCTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTTAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCCGGCTCAGTTGGCATCACTGACCCCTGTGAAAGTGGCAACTTTAGGGTTCATACAGTCATGACTCTGGAGCAGCAGGACATGGTTTGCTACACTGCCCAGACGTTGGTCCGTATTCTCTCCCACGGGGGGCTTCCGGAAAGATATTGGGCCT
  5   1   2       bld Sto1      ?                         CABG11130.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTCATTCAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCCGGCTCAGTTGGCATCACTGACCCCTGTGAAAGTGGCAACTTTAGGGTTCATACAGTCATGACTCTGGAGCAGCAGGACATGGTTTGCTACACTGCCCAGACGTTGGTCCGTATTCTCTCCCACGGGGGCTT
  5   1   2       bld Fat1      in                         CABC6348.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGCGAGTCACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCCGGCTCAGTTGGCATCACTGACCCCTGTGAAAGTGGCAACTTTAGGGTTCATACAGTCATGACTCTGGAGCAGCAGGACATGGTTTGCTACACTGCCCAGACGTTGGTCCGTATTCTCTCCCACGGGGGCTTCCGGAAGATATTGGGCCTGGAGGGAGATGCCAGCGCTCTTGCCACGGAAATGTCTACCTGGGACGGAGTCATCGTG
  5   1   2       bld Gas7                                 XZG61354.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACTGCTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCTGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAAGAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCTGGCTCAGTTGGCATCACTGACCCCTGTGAAAGTGGCAACTTTAGGGTTCATACAGTCATGACTCTGGAGCAGCAGGACATGGTTTGCTACACTGCCCAGACGTTGGTCCGTATTCTCTCCCACGGGGGCTTCCGGAAGATATTGGGCCTGGAGGGAGATGCCAGCGCTCTTGC
  5   1   2       bld Gas1                               IMAGE:6986308                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCTCAAACGAAACCAAGAATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCCGGCTCAGTTGGCATCACTGACCCCTGTGAAAGTGGCAACTTTAGGGTTCATACAGTCATGACTCTGGAGCAGCAGGACATGGTTTGCTACACTGCCCAGAACGTGGGTCGTA
  5   1   2       bld Egg       in                   TEgg045c10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCAGCCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAG
  5   1   2       bld Hrt1      in                         CAAQ8626.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCCGGCTCAGTTGGCATCACTGACCCCTGTGAAAGTGGCAACTTTAGGGTTCATACAGTCATGACTCTGGAGCAGCAGGACATGGTTTGCTACACTGCCCAGACGTTGGTCCGTATTCTCTCCCACGGGGGGCTTCCGGA
  5   1   2       bld Gas7      in                         XZG45906.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCAAACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCTGGCTCAGTTGGCATCACTGACCCCTGTGAAAGTGGCAACTTTAGGGTTCATACAGTCATGACTCTGGAGCAGCAGGACATGGTTTGCTACACTGCCCAGACGTTGGTCCGTATTCTCTCCCACGGGGGCTTCCGGAAGATATTGGGCCTGGAGGGAGATGCCAGCGCTCTTGCCACGGAAATGTCTACCTGGGACGGAGTCATCGTGACCCCTTC
  3   1   0       chi Gas7 5x3  in                         XZG48614.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAAGGAAACCAAGTTTGGGCCCCCAGCACAGCGGGGCGGGCCTCAATCTTTTTTTGGGTCCCCAAAATCAACAAGGTTTTGGACAATTTGTTGGTAGCCCCGGGAAACTTTGAAGTGCAAATTGGGGGGGGGGGCCAGGGGGGTTCCTCCAAGAAAGGGCCCAGGGGCCCGGGCCATAATGTGGCAGACTGGGTGGTCTTCCAAAAGATCCTTCCCCCCCGGGAAGCGGTTTTTGCTTTGGGCATTAAGGCCGGGGGGGGGATCCCAGCGTTTTTCCCCGGGAAATGTTTCCCGGGGGGGGGGTCTTGGGGACCCCTTCAGGGAAGGCCTAGGAGAACCCCCCCGAGGGGAAGGGGGGGGGGGGGGATGAGACCCGGGATTTCCCAGGGGGGGGGGAAGGGGGGGGGACCAGGGAGCCCCGGGGGGGATATTTTTTTAAAGATTTCAGTGGGTTGGGATCCCCCTTGGCGGGGGCGGAACACATGGGGTTTTTTTGGGGCCCAAATCCC
  5   1   2       bld Brn4      in                        CAAL19654.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCTGGCTCAGTTGGCATCACTGACCCCTGTGAAAGTGGCAACTTTAGGGTTCATACAGTCATGACTCTGGAGCAGCAGGACATGGTTTGCTACACTGCCCAGACGTTGGTCCGTATTCTCTCCCACGGGGGCTTCC
  5   1   2       bld Gas7      in                         XZG50700.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACGAAACCAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCCGGCTCAGTTGGCATCACTGACCCCTGTGAAAGTGGCAACTTTAGGGTTCATACAGTCATGACTCTGGAGCAGCAGGACATGGTTTGCTTCACTGCCCAGACGTTGGTCCGTATTCTCTCCCAC
  5   1   2       bld Eye       in                          CCAX982.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAGATCTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCCGGCTCAGTTGGCATCACTGACCCCTGTGAAAGTGGCAACTTTAGGGTTCATACAGTCATGACTCTGGAGCAGCAGGACAT
  5   1   2       bld Gas7      in                         XZG51717.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGGCCCCCAGCACAGCCGAGCAGGCCTCAATCCTTTCTTTGGTCACCAAAATCAACAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAAACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCGCTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCTGGCTCAGTTGGCATCACTGACCCCTGTGAAAGTGGCAACTTTAGGGTTCATACAGTCATGACTCTGGAGCAGCAGGACATGGTTTGCTACACTGCCCAGACGTTGGTCCGTATTCTCTCCCACGGGGGCTTCCGGAAGATATTGGGCCTGGAGGGAGATGCCAGCGCTCTTGCCACGGAAATGTCTACCTGGGACGGAGTCATCGTGACCCCTT
  3   1   2       bld Tad0 5g3  in                       IMAGE:6981962                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTGGTAGAGGGTGAGTACGTTTTACACTCCTCTGTCGGTAATGACCCGGGTGTTATTGANATAGGAGGGCATTTATATAAGGACGTTGGTGGAGTGCGCTTCAGGGTGGCGGCACGGGAGATTGTCATGTTGTGAAGATGTTTTCTTCAAGGAATGCTGTTAGCAAAATAGGTAATATCTCTGTGTTTATGAGGATATCATTTGTTTTGAGGCCGGGTGGGCCCCAATTGTTGGAAAGAATTCCTTATTGTCACGCCGGCGCCGGGGCGCCGGCAGCAAATTTATTGGACCCAAGCAGTGAGTACCTTTCTGAGATTGGACAATTGTGAGACCTATAAATAAGATTTTACACCAGGAGGTTTTGTTTTGGGGCCGGCCAATTTATGGCCACTTATTCGGTTGGTTTTGGGGGGGAGGAATCTCCTTCCCCATTTTTTCTATGTGAAAGGGTTTTTAATCCCGGGTTGTTTGATAAGGACTTTGTGGGAGTTCTGTTTTCCCGGGATTTTGTAGCTTCTGACTCCGGTGGATTGCTGGGCCTCTGGGGGCAGTAGGCCGTCATGGAACAACCCCACCATGGCAGCCGCTGGCACTCAATGTGTCCTACTAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCTGGCTCAGTGGGCATCATTGACCCCTGTGAAAGTGGCAACTTTAGGGTTCATACAGTCATGACTCTGGAGCAGCAGGACATGGTTTGCTTCTCTGCCCAGACGTTGGTCCGTATTCTCTCCCACGGGGGCTTCCGGAAGATATTGGGCCTGGAGGGAGATGCCAGCGCTCTTGCCACGGAAATGTCTACCTGGGACGGAGTCATCGTGACCCCTTCAGAGAAGGCCTATGAGAAGCCCCCCGAGAGGAAGGAGGGAGAGGAGTGATGAGAAACCAAGGATATACCCAAGAGTGGAGGCAGGAAAGAAGGAGAGAAGAAGACAATGGAAGACAAACAAGGAAGTGATANTATATTTAAAAGATATTACAGATGGTAATGGATACCCCATAAGCAGGCGCAGAAACAACATTGGGTCAGTAGTGGAACACAAAATGACCAAGAGTTCAAATATTAATATACAATAGATAAAAGCATGTCAAGAAAAATAAAAAAAAAAGAAGGGAAACAAAGTAT
  5   1   2       bld In62                            IMAGE:8954992.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AATTTTTTGGGAAAGTATCAAAATAAAAAAACGCCCCCAAATCTAAACGTTATCGACAATTTGATCGTAGCCCCGGGAAACTTTGAAGTGCAAATTGAGGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAGCACAGGCCATAATGTTGCAGACTTGGTCGTCATCCTAAAGATCCTTCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTGGTCGAGACCCTAAGGACGCAGGATCCAGCTGAAGTTCTCACAATGCTGACAAACGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACGGTGAAGATCCTTATCACGACTGTGCCGCCCAATCTGCGCAAGCTGGACCCCGAGTTGCATTTGGACATCAAAGTTCTGCAGAGCGCACTGGCCGCCATCAGGCACGCACGGTGGTTCGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAGCCTCTGACTCCCTGGATCCTGGACCTCTTGGGGCATTATGCCGTCATGAACAACCCCACCAGGCAGCCGCTGGCACTCAATGTGTCCTACAAACGCTGCCTACAGATGCTCGCCGCCGGCCTTTTCCTCCCCGGCTCAGTTGGCATCACTGACCCCTGTGAAAGTGGCAACTTTAGGGTTCATACAGTCATGACTCTGGAGCAGCAGGACATGGTTTGCTACACTGCTCAGACGTTGGTCCGTATTCTCTCCCACGGGGGCTTCCGAGATATTGGGCCTGAGGGAGATGCCAGCGCTCTGCCACGAAATGTCTACCTGGGACGGATCATCGTGACCCTTCGAGAGCTTATGAAAGCCCCCGAAAGAGAGGAAGAGATGAGACAGATATCCCGAGGGCGAAGAGGAAGCTGA