Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 98%

 1012070153 Xt7.1-TTpA027f14.5.5 - 480 ESTs
                                                                       ........-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TTpA027f14.5.5                                                                                                                                                                                                                                                                                                                     CCCTGAATGGCTAGACTGACAAGAAGCTTAGTAGTGAAGAAGGGGGTGGGAGAAGTAGTTCGCCATCTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008221296                                                                                                                                                                                                                                                                                                                           ATGGCTxxxCxxACAAGAAGCTTAGTAGTGxxxxxxGGGGTGGGAGAAGTAGTTCGCCATCTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                          3     7     5     9     5    10     8    17    22    34    26    39    47    62    72    90    95   114   106   129   113   133   131   142   136   145   137   146   140   148   140   148   142   149   143   149   143   149   146   151   147   150   148   151   146   151   145   151   147   152   147   152   149   155   148   156   153   158   153   158   150   157   153   157   154   158   153   158   154   158   154   158   154   160   155   162   157   162   158   164   158   164   157   164   156   164   157   164   157   164   157   163   159   166   157   165   143   164   149   164   147   164   147   163   145   165   148   165   148   165   147   165   149   166   148   166   152   168   146   164   142   163   143   159   141   157   133   152   129   149   121   146   120   146   114   145    96   132    87   126    88   125    76   113    76   111    79   111    73    99    72    94    68    90    65    88    61    84    58    74    59    72    58    70    56    69    59    68    59    66    56    61    56    61    57    62    58    64    58    62    55    60    55    60    55    60    55    57    55    58    56    59    58    59    59    60    60    61    61    63    63    65    62    65    64    66    64    65    65    66    66    67    65    65    65    65    66    68    67    68    67    68    69    70    68    70    65    68    65    67    69    72    68    71    69    71    68    70    60    68    64    70    64    69    65    69    66    72    67    73    71    80    73    83    86    98    87   103    97   106   106   117   113   121   112   121   130   136   149   154   153   157   160   167   163   169   172   174   170   174   178   180   183   187   184   189   184   194   194   204   195   206   203   215   200   213   199   219   207   220   217   228   221   230   222   228   217   228   219   228   209   231   213   233   211   232   227   234   231   236   221   238   232   238   230   236   231   237   227   235   235   236   227   236   227   233   222   234   188   232   225   233   207   233   223   233   219   232   212   230   214   230   213   228   220   229   213   228   210   228   216   228   214   227   212   226   211   226   219   225   201   224   213   223   203   222   198   221   195   220   174   214   168   210   173   199   151   192   154   186   126   178    31    74    43    60    24    34     9    14
  5   1   2  SIG                                    Xt7.1-TTpA027f14.5                                                                                                                                                                                                                                                                                                                                                               GGGGTGGGAGAAGTAGTTCGCCATCTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CABH5629.3                                                                                                                                                                                                                                                                                                                                                                 GGTGGGAGAAGTAGTTCGCCATCTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGGACCACAAAAGACATCATCCTACCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTACCGGGTCCGGGAATTCCCGCGGATGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                         CCACTCCGACCATTTGTCAGGGTGGTTTTTGTATTTTTGCCTTGTGTGTGGGAGCACACG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAGTGATTGAGAAACAAGGCAAAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAATTGCCATTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCCACCAGTGTG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                     --A---C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----G----T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----T-T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -T--T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --C-C-------
                                               BLH ATG     152    3200                                                                                                                                                                                                                                                                                                                     
                                               BLH MIN     152     318                                                                                                                                                                                                                                                                                                                     
                                               BLH MPR     152     318                                                                                                                                                                                                                                                                                                                     
                                               BLH OVR     152      92                                                                                                                                                                                                                                                                                                                     
                                               CDS MIN     152      44                                                                                                                                                                                                                                                                                                                     
                                               EST CLI      76      44                                                                                                                                                                                                                                                                                                                     
                                               ORF LNG     152      10                                                                                                                                                                                                                                                                                                                     
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Sc ==== 9e-079     NP_015064.1 medium subunit of the clathrin-associated protein complex; Apm1p [Saccharomycescerevisiae] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Ce ==== 0          NP_001024865.1 DumPY : shorter than wild-type family member (dpy-23) [Caenorhabditis elegans] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Sp ==== 0          XP_779903.1 PREDICTED: similar to adaptor-related protein complex 2, mu 1 subunit isoform b isoform 1 [Strongylocentrotus purpuratus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Dm ==== 0          NP_732744.1 CG7057-PA [Drosophila melanogaster] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Dr ==== 0          NP_957320.1 similar to adaptor-related protein complex 2, mu 1 subunit [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Gg ==== 0          NP_001072962.1 adaptor-related protein complex 2, mu 1 subunit [Gallus gallus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Mm ==== 0          NP_033809.1 adaptor-related protein complex AP-2, mu1; clathrin-associated AP-2 [Musmusculus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Hs ==== 0          NP_004059.2 adaptor-related protein complex 2, mu 1 subunit;clathrin-associated/assembly/adaptor protein, medium 1; plasma membrane adaptorAP-2 50kDA protein; clathrin coat adaptor protein AP50; clathrin adaptor complexAP2, mu subunit; HA2 50 kDA subunit; clathrin ass [Homo sapiens]  =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xl ==== 0          AAH72057.1 MGC78929 protein [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Xt ==== 0          AAH61374.1 Unknown (protein for MGC:75936) [Silurana tropicalis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TTpA027f14.5.5                                                                                                                                                                                                                                                                                                                                                                                                     TGA---------------TGA------ATG------------ATG------------TAA------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG---------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG------------------ATG------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG------ATG------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------ATG---------------------TAG------------------TGA---TAA------------------------------------------------------TAG------------------------------------------ATG---------------------------------------TAA------------TAG------------------------------------TGA------ATG------------------TAG---------------------------------------------------------------------------TAG------------------------------------------------------------------------------------------ATG------------------------------------------------------------------TAA---------------------------------------TGA------------------TAA---------------------TAG---------TAA------------------------------------TAA---------------------TGA------------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
  5   1   2  SIG                                    Xt7.1-TTpA027f14.5                                                                                                                                                                                                                                                                                                                                                               GGGGTGGGAGAAGTAGTTCGCCATCTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008269724                                                                                                                                                                                                                                                                                                                                                                     GGAGAAGTAGTTCGCCATCTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   1           Neu0 FL                     IMAGE:5383841.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                       CTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACACAAAAAAAAAAAAAAAAAAAAA
  5   1   0       chi Tail      in                         CBSW1721.b1 AATGTAGTAGTGCCTTTCCAGGATCTGATAATCAAAGGTGGCAGGTTGTTTTTTCAAAGTGTCAGACCTACATTTTCTTGAAAATAGAGGCCTAGCTACCTTCAGAACAGTGCGGTTGCTGTTCACCCCTTTGTGGAAGAAAAAACAGAAACATTACTTTTGGTGGCTGTTGTAGCTTTAAGGATACAGCACTTTTGGGGAAAGAGTAATTGCCGTCCTTAGGATCAGGTCCTGGGAGTGTCAACACTACATTATCTGAAATGCGATTTTGCTGTGTCAGTAGTGCGCTATAGATTTAAATGCAGGCAAGCTGCGTATTTGACTCCTTTTAATATTAGAGTGCAAGATCTCTGGAAGTTTTTTGCTTGTTTTGACAGCTGCAGGTTGCAGTGCAATGCCTGGAAACTAAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGA
  5   1   0       chi Neu0 5x                            IMAGE:6994766                                                                                                                                 TGTGAAAAGAGAAAAAAGAAAAAGAAAAGAGAAAGACGACAGAGAGAAAAGGAGGAACGAAGCAATAGAAACAGGGCAAGAATAAAAAAGGCAGACAGCAAAAAGAACNAAGAGGAAAACCGAAAGTAAACGTATGACAAAAAGACAACCAGAGACAAACAAATAGAACGAGAAGAAGGAAAGGCATGTGATACCCGGGATGCCAAGCAAATTACCGGAGGAAGTCTGGTGACATAGAACGAGAGCGCGGCGCGAGAAGAAGATGAAAGAATCGTCATGCTGTGTCGTGAAGCAATCACTGGCGAAGGAGGAAAACTAGGCAAGAATTCACCATGATTGGGGGAGTGTTCATATATAATCATAAAGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAGAATGGTTTAATGCGTGCCATGGGTGGTTTGAGTTTTCTTCCTACCAAAAAAATTGGGTTGGGGTTGGAGAGCCCGGGTTTTGGGGGGAGGTTTTGGTTGGGTGGTGATGTATAAGGGGGCNGGGGGGGTATGGGGTGGGGCAGGGCGGATGTGGGTTTGGGTGTCTTGCCGCTATTGTGTGGGTGGTGGTTTTGTTGTAGAGAAGGAGGATGAGAAGGGGGGTGGTGCTATTTCTGGTAGTAGAAAGGGAAGAAGTGGAGAGAAGTGTGATGAAGATGGGTTGTTAGTAGAAAAGAAAAAGAAAGAAAAGAAAGAGGAACGCGGAAAATAAAAGCGAGAAAAAACCAAACAAAAAACAATAAAAGGAAGGTAAAAGAAAGATGCGACAGAGGCGAACAGGTAGAGAACATGAAGAGAAAGGGTCGCACAAAAAAATGAAGAAAGAACAGCAGGCCGTAGGAAGCTAAAACACAAAGACAGACAANGAACGATGAACAGAAACCANACAAATAGATGAACAGCAGAGCAAAGGACANAAACNGAACGAGACACAAGCCTATCAAGAGAGCGGCCAAGCAGAATAACAGGACCTGATCATAACGAATGATGAAAAGAGAGACACGAGGCAGAACGGCATAAGGAGGGAGAGACGCGAACATGATAATAAATGAAANAACAATGAGAAGCTATCAAAACGACACGATCNGACAANGNGGACGAAGNACATGAAAGACGGCGATGGCGTCAAAGATACTAGANCACCATACATGAGAAAAAAGAGACAAAACAGAAACAAAAGAGAAAGATCAGAACAAATGAATGTACGANGAGGGATGGGCTAGCNCNTTCTAGATTTGTGCGCCAGCGAAACTGATACTCAGAATGACGAGCTAACATCAATAGTATGAGAAAACAAACACACGACGGATGTAAGAGCACGAGAAAGACACAGCAAAAANGAAAGAACGCGAGAGACAGGTATGAAAATAAGACATGAAACACGACTGGATGAACGAGAAACAGATACACAAAGACAAATTAGGGGAAACACAAGGGAGAAATGAGTGAGCAAGCTGCATACAATTAAGACATGTCGACACGCGGCGGCGTTATATCACATTTACTAGGTAAAAACGCCGACGTCATATTAAGTATAGGGATGACACAACCCCAGAATGCAAGACAAAAAACCACCTGANAA
  5   1   2       ext Te5       in                         CAAO7516.5p                                                                                                                                                                                                                                               GAAAGCGATCCTTCGGACGCGCCCTATAGTTTGCGCATGCGCCGCAGCTTCCTGCAAGACTTGGTAATCTCCCTGAATGGCTGCGCGCTGACGTAAGCACTGCGGAAAGAAGGGGGTGGGAGAAGTAGTTCGCCATCTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCCTCAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATG
  5   1   2       add Gas1 5g                            IMAGE:6986879                                                                                                                                                                                                                                                                       AAGGGCAGGAGTACCGGGGTCCGGGAATTCCNCGGGATTAACCTGGGGATCTTACTATAGACTGACAAGAAGCTTAGTAGTGCCACTCCGACCATTTGTCAGGGTGGTTTTTGTATTTTTGCCTTGTGTGTGGGAGCACACGAGAAAACATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTNCAGGGCANGTACTTAGCGCT
  5   1   2       add Tbd0 5g3  in                       IMAGE:6976369                                                                                                                                                                                                                                                                           GTTTGCGCATGCGCCGCAGCTTCCTGCAAGACTTGGTAATCTCCCTGAATGGCTGCGCGCTGACGTAAGCACTGCGGAAAGAAGGGGGTGGGAGAAGTAGTTCGCCATCTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAAAGCTACCCTGAGTGGAATGCCCGAGTGCAAGTTTTGGAATGAATGACAAAATAGTGATTGGAGAAACAA
  5   1   2       add Neu  5g                        TNeu027a21.p1kSP6                                                                                                                                                                                                                                                                                   TGCTGAGGAGCCGCGAGAGAGTGAAGGTAACCGGGGATCTTACTATAGACTGACAAGAAGCTTAGTAGTGCCACTCCGACCATTTGTCAGGGTGGTTTTTGTATTTTTGCCTTGTGTGTGGGAGCACACGAGAAAACATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGT
  5   1   2       add HdA  5g3  in                  THdA010k02.p1kbSP6                                                                                                                                                                                                                                                                                     CTGAGGAGCCGCGAGAGAGTGAAGGTAACCGGGGATCTTACTATAGACTGACAAGAAGCTTAGTAGTGCCACTCCGACCATTTGTCAGGGTGGTTTTTGTATTTTTGCCTTGTGTGTGGGAGCACACGAGAAAACATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGGCGTGTGGNTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTA
  5   1   2   10  ext Te1  5g3  in                        CBWN17677.b1 ..............................................................................................................................................................................................................................................................................................................TAATCTCCCTGAATGGCTGCGCGCTGACGTAAGCACTGCGGAAAGAGGGGGGTGGGAGAAGTAGTTCGCCATCTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTT
  5   1   2       add Gas  5g3  in                   TGas127m03.p1kSP6                                                                                                                                                                                                                                                                                                                CCGGGGGGGATCTTACTATAGACTGACAAGAAGCTTACCATGACACTCCGGCATTTGTCAGGGTGGTTTTTGTATTTTTGCCTTGTGTGTGGGAGCACACGAGAAAACATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAATAGTGATTGAGAAAACAGGCAAAGGAACCGCTGATGAGACTGGCAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATAC
  5   1   2   22  add Tad5 5g                              XZT66236.5p .....................................................................................................................................................................................................................................................................................................................CGGACGCGTGGGGACTGACAAGAAGCTTAGTAGTGCCACTCCGACCATTTGTCAGGGTGGTTTTTGTATTTTTGCCTTGTGTGTGGGAGCACACGAGAAAACATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAGGCAAA
  5   1   2       add Te5       in                         CAAO2519.5p                                                                                                                                                                                                                                                                                                                             CTATAGACTGACAAGAAGCTTAGTAGTGCCACTCCGACCATTTGTCAGGGTGGTTTTTGTATTTTTGCCTTGTGTGTGGGAGCACACGAGAAAACATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAG
  5   1   2       add In60 5g                         IMAGE:8950248.5p                                                                                                                                                                                                                                                                                                                                      GTTTTTATTAAGGATTATTCTAATCGTATTCGTCCGATTACTTCGCCTTCTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAATCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGCAGTACTTAGCGCTCATGTGTCTGGGTCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGATGAATGACAAAATATGATTGAGAACAAGCAAGAACCGCTGATGAGACTGGCAAACGGGAAGCATCATGCATTGATGACTGTACATCACAGGTGTCCGCTAACAATTGACTCTGACGCACATCAGCTTACCTCCGATGGAGATTGGAGCTTAATGAAAATATCGACCC
  5   1   3        nb BrSp 5g3  in                     EC2BBA27AA02.g1                                                                                                                                                                                                                                                                                                                                                 GGGGCGGAAAGAAGGGGGTGGGAGAAGTAGTTCGCCATCTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAATTGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGT
  5   1   2       add In62 5g                         IMAGE:8956345.5p                                                                                                                                                                                                                                                                                                                                                   GCCAGGATTCAACAATGGAGGGACCCTGCTAACTGAATTCGTCCCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAATAGTGATTGAGAAACAAGCAAAGGACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCATTGCCATGATGACTGTACATTTCCACCCAGTGGTGTCAGCTAGCAATTGGACTCTGAGCGCAGCATCAGCCTTATACTCGGATGGAAGAATTGGAGCTTTATGAAATAATTCTGGATCCCCCAAAGGG
  5   1   3        nb BrSp 5g                          EC2BBA19AE06.g1                                                                                                                                                                                                                                                                                                                                                     GGGAAAGAAGGGGGTGGGAGAAGTAGTTCGCCATCTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGGAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTA
  5   1   3        nb AbdN 5g3  in                       IMAGE:7007373                                                                                                                                                                                                                                                                                                                                                      CCCGGGATGGGGGTGGGAGAAGTAGTTCGCCATCTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCCTCAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGGATGAATGACAAAATAGTGATTGAGAAAACAAGCAAAGGAACCCGCTGATGAGACTGGCAAAACGGGAAAGCAATCCATTGCCATTGGATGACTGGACATTCCCACN
  5   1   3        nb HdA  5g3  in                   THdA033n05.p1kSP6                                                                                                                                                                                                                                                                                                                                                        AAAGAAGGGGGTGGGAGAAGTAGTTCGCCATCTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGA
  5   1   3   14   nb Te4  5g3  in                         CAAN3236.5p .......................................................................................................................................................................................................................................................................................................................................................AAAGAAGGGGGTGGGAGAAGTAGTTCGCCATCTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGTAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGC
  5   1   3   14   nb Brn4 5g3  in                        CAAL22945.5p ........................................................................................................................................................................................................................................................................................................................................................AAGAAGGGGGTGGGAGAAGTAGTTCGCCATCTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGANCAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCATTTGCCATTGATGACTGTACATT
  5   1   3   14   nb Brn3 5g3  in                         CAAK7294.5p .........................................................................................................................................................................................................................................................................................................................................................GTCCGGGGGTGGGAGAAGTAGTTCGCCATCTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCA
  5   1   3   22   nb Gas7 5g                               XZG8039.5p .........................................................................................................................................................................................................................................................................................................................................................AGAGGGGGTGGGAGAAGTAGTTCGCCATCTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGGC
  5   1   2   12  add Tad5 5g3  in                         XZT19087.5p ..........................................................................................................................................................................................................................................................................................................................................................CGGACGCGTGGGCGGACGCGTGGGCGGACGCGTGGGCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGNCAGTTTGGAATGAATGACAAAATAGTGATTGAGAAAAC
  5   1   3   22   nb Gas7 5g                               XZG8971.5p ...........................................................................................................................................................................................................................................................................................................................................................GAGGGGGTGGGAGAAGTAGTTCGCCATCTTGGGCTCTGTGCTGAGGAGCCGTGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTNCAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGNCAGTTTGGAAATGATGACAAAATAGTGATTGAGAAAACAGGCAAAGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTA
  5   1   2       add Brn4      in                         CAAL6460.5p                                                                                                                                                                                                                                                                                                                                                             AGGGGGTGGGAGAAGTAGTTCGCCATCTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGTCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAAACCGCTGATGAGACTGGCAAAACGTGAGTAGAGTATTAACTGGTTAGAAAAGTGAATGTGGTCAAAGTGTCAGTTCCCATAAAACTAAATTGTAATT
  5   1   2   14  ext Brn4 5g3  in                         CAAL7544.5p ..............................................................................................................................................................................................................................................................................................................................................................GGGGTGGGAGAAGTAGTTCGCCATCTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTC
  5   1   2       add In60 5g                         IMAGE:8948137.5p                                                                                                                                                                                                                                                                                                                                                                 GAGAATGGTAAGACTAGAGAATCAACACTTAAAAGATTCGTCCCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAGAGCTACCTGAGTGGAATGCCAGAGTGCAGTTTGGATGAATGACAAATAGTGATTGAAAACAAGGCAAGGAACCGCTGATGAGACTGCAAACGGGAAAGCATTCAATTGCCATTGATGACTGTACATCACCAGTGTGTTCCGCTTAGCAAATTTGACCTCTGACGCAGCATCCGCCTTTACCTTCGATGGAGATTTGATCTAGAATATCGAACCATAAAGAACTCACTCCTACATTCCCC
  5   1   3        nb Gas1 5g                            IMAGE:6988966                                                                                                                                                                                                                                                                                                                                                                    GGGAGAAGTAGTTCGCCATCTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCAGAGTGNCAGTTTGGAATGATGACAAATAGTGA
  5   1   3        nb Gas  5x3  out                  TGas054l18.p1cSP6                                                                                                                                                                                                                                                                                                                                                                     GGAGAAGTAGTTCGCCATCTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTG
  5   1   3        nb BrSp 5g3  in                     EC2BBA13CD12.g1                                                                                                                                                                                                                                                                                                                                                                     GGGGAAGTAGTTCGCCATCTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATCGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATG
  5   1   3        nb BrSp 5g3  in                     EC2BBA26CB10.g1                                                                                                                                                                                                                                                                                                                                                                     GGGGAAGTAGTTCGCCATCTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGT
  5   1   3   14   nb Brn3 5g3  in                         CAAK5457.5p ....................................................................................................................................................................................................................................................................................................................................................................GGAGAAGTAGTTCGCCATCTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAGGCAAAGGAACCGCTGATGAGACTGGCAAAA
  5   1   3   14   nb Brn3 5g3  in                         CAAK7962.5p ....................................................................................................................................................................................................................................................................................................................................................................GGAGAAGTAGTTCGCCATCTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAGGGCAAGGAACCGCTGATGAGACTGGCAAAACGGGG
  5   1   3   14   nb Te4  5g3  in                        CAAN10382.5p ....................................................................................................................................................................................................................................................................................................................................................................GGAGAAGTAGTTCGCCATCTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAANACAGGCANAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATT
  5   1   2       add In62 5g                         IMAGE:8955214.5p                                                                                                                                                                                                                                                                                                                                                                     GTTTTTTTTTGGGGATATAATAATAAAATAAATTCTTCCCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAATAGTGATTGAGAACAGGCAAAGGACCGCTGATGAGACTGGCAAACGGGAAAGCATCATTGCATTGATGACTGTACATTCCACCAGTGTTGTCGGCTAGCAATTTGACTCTGACGCAGCATCAGCTTTATACCTCCGATGAGATTGAGCTATGAAATTCGACCCAAAGACTCATCTACATCTGTCATTCCTCTGTCTGATGGGCGCCAGCTGAGTCAGGCTCATCATACTTGTGTTGAAATGAGGAGATCACCCTTCACCGGAACAGCCTCGT
  5   1   3        nb Gas  5x3  in                   TGas097o16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                       CGGGGAGAAGTAGTTCGCCATCTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAACTAAGAAGAATTCCCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAATCCTGGATTTTGGTTACCCTCAGAATTCTGAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGAT
  5   1   3        nb TpA  5g                        TTpA029a16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                         AAGTAGTTCGCCATCTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATTTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACANAATAGTGATTG
  5   1   3   14   nb Brn4 5g3  in                        CAAL19320.5p ........................................................................................................................................................................................................................................................................................................................................................................AAGTAGTTCGCCATCTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGGAAGCAATCAATTGCCATTGATGACTGTACATTCCA
  5   1   3        nb Te5  5g3  in                        CAAO13041.5p                                                                                                                                                                                                                                                                                                                                                                         AAGTAGTTCGCCATCTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCCGCACAGCTTCTTTCACGTAAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCT
  5   1   2       add In66 5g                         IMAGE:8962675.5p                                                                                                                                                                                                                                                                                                                                                                           TCCCTACTTTGGGGCTTCTCGTTGCTTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGATGACAAATTAGTGATTGAAGAACAGGCAAAGGGACCGCTGATGAGACTGCAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCACCCAGGTGGTGTCCGGCCTAAACAAATTG
  5   1   2       add Gas7 5g3  in                         XZG14734.5p                                                                                                                                                                                                                                                                                                                                                                                   CCATCTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATG
  5   1   2   12  add Gas7 5g3  in                         XZG53425.5p ....................................................................................................................................................................................................................................................................................................................................................................................ATCTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGGTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTT
  5   1   3   10   nb Tail 5g3  in                         CBSW9350.b1 ....................................................................................................................................................................................................................................................................................................................................................................................GTCTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGATGCCAGAGTGCAAGTTTGGAATGAATGACAAA
  5   1   3        nb Gas1 5g                            IMAGE:6987926                                                                                                                                                                                                                                                                                                                                                                                       TCCGGGATCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACANGGCANAGGAACCGCTGATGAGACTGGCANAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCCACAGTGTGTCCGGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGGAGATTTGAGCTTATGAGATATCGGACCACCAAAGACATCATCCCTACCAATCCCGTGTCT
  5   1   2       add Gas1 5g3  in                     NISC_mq20b09.y1                                                                                                                                                                                                                                                                                                                                                                                       CTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCT
  5   1   3        nb Neu0 FL   in                    IMAGE:5383841.y1                                                                                                                                                                                                                                                                                                                                                                                       CTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGC
  5   1   2   12  ext Gas7 5g3  in                         XZG59280.5p ......................................................................................................................................................................................................................................................................................................................................................................................CTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCACATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACANAATAGTGATTGAGAAACAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCNATTGCCATTGATGACTGTACATTCCACCAG
  5   1   3   12   nb Tad5 5g3  in                         XZT40660.5p ......................................................................................................................................................................................................................................................................................................................................................................................CTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACT
  5   1   3   10   nb Thy1 5g3  in                         CBST483.fwd ......................................................................................................................................................................................................................................................................................................................................................................................CTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGTCAT
  5   1   3   10   nb Limb 5g3  in                        CBSU3271.fwd ......................................................................................................................................................................................................................................................................................................................................................................................CTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAA
  5   1   3   10   nb Te1  5g3  in                         CBWN8767.b1 ......................................................................................................................................................................................................................................................................................................................................................................................CTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGAT
  5   1   3   10   nb Eye  5g3  in                         CCAX1420.b1 ......................................................................................................................................................................................................................................................................................................................................................................................CTTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAAC
  5   1   2       add AbdN 5g3  in                       IMAGE:6998033                                                                                                                                                                                                                                                                                                                                                                                        TTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGNCAGTTTGGAATGAATGACAAANTAGTGATTGAGAAAACANGGCAANGAACCGCTGATGAGACTGGGCAACNGGAAANGCATCATTTGCATTGATGACG
  5   1   3   20   nb Eye  5g                              CCAX6046.b1 .......................................................................................................................................................................................................................................................................................................................................................................................TTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTG
  5   1   3        nb Neu0 5x3  in                     NISC_ng10a08.y1                                                                                                                                                                                                                                                                                                                                                                                         TTGGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGAATGCTGTGGATGCTTTCC
  5   1   3        nb TpA  5g3  in                   TTpA078a12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                          GGCTCTGTGCTGAGGAGCCGCGAGAGCAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGNCAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAGGCAAAGGAACCGCTGATGAGACTGGNCAAACGGGAAAGCAAATCATTGCCATTGATGACTGTACAT
  5   1   3   20   nb Te1  5g   ?                         CBWN14672.b1 .........................................................................................................................................................................................................................................................................................................................................................................................GGGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAA
  5   1   3        nb Gas1 5g3  in                     NISC_mq26h09.y1                                                                                                                                                                                                                                                                                                                                                                                           GGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCA
  5   1   2       ext TpA  5g3  in                   TTpA027f14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                           GGCTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTC
  5   1   2       add TbA  5g3  in                   TTbA028d05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                           GGCTCTGTGCTGAGGAGCCGCGAGAGACTTACGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAACAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGT
  5   1   3   20   nb Te1  5g                              CBWN2493.b1 ............................................................................................................................................................................................................................................................................................................................................................................................CTCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGA
  5   1   3   10   nb Thy1 5g3  in                        CBST4547.fwd .............................................................................................................................................................................................................................................................................................................................................................................................TCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACGGCTGATGA
  5   1   3   20   nb Spl2 5g   out                       CBSS1590.fwd .............................................................................................................................................................................................................................................................................................................................................................................................TCTGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAA
  5   1   2       add Tad5                                 XZT47312.5p                                                                                                                                                                                                                                                                                                                                                                                               agtgtctaaccactctgtgggagccagaactcttaatggttggtaggggttcaggggcttatttcgctcaatgaaatgcaaatcagttgctatcttttatttgaggttgttttttcgattttccttttggtgtgctgtctgccactgttgaagtggacctgccattggggtggtgctgttctgggacttttcgtttctttgtcgttggacgggcttgcagaatcggtgaggggtcaaataattatttcctccactgtataCACAGTGTAATGCAACCCACCCTTGCCTTATTCCATTGTGAAGTTTTGGATGCTGGGAACTAGTCCCTCTCCTTTGCAGAGAATCTGAGCATCACCCACTAAGCAAATAACATCACTCTACAGTGGCTTGCATTATGTCTTAGCTTGGGCTGAGGGCTACTAATATATATTGATTTTGTTCTCTACTGCCTGCTGAAATTTTAGACTATATATCTTTTCTCTCTGTGGTTTTTTTTTTTTTTCTTAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAA
  5   1   3        nb Te5       in                         CAAO7838.5p                                                                                                                                                                                                                                                                                                                                                                                                TGTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGG
  5   1   3        nb HdA  5g3  in                  THdA017a21.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                 TGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGAGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAAGCATTAAGTATCGTCGAAATGAGCTGTTCTTATATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCATAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACA
  5   1   2       add 1030 5g                         IMAGE:7094531.5p                                                                                                                                                                                                                                                                                                                                                                                                 GTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAAGATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAATATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATATAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAAACTTTCATCATCCAATAAGGGATTAAAAGTCTGCATCAGACCTTGGAGGAGCAGTCTCTGATTACTAGCCAGGTTATGGCCAATTTTGGGTGGAGACCTGTAGGCATATAATTATTGTTCAAATGACCTGTTCTTAGATGTTTTAAAAGTGTCAACTGGTAAGGTCCTTTAAGGGTAGTTCTTATTC
  5   1   3   10   nb Thy1 5g3  in                        CBST6159.fwd ................................................................................................................................................................................................................................................................................................................................................................................................GTGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCA
  5   1   2       ext TpA  5g3  in                   TTpA034c07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                  TGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAATTTGACT
  5   1   4      seed TpA  5g3  in                   TTpA041m14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                  TGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTC
  5   1   3        nb TbA  5g                        TTbA046k08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                  TGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTNCACCTGCTAATGTCACCTNCAGGGCAGGTACTTAGCGCTCATGTG
  5   1   3        nb TbA  5x3  out                  TTbA069a19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                  TGCTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCANAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTC
  5   1   3        nb TpA  5g                        TTpA035h11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                    CTGAGGAGCCGCGAGAGAGTGAAGATCTTTGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACA
  5   1   3   14   nb Brn4 5g3  in                        CAAL20803.5p ...................................................................................................................................................................................................................................................................................................................................................................................................CTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGAAAAGCATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGC
  5   1   3        nb Te5       in                         CAAO2598.5p                                                                                                                                                                                                                                                                                                                                                                                                    CTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCANAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCAT
  5   1   3   12   nb Tad5 5g3  in                         XZT54762.5p ...................................................................................................................................................................................................................................................................................................................................................................................................CTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAGTCAGCATCAGACCAAGGAGGAGCAGT
  5   1   2       add In62 5g                         IMAGE:8954163.5p                                                                                                                                                                                                                                                                                                                                                                                                    CTGAGGAGCCGCGAGAGAGTGAAGATAAAGAAAACAAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGAACATTTCACCAGTGTGTCCGGCTTAGCAAATTTGGACTCTGGAGCGCAGCAATCAGCGTTCTAACCTTCCGAATGGGAGAATTGAGCCTTATTGCAGAGAATATTCTGCGAACCACTGCAATGATGTAC
  5   1   3   10   nb Spl2 5g3  in                        CBSS3465.fwd ...................................................................................................................................................................................................................................................................................................................................................................................................CTGAGGAGCCGCGATAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAA
  5   1   3   10   nb Te1  5g3  in                        CBWN15475.b1 ...................................................................................................................................................................................................................................................................................................................................................................................................CTGAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTC
  5   1   3        nb Neu  5g                        TNeu021c20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                      AGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGCGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGAGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCANGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATG
  5   1   3   10   nb Ovi1 5g3  in                          CABI633.5p .....................................................................................................................................................................................................................................................................................................................................................................................................GAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCA
  5   1   3   10   nb Spl2 5g3  in                        CBSS5096.fwd .....................................................................................................................................................................................................................................................................................................................................................................................................GAGGAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACANAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGC
  5   1   3        nb HdA  5g3  in                   THdA042d16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                        CCCGGGGAGAGAGTGAAGATCNTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCCACAAAGACATCATCCTACCATTCCGTGTCATTCCT
  5   1   3   12   nb Tad5 5g3  in                          XZT9199.5p .......................................................................................................................................................................................................................................................................................................................................................................................................GGGGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAAC
  5   1   0       chi Gas1 5g                            IMAGE:6988493                                                                                                                                                                                                                                                                                                                                                                                                         GGAGCCGCGAGAGAGTGAATTTTCTGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAAAGCTACCTGATTGGAAAGCCAGAATGCAAGTTTGGCAATGAATGACAAAATAGTGGATTGAGAAAACCAGGCAAAAGGAACCGCCTGTATTGAAAATGGGCAAAAAGGGGAAAAGACCAATCCAAATTTGCCCATCTGAATGGAACTGTGTATCAATTTCCACCCCCAATTTGTTGTCCCCCGGGCTTTTAAGACAAAAATATTCTTGAACCTCCCTCGCAAGCCT
  5   1   3   14   nb Brn4 5g3  in                        CAAL19890.5p ........................................................................................................................................................................................................................................................................................................................................................................................................GAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATA
  5   1   3        nb Te5       in                        CAAO12633.5p                                                                                                                                                                                                                                                                                                                                                                                                         GAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCCAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAG
  5   1   3        nb Te5       in                         CAAO2392.5p                                                                                                                                                                                                                                                                                                                                                                                                         GAGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTT
  5   1   3        nb Neu0 5g                            IMAGE:6995673                                                                                                                                                                                                                                                                                                                                                                                                          GCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATNCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGGCTTANNCAAATTTGACTCTGAAGCGCAGCATCAGCTTTTATACCCTCCCAGATGGGAGAATTTTGAGCN
  5   1   0       chi Tad5 5x3  in                         XZT25608.5p                                                                                                                                                                                                                                                                                                                                                                                                          AGCCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGGTCTTTTTCTTGTTTTTGTTCCTGTCTCACCTGATGTGCTTAACTACTTCCCTTGCGTATGCATCATGTTGCTTCCTCACTTTTCTGCGTGTGGCTGGACCTCTGTAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGC
  5   1   3        nb Neu  5g                        TNeu032o10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                           CCGCGAGAGAGTGAAGATCTATTTTTCTAAGCATCATGNGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGNGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTG
  5   1   3        nb HdA  5g                       THdA026m21.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                            CCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGNTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTNAGCAATTTGACTCTGAGCGCAGCATCAGCTTTATACCT
  5   1   3   14   nb Brn3 5g3  in                         CAAK3147.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................CCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGT
  5   1   3   14   nb Brn4 5g3  in                         CAAL6792.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................CCGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGA
  5   1   3        nb Gas  5g3  in                   TGas065k08.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                             CGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAAGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAAGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAAGCATTAAGTATCGTCGAAATGAGCTGTTC
  5   1   3        nb Neu  5g                        TNeu060g10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                             CGCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCT
  5   1   3        nb Neu  5g                        TNeu024i02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                              CGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGNGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTANCGCTCATGTGTCTGGGCGTGT
  5   1   3   12   nb Tad5 5g3  in                         XZT60374.5p .............................................................................................................................................................................................................................................................................................................................................................................................................GCGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAGGAACCGCTGATGAGACTGGC
  5   1   3        nb TpA  5g3  in                   TTpA001h20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                               CGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGG
  5   1   3        nb TbA  5g                        TTbA049c11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                               CGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCCACAAAGACATCATCCTACCATTC
  5   1   3   14   nb Brn4 5g3  in                        CAAL21934.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................CGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGG
  5   1   3   14   nb Te5  5g3  in                        CAAO10108.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................CGAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTG
  5   1   3        nb TbA  5x3  out                  TTbA060f16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                CCCGGGGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCATCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCACACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTACATGTGTTACAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCT
  5   1   3        nb TbA  5x                        TTbA066j01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                AGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAAAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATAGCTTTCCGTGTTAATGTCATCCATGCCCAGCAGCATGTGCGCTCGCCAATCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACGAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGATAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTTGGATTTTGGTTACCCTCAGAATTCTGAAACAAGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCCACGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCGAATTGGAGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGATGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGT
  5   1   2       ext HdA  5g3  in                  THdA016k04.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                AGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAAGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGNTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGGATGAATGACAAAATAGTGACCGAGAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCATCAATTGCCATTGATGACTGTACAT
  5   1   3   22   nb Gas7 5g                              XZG22095.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................GAGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTG
  5   1   3        nb HdA  5g3  in                   THdA012l22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                 AGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAA
  5   1   3        nb HdA  5g3  in                  THdA035k02.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                 AGAGAGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCANATTTGACTCTGAGCGCAGCATCAGCTTTATACCT
  5   1   3        nb TpA  5g3  in                   TTpA064k01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                    CGCTGACATCTATGTTTCTAAGCATCATGGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGAAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTC
  5   1   3        nb TpA  5g3  in                   TTpA075j24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                    AGTGAAGATCTATGTTTCTAAGCATCACTGTGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGNCAGTTTGGAATGAATGANCAAATAGTGATTGAGAAANCAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTC
  5   1   2       add Brn4      in                        CAAL23073.5p                                                                                                                                                                                                                                                                                                                                                                                                                    AGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGCAATAGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAA
  5   1   3        nb TpA  5g3  in                   TTpA065j11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                     AGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAAATGACAAATAGTGATTG
  5   1   3   10   nb Mus1 5g3  in                         CABH2647.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................AGTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCCTCAGATGGAGAATTTGAG
  5   1   3   12   nb Gas7 5g3  in                         XZG53200.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................GTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAAACAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAANGCATCATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTC
  5   1   3   20   nb Eye  5g                              CCAX1121.b1 .....................................................................................................................................................................................................................................................................................................................................................................................................................GTGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGA
  5   1   3        nb TpA  5g3  in                   TTpA060b24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                       AAGATCNTATGTTTCTAAGCATCATGGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTG
  5   1   3        nb TpA  5x3  out                  TTpA060c04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                       AAGATCNTATGTTTCTAAGCATCATGGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCCAGAGTGCAGTTTGGAAATGATGACAAAATAGTGATTG
  5   1   3        nb HdA  5x3  out                 THdA017e11.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                       AAGATCTATGTTTCTAAGCATCATGAGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGAGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTC
  5   1   3   10   nb Ski1 5g3  in                         CABJ4021.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................TGAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTT
  5   1   3        nb Tad5      in                           XZT936.5p                                                                                                                                                                                                                                                                                                                                                                                                                       TGAGATCTATGTTTCTAAGCATCNATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAG
  5   1   2       ext Neu  5g3  in                   TNeu123l16.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                        GAAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGGCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTGTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATC
  5   1   3        nb TpA       in                   TTpA001n24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                        AAGATCTATGTTTCTAAGCATCATGGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGANATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGACATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTG
  5   1   3        nb HdA  5g3  in                   THdA051l11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                         AAGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTC
  5   1   3        nb Te5       in                        CAAO12381.5p                                                                                                                                                                                                                                                                                                                                                                                                                          AGATCTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGT
  5   1   3        nb Neu0 5g                            IMAGE:6996029                                                                                                                                                                                                                                                                                                                                                                                                                              CTATGTTTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGNATGACTGTACATTTCCACCCAGTGTGTTCCGGGCTTACCAAATTTTGACTTCTGAAGCGGCAGCCATCAG
  5   1   3   20   nb Lun1 5g                              CABD5984.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................TTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCCGCTTAGCAAATTTGACTCTGAGCGCAGCATC
  5   1   3   10   nb Ovi1 5g3  in                         CABI8231.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................TTCTAAGCATCATGGGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTT
  3  -1   0       chi Int1      in                        CAAP12835.3p                                                                                                                                                                                                                                                                                                                                                                                                                                      CATATAGGGCGAGAGGCGAGAAAACTAAGAAGAATTCCCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACAACAAGCTATTTTAATAATCTGTCAGCCATGATGTGAAATCTGATAAACTTAATCTATGGCAAAGTTATAGCTAATTCTTTATGTCACATGATTTTTACTTTTGAAAGTAGTGACAAACATGATATAGTCATCAATTACTTTCCATCTGGGACTGTTTATCTTTATCCCATGCATAANTGTCAGA
  5   1   2       add Mus1      in                         CABH7069.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                ATCGGCACGAGGGAAAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGCAATAGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCAC
  5   1   3   24   nb Brn3 5g                              CAAK8990.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................GGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCCTCT
  5   1   3   10   nb Ski1 5g3  in                         CABJ1642.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................GGAAGAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAAC
  5   1   3   22   nb Tad5 5g                              XZT30491.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................GAGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTT
  5   1   3   10   nb Ski1 5g3  in                        CABJ10034.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................AGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACA
  5   1   3   10   nb Spl1 5g3  in                        CABK10456.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................AGAAAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTT
  5   1   3        nb Gas  5g                        TGas006e24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGAAACTAANAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTANCGCTCATGTGTCTGGGCGTGTGGTGA
  5   1   3   24   nb Brn4 5g   ?                         CAAL18518.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................AAACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAAGACATCATCCTACCA
  5   1   3        nb Neu  5g                        TNeu144b22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACTAAGAAGAATTCACCATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCATGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGGCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAAGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCATACCAAGGAGGAGCAGTCTCATATTACTATCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAAGCATTAAGTATCGTCGAAATGAGCTGTTCTTATATGTGTTAGAGAGTGTCAACCTGCTAATGTC
  5   1   2       add In66 5g                         IMAGE:8962539.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATGAATTTCCCCATTGATTGGGGGACTTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTATCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAATATGATTGAGAAACAGCAAGAACCGCTGATGGACTGGCAACCGGGAAGCATCATGCATTGATGACTGTACATCCACATGTGTCGCTAGCAATGACTCTGACGCAGCATCAGCTTTATACCTCGATGGAGATTTGGAGCTTATGA
  5   1   3        nb Hrt1      in                         CAAQ1882.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGGCACGAGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAG
  5   1   3        nb Eye       in                         CCAX2107.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACA
  5   1   3        nb Mus1      in                         CABH5796.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGNGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCANATCTAAT
  5   1   3        nb TbA                            TTbA002j12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAATGCTGTGTATGCTTTCCGTGTTAATGTCATCCATGCCCAGCACCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCATTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGCAAAGAT
  5   1   3        nb Gas                            TGas066e15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAAGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAATAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATC
  5   1   2       add Neu       in                   TNeu053i18.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGGTCAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCATCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAA
  3  -1   2       add Int1      in                         CAAP7573.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCAACCTCCCTTATACACACAGTGTAATGCAACCCACCCTTGCCTTATTCCATTGTGAAGTTTTGGATGCTGGGAACTAGTCCCTCTGCTTTGCAGAGAATCTGAGCATCACCCACTAAGCAAATAACATCACTCTACAGTGGCTTGCATTATGTCTTAGCTTGGGCTGAGGGCTACTAATATATATTGAATTTGTTCTCTACTGCCTGCTGAAATTTTAGACTATATATCTTCTCTCTGTGTTTTTTTTTTTTTTTTTTTTTTTTTTCTTAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGTGAGTAGAGTATTAACTGGTTAGAAAGGTGAATGTGGTCAAAGTGTCAGTTCCCATAAACTTAAATTGTAATTCTACCCTTGTCTCTTATGTAGAATGGTAGGGTGCATCTTGGGCTGTCTGTGGTTTGCATGCATAGGCTTTTAGGTATAAATCTGCGTCTGTCATGGAACTGCCTGAACACCTTTGAAATACTGGCATGGAAGCTAATTAACCTTTTATTTTTTTTTTTACAGAACAAGCTATTTTAATAATCTGT
  5   1   3        nb HdA                            THdA002i14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAGTCTTCTTTCACGTAAGACGGTCAAATATCTGGCTAGCTGCAGTCACCAAATAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTATACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTGGGTTACCCT
  5   1   3        nb TpA       in                  TTpA045f10.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCGGGGCCCGGGAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCANATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCACCCCACTNCACACCAGTGGAGTACAGGTCATCTGTA
  3  -1   3        nb Neu       in                    TNeu091b24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCTTCTTTCCGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCANAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGAATAGTGCAGAGATTGAGCTGCTTCCTACTAATG
  5   1   3        nb BrSp      in                     EC2BBA30AH08.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGA
  5   1   3        nb Neu                            TNeu133n08.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGCTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAGACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTGAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAAGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACT
  5   1   3        nb Tail      in                         CBSW5245.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCAT
  5   1   3        nb Gas7      in                         XZG20367.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAA
  5   1   2       add Hrt1      in                         CAAQ9158.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGANAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTC
  5   1   3        nb Liv1      in                        CAAR10618.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAANATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGA
  5   1   3        nb Tad5      in                          XZT6980.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTTTGGAAGACAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTG
  5   1   3        nb Gas7      in                         XZG38913.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGANAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAATAAAGCGCATGGCTGGTATGAAGGAATCTC
  5   1   3        nb Gas7      in                         XZG53013.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTC
  5   1   3        nb Neu                            TNeu050g06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCT
  5   1   3        nb TpA                            TTpA042g13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGATACCCTCAGAATACTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGAATTAAAAGTCAGCATCAAACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCTAAATGAGCTGTTCTTATATGTGTTAGAGAGTGTCAACATGCTAATGTCACCTCAAGGGCAAGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCC
  5   1   3        nb TpA                            TTpA004c15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCANAGTGCGTTACCTGAANGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAA
  5   1   3        nb TpA                            TTpA069h14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGCTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCANAGTGCGTTACCTGAANGTGTTTGAACCAAACTAANCTACAGCGACCATGATGTGATCAAATGGGTGCG
  5   1   3        nb Int1      in                         CAAP8805.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGAGTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCTCATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCNAAGTGCGTTACCTGAAGGTGTTTG
  5   1   3        nb HdA       in                   THdA046h08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CACCCACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATCGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAAC
  5   1   2       ext HdA       in                   THdA046l06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CACCCACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATCGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCANAGTGCGTTACNCTGAAAGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAAT
  3  -1   0       chi Eye       in                         CCAX8085.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTAAACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAAAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAAAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGGTTAGTTCTTATAATTGATATCCAAAAGTTTTTAAATTGAATTTTATTTTTTTGGGGAGTAGAGTGTCATTGCTTTAGTATACAAACGGTGAATTTACTTTTTCAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATT
  5   1   3        nb Eye       in                         CCAX9443.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTG
  5   1   3        nb Brn4      in                        CAAL20918.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGGCGC
  5   1   3        nb Ova1      in                         CABE8387.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCC
  5   1   3        nb TbA                            TTbA005n20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTNAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATT
  5   1   3        nb Ova1      in                        CABE10391.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACANCGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAA
  5   1   2       add AbdN                               IMAGE:7005733                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCCAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGGTGTTAATACATCACCAAAACTCAAAAAAGAAGTGGGCCCCCGTTCTCTTAAACTTGCCAATTTCCTTTTTTATTGGAGAAAAAAGGAAGTTCAACCATGCCTTAACCCAA
  5   1   3        nb Gas7                                 XZG35374.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGNGATCTATG
  5   1   3        nb Gas7      in                         XZG31155.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATATTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCNATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGA
  5   1   3        nb Tad5                                 XZT15654.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACANAACTCAGAAAGAAGT
  5   1   3        nb Mus1      in                         CABH8544.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCCTGATGTGATCAAATGGGTGCGATACATTGGCCG
  5   1   3        nb Tad5                                 XZT32466.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGNGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGA
  5   1   3        nb Liv1      in                         CAAR6971.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGNGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAAGGGTCAGAATGGGTAGGATTAAAGGTGTG
  5   1   2       ext Neu       in                   TNeu091l11.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCT
  5   1   3        nb Gas7      in                         XZG42456.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACANAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAG
  5   1   2       add Gas                            TGas017b04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTGTCAACCTGCTAATGTACCTCAGGGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGGC
  5   1   3        nb HdA                            THdA042p13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTG
  3   1   0       add Brn4      in                         CAAL6460.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAACAANGGCAAAGGAACCGCTGATGAGACTGGCAAAACGTGAGTAGAGTATTAACTGGTTAGAAAGGTGAATGTGGTCAAAGTGTCAGTTCCCATAAACTTAAATTGTAATTCTACCCTTGTCTCTTATGTAGAATGGTAGGGTGCATCTTGGGCTGTCTGTGGTTTGCATGCATAGGCTTTTAGGTATAAATCTGCGTCTGTCATGGAACTGCCTGAACACCTTTGAAATACTGGCATGGAAGCTAATTAACCTTTTATTTTTTTTTTTACAGAACAAGCTATTTTAATAATCTGTCAGCCATGATGTGAAATCTGATAAACTTAATCTATGGCAAAGTTATAGCTAATTCTTTAATGTCACATGATTTTTACTTTGAAAAGTAGTGACAAACATGATATAGTCATCAATTACTTTCCATCTGGGACTGTTTATCTTTATCCCATGCATAAATGTCAGAAAATGTAGCCATCCACAAATGTCTTTTTACTACACCTGGTCATATTGCTTAAGGTGCAAGCATATGGGGTTTTTTTTGGCTTAAAACCCCCCAAATGAATTGATGTACATTTTTGCTGTTTATACAAATTTTTTGTTATTTTCAAATATATGCATCTTTTTACTGCTTATAGCAGGGTTTTGGCCCAATTTAGGGTCAGCAAACCTAGGGTTAATTAAATATGTGAAGTGCAGGTAGGGTCAGTGACACTGAGTTTCAAAGTGAGCTAGCAAGCTGAAAGCCTGTTAGTAGCATTTGAGCCTTAAGCTGGCCATACACATTAAGATTTTTGAAAGATCTTTTCATTGTCATAGGACCAAGCTTATCCTG
  5   1   3        nb Ova1      in                         CABE4290.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCGAGGGACAAAATAGTGATTGAGAAACACGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGAATTAAGGTGTGAGATAGCCCTT
  5   1   3        nb Ova1      in                         CABE7000.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAG
  5   1   3        nb Gas                            TGas006n01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACAAGGCAAAGGAACCGCTGATGAGACTGGGCAAAACGGGNAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGGAAGTGTTTGAACCAAAACTAAACTACAGCGACCA
  5   1   3        nb TbA       in                   TTbA048g13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGGCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTT
  5   1   3        nb Gas7      in                         XZG59763.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGGCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGNGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTT
  5   1   3        nb Tad5                                 XZT67347.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAG
  5   1   3        nb TpA                            TTpA041j20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAACCGCTGATGAGACTGGCAAAACNGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCNGTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTAT
  5   1   3        nb Brn4      in                        CAAL11528.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGGCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGNGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAAT
  5   1   3        nb Thy1      in                        CBST9877.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGNGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGT
  5   1   3        nb Lun1      in                         CABD1648.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGGCATAGCTGCTATGTGGT
  5   1   3        nb HeRe                              EC2CAA4CD12.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAAC
  3  -1   3        nb Ovi1      in                        CABI12555.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGAGGGTACATTCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAG
  5   1   3        nb Ovi1      in                        CABI12701.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTAT
  3   1   0       add BrSp                             EC2BBA30DE07.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAAGTGTCAGTTCCCATAAACTTAAATTGTAATTCTACCCTTGTCTCTTATGTAGAATGGTAGGGTGCATCTTGGGCTGTCTGTGGTTTGCATGCATAGGCTTTTAGGTATAAATCTGCGTCTGTCATGGAACTGCCTGAACACCTTTGAAATACTGGCATGGAAGCTAATTAACCTTTTTTTTTTTTTTTTACAGAACAAGCTATTTTAATAATCTGTCAGCCATGATGTGAAATCTGATAAACTTAATCTATGGCAAAGTTATAGCTAATTCTTTAATGTCACATGATTTTTACTTTGAAAAGTAGTGACAAACATGATATAGTCATCAATTACTTTCCATCTGGGACTGTTTATCTTTATCCCATGCATAAATGTCAGAAAATGTAGCCATCCACAAATGTCTTTTTACTACACCTGGTCATATTGCTTAAGGTGCAAGCATATGGGGTTTTTTTTGGCTTAAAACCCCCCAAATGAATTGATGTACATTTTTGCTGTTTATACAAATTTTTTGTTATTTTCAAATATATGCATCTTTTTACTGCTTATAGCAGGGTTTTGGCCCAATTTAGGGTCAGCAAACCTAGGGTTAATTAAATATGTGAAGTGCAGGTAGGGTCAGTGACACTGAGTTTCAAAGTGAGCTAGCAAGCTGAAAGCCTGTTAGTAGCATTTGAGCCTTAAGCTGGCCATACACATTAAGAT
  3   1   2       add Gas7 5g3  in                         XZG14734.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCAAAAGATAGAAAGAAAAAAAAATAGATTAGATAAGAAGAAAACT
  5   1   3        nb Te1       in                         CBWN8279.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGG
  5   1   3        nb Ovi1      in                         CABI4232.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCATCGATTCGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAAATATGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCC
  5   1   3        nb Tbd0      in                       IMAGE:6977240                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTTATCTTATCTCACTCCCATCTG
  5   1   3        nb Tad5                                 XZT59618.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATACCACCCTCCATCTAGCACAGAC
  5   1   3        nb Tad5      in                         XZT60659.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCAC
  5   1   3        nb Egg                            TEgg103f09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTG
  5   1   3        nb Tad5      in                          XZT4839.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCGACACAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAG
  5   1   3        nb Tad5                                  XZT9065.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCCTCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGT
  5   1   3        nb Brn4      in                         CAAL7318.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTG
  5   1   3        nb Tad5      in                         XZT25228.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTG
  5   1   3        nb Eye                                  CCAX8411.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTT
  5   1   2       ext Tad5      in                         XZT56384.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTTCAATATATACAATTTTTACACTGTCAAAGGCCAGCAGAGTAGGAACA
  5   1   3        nb HdA       in                   THdA023c24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAGCTTGAGGTCAGGTGGTCATCAAATCTAATTTTAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGATGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCATATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGGCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCATAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCGTAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCAT
  5   1   3        nb Gas7                                 XZG26423.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTAT
  5   1   3        nb Tad5      in                           XZT343.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTTCACAATCATCCCNACCTTACTACTCATCATGGAACTGGCA
  5   1   3        nb Neu       in                   TNeu131m14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCACCCCCTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGC
  5   1   3        nb TpA       out                  TTpA006o14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACCGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAA
  5   1   3        nb Brn4      in                        CAAL11932.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGTGGAGTACAGGTCATTTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCA
  5   1   3        nb Gas7                                  XZG9510.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCT
  5   1   3        nb Eye       in                         CCAX8016.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTT
  5   1   3        nb Neu                            TNeu028j02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATAAGGGCCAGTGAGAATGCCATTGTGTGNGAAAATAAAGCGCCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGGCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCGTAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCAC
  5   1   3        nb Tail      in                         CBSW6288.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGGCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATCGGAGAGCTTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACTGACCA
  5   1   3        nb Gas7      in                         XZG26477.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGATATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAAC
  5   1   3        nb Brn4                                CAAL22526.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGGCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCGTAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAACCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCANATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCAATGTCTCT
  5   1   3        nb Te5       in                         CAAO9009.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCANATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCA
  5   1   3        nb Spl2      in                        CBSS2468.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGGCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCGTAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAACCTTCTTGGGTTCATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAAACACTGGGCAGAAGTTTCAGAGCAT
  5   1   2       add Gas7      in                         XZG30105.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGGCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCGTAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAACCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTACACTGTCCAAGGCCACCAGAGTAGGAACAACTGGG
  5   1   3        nb Te1       in                         CBWN7820.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGGCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCGTAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAACCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCA
  5   1   3        nb Brn4      in                        CAAL19444.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGGCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCGTAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAACCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCNAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGNGTTCAGTATGTGGCATG
  5   1   3        nb Mus1      in                         CABH3823.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAG
  5   1   3        nb Tad5      in                         XZT24675.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGT
  5   1   3        nb Gas       in                   TGas131j21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCATCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCA
  5   1   3        nb Ovi1      in                         CABI4304.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATGGGCTCGGCCATCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGCAATGTGTTTGAACCACAACTAAACTACAGCGACCATGATGTGATCAAATGCCTGCGATACATTGGCCGCAGAGAGATCTATGATACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTCAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGCGTCAGAATGGGAAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCTCTTCTTTAGC
  5   1   3        nb Gas                            TGas083e21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGGCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCGTAGCTGCTATG
  5   1   3        nb Neu       in                   TNeu120p23.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGGCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCGTAGCTGCTATGTGGTTTCCCAATAACCACCTCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTC
  5   1   3        nb TpA       out                  TTpA054l15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCGGGGCCCGGGGCCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGGCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCGTAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAACCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCANATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTANGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCA
  5   1   3        nb Gas7      in                         XZG16052.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGNGTTCAGTATGTGGCAT
  5   1   3        nb Gas7      in                         XZG16067.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGA
  5   1   3        nb Gas7                                 XZG20324.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGNGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAA
  5   1   3        nb Gas7      ?                          XZG26852.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAATAAGAGGTGAGGGATAGTTCTACAGGTGCTCATGTTACAGCT
  5   1   3        nb Tad5                                 XZT36327.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGC
  3   1   3        nb Ski1 5g3  in                         CABJ1642.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTC
  5   1   3        nb Tad5      in                         XZT42309.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCC
  5   1   3        nb Tad5      in                         XZT40980.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATACATTGGCCGCAGTGGGATCTATGAGACACGNGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCT
  3   1   2       add Tbd0 5g3  in                       IMAGE:6976369                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGGTTAATTACATTCACAAAAATTCAGAAAAGAAAGTTGGGCCCCGTTCTTCTTAAACTTGCATTTTCTTTTTTATTGAGAAAAAGGAAAGTCCAACATGCTAACCCAAGGGGTTCAGAATTGGGTAGGATTAAAAGGTGTGAGATAGCCCTTTCCTTTTTCCCCACCTGACCCATAATATCCACTTTTGCTCCATTTATACTTTTAATAACAATTCTTGCTGTTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATTCTCCGTGCTCCTTGTGTTGTGATTTGCTCNGTTTTTTTTGGGA
  3   1   3        nb AbdN 5g3  in                       IMAGE:7007373                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATCTATGAGACACGGTGTTAAATACATCACAAAACTTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTCTTTTATGAGANNAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCTGTGCTCCTTGTGTTGTGATTTGCTTCT
  5   1   3        nb Tad5                                 XZT11689.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATCTATGAGACACGGTGTTAATACATCACAAAACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCCTTGTGTGNGATTTGC
  5   1   3        nb Tad5      in                          XZT6749.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAACTCAGAAAGAAGTGGGCCCCGCTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCGTAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAACCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCAATGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTT
  5  -1   2       add Int1      in                         CAAP7573.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AACTCAGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATGNAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTNTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTG
  5   1   3        nb Gas       in                  TGas096o04.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGAAAGAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAATATATACAATTTTAACACTGT
  3   1   3        nb Tbd0      in                       IMAGE:6977240                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGTGGGCCCCCGTCTCTTAAACTTGCATTTCTTTTTTAATGAGAAAAGGGAAGTCAACATGCTAACCAAGGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTNTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATTCTCCGTGCTCCTTGTGTTGTGATTTGCTCAGTTTTTG
  5  -1   3        nb Ovi1      in                        CABI12555.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAGTGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACACAACCTCGTGCCGAATTGA
  5   1   3        nb BrSp      in                     EC2BBA31AB12.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGGCCCCGTCTCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATCGGAGAGCTTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACTTTTTATTCCTTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCGTGGAACTGGCAACCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGC
  3   1   2       ext Te5       in                         CAAO7516.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGCCCCCGTCTCTTAACTTGCATTTCTTTTTATGAGAAAAGGGAAGTCACCATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTCCTTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCGTAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAACCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCAATGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAAC
  3   1   3        nb Liv1      in                        CAAR10618.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGTCTCTTAACTGCATTTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTNTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACAC
  3   1   3        nb Int1      in                         CAAP8805.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGTCTCTTAACTTGCATTTCTTTTTATGNAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTNTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGC
  5   1   3        nb Ova1                                 CABE2064.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCTTAACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCT
  3   1   3        nb Gas                             TGas086o19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACTTGCATTTCTTTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTAAAGACTGTACAAGTAATAAACAGCGTAGAACACAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Brn3 5g3  in                         CAAK3147.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTGCATTTCTTTTTATTGAGAAAAGGAAGTCANCATGCTANCCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTCCTTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCGTAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAACCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCAATGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACAC
  3   1   2       add AbdN 5g3  in                       IMAGE:6998033                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCCCGTTCTACTGCATTTCTTTATGAGAAAGGAGTCACATGCTACCANGGGTCAGATGGTAGGGATAAAGGTGTGAGATAGCCCTTCCTTTTCCCACCTGACCATAATATCCACCTNTGCTCCATTATACTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTCCCGGGAAGTCGCTCCAACTGACAAGTATAACGCACC
  3   1   3        nb Gas       in                    TGas131j21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCATCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCNCCCTCACATTTCGCGTGCTCCCTTGTGTTGTGATTTGTCTCTGTTTTTTCTTTGTGACGCCTCAAACCTGTACAAGGTAATAAACAGGCGTAGAACACAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas                             TGas136b18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCTCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAGACCTGTACAAGTAATAAACAGCGTAGAACACAAAAAAAAAAAAAAAAAA
  3   1   3        nb Lun1      in                         CABD1648.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACAC
  3   1   3        nb Ski1 5g3  in                         CABJ4021.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTATTGAGAAAAGGAAGTCAACATGCTACCNAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACAC
  3   1   2       ext HdA  5g3  in                   THdA016k04.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTATTGAGAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTGAACACAAAAAAAAAAAAAAAAA
  3   1   3        nb Liv1      in                         CAAR6971.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGAGAAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCTTTTTCCCACCTGACCATAATATCCACCTTNGCTCCATTATACTNTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGACTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACAC
  3   1   2       ext Neu       in                    TNeu091l11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGAAAAGGAAGTCAACATGCTANCCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACACaaaaaatgaagaaaaaaaaaaaataataaaagaaaacgacgaattaaaaaaaaaaaatcaaaaaaaaaaaaaaaaaa
  3   1   3        nb Te5  5g3  in                        CAAO10108.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGAAAAGGAAGTCAACATGCTACCAAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTNTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCGTAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAACCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCAATGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACAC
  3   1   2       ext Neu  5g3  in                    TNeu123l16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCNTTCCTTTTTCCCCACCTGACCCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACACaaaaaaaaaaataaaaaaaaattaaaaaaaaaaaaaaaaaa
  3   1   3        nb Mus1      in                         CABH5796.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAAAAGGAAGTCAACATGCTANCCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACAC
  3   1   3        nb Brn4      in                        CAAL19444.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAAGGAAGTCACNATGCTACCAAGGGGGTCAGAATGGGTAGGATAAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCGTAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAACCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCAATGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACAC
  3   1   3        nb Brn4 5g3  in                        CAAL21934.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAAGGAAGTCAACATGCTANCCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCGTAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAACCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCAATGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACAC
  3   1   3        nb Mus1      in                         CABH3823.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACACAA
  3   1   3        nb Ski1 5g3  in                        CABJ10034.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAAGGAAGTCACCATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCGTAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAACCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCAATGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACAC
  3   1   2       add Mus1      in                         CABH7069.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAGGAAGTCAACATGCTAACCAGGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTNTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACAC
  3   1   3        nb Hrt1      in                         CAAQ1882.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCTTCCTTTTTCCCACCTGACCATAATATCCACCTNTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACAC
  5   1   3        nb Spl1      in                         CABK7839.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGGAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCANACTGTACAAGTAATAAACAGCGTAGAACAC
  3   1   3        nb Brn4      in                         CAAL7318.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAGTCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTNTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACAC
  3   1   3        nb Ovi1 5g3  in                          CABI633.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGTCAACATGCTACCAAGGGNTTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTCCTTTTTCCCACCTGACCATAATATCCACCTNTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCTGTGCTCCTTGTATTGCGATTTGCTCTG
  3   1   3        nb Ovi1      in                         CABI4232.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTCAACATGCTACCNAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTNTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACAC
  5   1   3        nb Tad5                                  XZT9519.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGTCACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACA
  3   1   3        nb Te4  5g3  in                        CAAN10382.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCAACATGCTAACCAAGGGGTCAGAATGGTAGGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTNTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCGTAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAACCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCAATGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACAC
  3   1   0       chi Liv1                                 CAAR7163.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCAACATGCTAACCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATGAGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGACTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATAGTTTATCTATAATGTCTGGTAACAGACTAAAGGCAGCATGTACAGTGTTTTGGTGCAGTTCTAGAGGCAGTTAGGCTCTAATAACTCACTGGTCAACAAAGTAGAGTTTGGGCTGCAGTGACCAGTGTCTTCTCTTTAAATGACAATGTGTCGCACATCTAGTGCAGTGTAGTGGCAAGTTCACACCCCTGGCACTTCCACACATGAAAAA
  3   1   3        nb HdA  5g3  in                    THdA051l11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCGGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTATTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTTTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGGCGTGGAACACAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Spl1 5g3  in                        CABK10456.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCGTAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAACCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCAATGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTGGACCCC
  3   1   3        nb Gas       in                    TGas096o04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATTTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTTTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTTTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTTTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTTTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATTTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGGCGTGGACCCCaaaaaaaaaaaaaaaaaaaagaaaaaaaaaaaaaagcaaataaaaaaaaaaaaaaaaaa
  3   1   2       ext Brn4 5g3  in                         CAAL7544.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGGGGTCAGAATGGGTAGGATAAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCGTAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAACCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCAATGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACAC
  3   1   3        nb Te5       in                         CAAO7838.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTNTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCGTAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAACCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCAATGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACAC
  3   1   3        nb Ova1      in                        CABE10391.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGGGGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACAC
  5  -1   2       add Int1      in                        CAAP12835.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTT
  3   1   3        nb Spl1      in                         CABK7839.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACAC
  3   1   3        nb Ova1      in                         CABE7000.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACACAAAA
  3   1   3        nb Ovi1      in                        CABI12701.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACACAT
  3   1   3        nb Tad5 5g3  in                         XZT54762.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCGTAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAACCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCAATGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAG
  3   1   2       ext Tad5      in                         XZT56384.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACAC
  3   1   2       add Gas  5g3  in                    TGas127m03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCGTAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCGGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAACCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCAATGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGGCGTAGAACCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Brn3 5g3  in                         CAAK5457.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGATGGGGTAGGATAAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCGTAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAACCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCAATGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACCC
  3   1   2       ext Gas7 5g3  in                         XZG59280.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGAATGGGTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAAC
  3   1   2       add Tad5 5g3  in                         XZT19087.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGAATGGTAGGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGTAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACAC
  3   1   2       ext HdA       in                    THdA046l06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGGTAGGATAAAAGGTGTGAGATAGCCTTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCGTAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAACCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCAATGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGGAACGGTCAAACTGTACAAGTAATAAACAGCGTGAACAAAAAAAAAAAAAAAAAAGC
  3   1   3        nb Brn4      in                        CAAL20918.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTAGGATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCGTAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAACCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCAATGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAAC
  3   1   3        nb Te1  5g3  in                        CBWN15475.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAGGATTAAAGGTGTGAGATAGCCTTTCCTTTTTCCCACTGACCATAATATCCACTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACACAAAAAAAAAAAAAAA
  5   1   3        nb Gas                            TGas019g22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTAAAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCGTAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAACCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCAATGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTT
  3   1   3        nb Te5       in                        CAAO12633.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGGTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCGTAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAACCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCAATGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGACCCC
  3   1   3        nb Thy1 5g3  in                         CBST483.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGTGAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTNTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACAC
  3   1   2       add Te5       in                         CAAO2519.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGTGAGATAGCCCTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACAC
  3   1   2       ext Te1  5g3  in                        CBWN17677.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCGTAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAACCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCAATGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAACACAAAAAAAAAAAAAAA
  5   1   3        nb BrSp      in                     EC2BBA19CD12.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGATAGCCCTTCCTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACCTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCGTAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAACCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGA
  3   1   3        nb Mus1 5g3  in                         CABH2647.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCTGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGGCGTAGAACAC
  3   1   3        nb Gas7      in                         XZG20367.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTTTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTGNCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAG
  3   1   3        nb Tad5      in                         XZT24675.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTTCCCACCTGACCATAATATCCACCTNTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGCGTAGAAC
  3   1   3        nb BrSp 5g3  in                     EC2BBA26CB10.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCCTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCGTAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAACCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGACCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTATTTGCTCTGTTTTCTTTGGACGCTCAAACTGTACA
  3   1   3        nb Tad5      in                          XZT4839.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTCCCCACCTGACCATAATATCCACCTTTGCTCCATTATACTTTTAATAACAATTCTTGCTGTTCCCTTCTTTAGCATTGGAGAGCGTTATCATTTATAAGATGCGCTCTCTATGATATGGAGTATCCTCTGGGCCATAGCTGCTATGTGGTTTCCCAATAACCACCTCCCATCTAGCACAGACCAGGCCGTATCTTATCTCACTCCCATCTGTGAATATTGATGACCGATAGTATTCTTGTATAGTGTAGTGCTTTCCACAATCATCCCAACCTTACTACTCATCATGGAACTGGCAGCCTTCTTGGGTTCAATGTTCCCTAGTATTTCTTTCAAATATATACAATTTTAACACTGTCAAAGGCCAGCAGAGTAGGAACAACTGGGCAGAAGTTTCAGAGCATTGGGTTCAGTATGTGGCATGGGAGGTTTTGCATTGTCTCTTCATGGAATAACTCAAGCACTCTATTATATGTGCCCAAATAAGAGGTGAGGGATAAGTTCTACAGGTGCTCATGTTACAGCTGAAGGTTGTGTAAGAAAGTATAAATTGTGCACTTCTGTGTCCTTTAGCTCCTGCAGTAACAGGGAGTGTATGGATTTAACCATATCATAGCCAGTTAATCATTAGTGCTGGCACAGGAATGATTTTGCTATTTGTGGCAGTGTGACTTCCCCCTCACATCTCCGTGCTCCTTGTGTTGTGATTTGCTCTGTTTTTCTTTGTGACGCTCAAACTGTACAAGTAATAAACAGC
  3   1   3        nb Brn4 5g3  in                        CAAL20803.3p