Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xt7.1-TTbA014p24.3                        153 END     2           0        1                plakophilin-3 [Xenopus laevis]

 This cluster: approximate FL confidence score = 97%

 1012070346 Xt7.1-CABJ4233.3 - 230 ESTs
                                                                       ..-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABJ4233.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCGGTGTCCAACGCGGCACTTCCGGGAGGAAGCGAGAGACAGGGTGACGTGGGCCGAGCGGTGCGACACAAGCCGGGGAGATGCTGACCAAGTTTGAGACTAAGTCCGCCCGAGTGAAAGGGCTGAGCTTCCACCCGAAGAGACCGTGGGTCCTCACCAGCCTGCACAATGGGGTCATCCAGCTGTGGGACTACCGCATGTGCACCCTTATCGACAAGTTTGATGAGCACGACGGTCCCGTCCGTGGCATTGACTTCCACAAGCAGCAGCCATTGTTCGTATCAGGAGGGGACGACTACAAAATCAAGGTGTGGAATTACAAGCTCCGGCGCTGCCTCTTCACCCTGCTGGGACATCTCGATTATATCCGCACCACCTTTTTCCATCATGAGTACCCCTGGATCCTGAGTGCCTCTGATGATCAGACCATCCGCATCTGGAACTGGCAATCTCGCACTTGCGTTTGCGTTCTGACGGGTCACAACCATTACGTCATGTGTGCTCAGTTCCACCCCTCTGAAGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATATTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTATTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGGGCACGATCGTGGCGTTAACTGGGCTGCCTTCCACCCCACCATGCCTCTCATTGTATCTGGAGCAGATGACCGACAAGTCAAAATCTGGAGGATGAACGAGTCCAAAGCCTGGGAAGTGGACACGTGCCGCGGTCATTACAACAACGTCTCGTGCGCCGTCTTTCATCCCCGCCAAGAGCTGATTCTCAGTAACTCCGAAGACAAAAGCATTAGAGTGTGGGATATGTCCAAAAGGACTGGAGTCCAGACTTTCCGCAGAGACCACGACCGTTTCTGGGTACTGGCCGCCCACCCAAATCTTAACCTGTTTGCTGCAGGGCATGACGGTGGCATGATTGTATTCAAGCTGGAACGAGAGCGTCCCGCCTATGCCGTGCACGGCAATATCTTGTATTATGTGAAGGACAGATTCCTGCGCCAGTTGGACTTTAACAGCTCCAAGGATGTGGCTGTTATGCAGCTAAGGAGCGGCTCCAAGTTCCCTGTGTTCAATATGTCGTACAACCCAGCTGAAAATTCCGTCCTGCTTTGCACGAGAGCCAGCAACCTGGAGAACAGCACTTATGACCTGTACACCATCCCCAAGGATACCGACTCCCAGAATCCCGATGCCCCTGAAGGGAAGCGATCCTCTGGTCTGACTGCAGTGTGGGTGGCACGGAATAGATTTGCCGTCCTGGATCGCATGCATTCTATTCTCATCAAGAACCTGAAGAATGAGATCACCAAGAAGGTCCAGGTGCCCAACTGTGATGAGATCTTCTATGCCGGCACTGGGAACCTGCTGCTCCGGGATTCCGACTCCATCACTCTATTTGATGTGCAGCAGAAGCGCACCCTGGCATCTGTGAAGATCTCCAAAGTGAAGTATGTCATTTGGTCCTCCGACATGTCCCACGTGGCTCTTCTTGCCAAGCATGCCATTATGATCTGCAATAGAAAGCTGGAGTCCCTCTGCAACATCCATGAAAATATCCGTGTCAAGAGCGGTGCCTGGGACGAGAGCGGGGTTTTCATCTACACGACCAGCAACCATATCAAATACGCACTCACCACTGGAGATCACGGTATTATTCGAACACTGGATCTGCCCATTTACATCACACGCGTCAAGGGCAACAACGTCTACTGCCTGGACCGGGAGTGCAGACCTCGGGTGCTGACCATTGACCCCACTGAATTCAAGTTCAAGCTCGCTTTGATTAACAGGAAGTACGATGAGGTGCTGCACATGGTGAGAAATGCTAAACTGGTGGGACAGTCCATCATTGCCTACCTCCAAAAGAAGGGCTACCCAGAGGTGGCATTGCACTTTGTGAAGGACGAGAAGACCCGATTCAGCTTGGCTCTGGAATGTGGAAACATAGAGATCGCCCTTGAAGCAGCGAAGGCTCTGGACGACAAGAATTGCTGGGAGAAGCTGGGGGAGGTGGCCCTGCTCCAGGGGAACCACCAGATTGTGGAGATGTGCTACCAGCGCACCAAGAACTTTGACAAGCTCTCCTTCCTTTACCTCATCACCGGCAACCTGGAAAAACTGCGCAAGATGATGAAAATCGCGGAGATCCGTAAGGACATGAGCGGCCAGTACCAGAATGCACTGTTCCTGGGGGACGTAGACGAAAGAGTGCGGATACTAAAGAACTGTGGGCAGAAATCTCTGGCCTACCTGACAGCCGCCACCCACGGAATCAACGATGAAGAAGAGGGCTTGAGGGAGACTTTCGACCCAGAAAAAGAAATAATTCCAGAGGTTGACCCTGATGCTAAGCTGCTGATGCCCCCACCCCCCATCATGCCTCTGGACACCAACTGGCCTCTGTTGACCATGTCTAAGGGCTTCTTTGAAGGATCCATTGGCAACAAAGGTAAAGGTGGAGCCCTGGCTGCGGATATCGATGTAGATACTGTGGGAGGTGAAGGCTGGGGAGAAGATGCCGAGCTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGAGAAAACTTTGGAGACGAGGTGGCAGGCAAAGGGCAAGAAGAGGGCGGTGGATGGGATGTGGAAGAGGATCTTGACCTTCCCCCTGAACTGGATGTTCCCTCTGGCCCGTCTGGCACAGCTGAAGATGGATTCTTTGTGCCCCCAACTAAAGGCAACAGTCCATCGCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACGTCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTGGAGTGGTGGACTTTGGCCCGTTCAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACCTACCAGGCCCTGCCAGGTCTCCCATCCATGTATGGCTACCCTCAGCGCAATTGGAAGGACGCAGGGTTAAAGAATGGGCTTCCTGCTGTCGGCCTGAAGCTCAACGACTTGATACAGCGCCTTCAGCTGTGCTACCAGCTCACCACATCCGGCAAGTTCGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008221734                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCAACGCGGCACTTCCGGGAGGAAGCGAGAGACAGGGTGACGTGGGCCGAGCGGTGCGACACAAGCCGGGGAGATGCTGACCAAGTTTGAGACTAAGTCCGCCCGAGTGAAAGGGCTGAGCTTCCACCCGAAGAGACCGTGGGTCCTCACCAGCCTGCACAATGGGGTCATCCAGCTGTGGGACTACCGCATGTGCACCCTTATCGACAAGTTTGATGAGCACGACGGTCCCGTCCGTGGCATTGACTTCCACAAGCAGCAGCCATTGTTCGTATCAGGAGGGGACGACTACAAAATCAAGGTGTGGAATTACAAGCTCCGGCGCTGCCTCTTCACCCTGCTGGGACATCTCGATTATATCCGCACCACCTTTTTCCATCATGAGTACCCCTGGATCCTGAGTGCCTCTGATGATCAGACCATCCGCATCTGGAACTGGCAATCTCGCACTTGCGTTTGCGTTCTGACGGGTCACAACCATTACGTCATGTGTGCTCAGTTCCACCCCTCTGAAGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATATTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTATTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGGGCACGATCGTGGCGTTAACTGGGCTGCCTTCCACCCCACCATGCCTCTCATTGTATCTGGAGCAGATGACCGACAAGTCAAAATCTGGAGGATGAACGAGTCCAAAGCCTGGGAAGTGGACACGTGCCGCGGTCATTACAACAACGTCTCGTGCGCCGTCTTTCATCCCCGCCAAGAGCTGATTCTCAGTAACTCCGAAGACAAAAGCATTAGAGTGTGGGATATGTCCAAAAGGACTGGAGTCCAGACTTTCCGCAGAGACCACGACCGTTTCTGGGTACTGGCCGCCCACCCAAATCTTAACCTGTTTGCTGCAGGGCATGACGGTGGCATGATTGTATTCAAGCTGGAACGAGAGCGTCCCGCCTATGCCGTGCACGGCAATATCTTGTATTATGTGAAGGACAGATTCCTGCGCCAGTTGGACTTTAACAGCTCCAAGGATGTGGCTGTTATGCAGCTAAGGAGCGGCTCCAAGTTCCCTGTGTTCAATATGTCGTACAACCCAGCTGAAAATTCCGTCCTGCTTTGCACGAGAGCCAGCAACCTGGAGAACAGCACTTATGACCTGTACACCATCCCCAAGGATACCGACTCCCAGAATCCCGATGCCCCTGAAGGGAAGCGATCCTCTGGTCTGACTGCAGTGTGGGTGGCACGGAATAGATTTGCCGTCCTGGATCGCATGCATTCTATTCTCATCAAGAACCTGAAGAATGAGATCACCAAGAAGGTCCAGGTGCCCAACTGTGATGAGATCTTCTATGCCGGCACTGGGAACCTGCTGCTCCGGGATTCCGACTCCATCACTCTATTTGATGTGCAGCAGAAGCGCACCCTGGCATCTGTGAAGATCTCCAAAGTGAAGTATGTCATTTGGTCCTCCGACATGTCCCACGTGGCTCTTCTTGCCAAGCATGCCATTATGATCTGCAATAGAAAGCTGGAGTCCCTCTGCAACATCCATGAAAATATCCGTGTCAAGAGCGGTGCCTGGGACGAGAGCGGGGTTTTCATCTACACGACCAGCAACCATATCAAATACGCACTCACCACTGGAGATCACGGTATTATTCGAACACTGGATCTGCCCATTTACATCACACGCGTCAAGGGCAACAACGTCTACTGCCTGGACCGGGAGTGCAGACCTCGGGTGCTGACCATTGACCCCACTGAATTCAAGTTCAAGCTCGCTTTGATTAACAGGAAGTACGATGAGGTGCTGCACATGGTGAGAAATGCTAAACTGGTGGGACAGTCCATCATTGCCTACCTCCAAAAGAAGGGCTACCCAGAGGTGGCATTGCACTTTGTGAAGGACGAGAAGACCCGATTCAGCTTGGCTCTGGAATGTGGAAACATAGAGATCGCCCTTGAAGCAGCGAAGGCTCTGGACGACAAGAATTGCTGGGAGAAGCTGGGGGAGGTGGCCCTGCTCCAGGGGAACCACCAGATTGTGGAGATGTGCTACCAGCGCACCAAGAACTTTGACAAGCTCTCCTTCCTTTACCTCATCACCGGCAACCTGGAAAAACTGCGCAAGATGATGAAAATCGCGGAGATCCGTAAGGACATGAGCGGCCAGTACCAGAATGCACTGTTCCTGGGGGACGTAGACGAAAGAGTGCGGATACTAAAGAACTGTGGGCAGAAATCTCTGGCCTACCTGACAGCCGCCACCCACGGAATCAACGATGAAGAAGAGGGCTTGAGGGAGACTTTCGACCCAGAAAAAGAAATAATTCCAGAGGTTGACCCTGATGCTAAGCTGCTGATGCCCCCACCCCCCATCATGCCTCTGGACACCAACTGGCCTCTGTTGACCATGTCTAAGGGCTTCTTTGAAGGATCCATTGGCAACAAAGGTAAAGGTGGAGCCCTGGCTGCGGATATCGATGTAGATACTGTGGGAGGTGAAGGCTGGGGAGAAGATGCCGAGCTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGAGAAAACTTTGGAGACGAGGTGGCAGGCAAAGGGCAAGAAGAGGGCGGTGGATGGGATGTGGAAGAGGATCTTGACCTTCCCCCTGAACTGGATGTTCCCTCTGGCCCGTCTGGCACAGCTGAAGATGGATTCTTTGTGCCCCCAACTAAAGGCAACAGTCCATCGCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACGTCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTGGAGTGGTGGACTTTGGCCCGTTCAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACCTACCAGGCCCTGCCAGGTCTCCCATCCATGTATGGCTACCCTCAGCGCAATTGGAAGGACGCAGGGTTAAAGAATGGGCTTCCTGCTGTCGGCCTGAAGCTCAACGACTTGATACAGCGCCTTCAGCTGTGCTACCAGCTCACCACATCCGGCAAGTTCGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      3     3     5     6     6     7    11    12    16    17    22    23    27    28    30    31    31    32    31    32    32    32    32    32    32    32    33    33    33    33    33    33    33    33    33    33    33    33    33    33    33    33    33    33    33    33    33    33    33    33    32    32    32    32    32    33    32    33    32    33    33    34    33    34    33    34    33    34    33    34    34    35    34    36    34    36    34    36    34    36    34    36    34    36    34    36    34    36    33    36    34    37    34    36    34    36    35    37    35    37    36    38    36    38    36    38    36    38    37    38    37    38    37    38    35    38    35    38    35    38    34    36    33    35    33    35    32    35    33    35    30    32    22    26    22    25    22    25    18    22    16    21    14    19    14    18    10    13    11    13    13    15    12    14    12    13    12    13    12    12    11    12    12    12    12    12    11    11    11    11    11    11    11    11    11    11    11    11    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    11    12    12    12    12    12    12    12    12    12    12    12    12    12    12    11    12    11    11    11    11    11    11    11    11    11    11    10    10    10    10    10    10    10    10     9    10     9    10     9     9    10    10    10    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    12    12    13    13    13    14    13    14    12    13    12    13    12    13    12    13    15    15    16    16    16    16    13    14    16    16    16    16    16    16    17    17    17    17    17    17    17    17    17    17    18    18    19    19    18    18    18    18    18    18    18    18    17    18    18    18    18    18    19    19    20    21    20    21    19    22    20    22    19    21    21    21    21    21    21    21    22    22    22    22    23    23    23    23    24    24    24    25    24    25    24    25    25    27    26    28    28    29    28    29    29    30    29    30    29    30    29    30    29    29    30    30    30    31    30    31    29    31    29    31    30    32    31    33    29    32    28    33    29    33    30    34    29    34    29    33    28    32    27    31    27    32    26    31    24    28    24    27    25    28    25    29    25    30    24    31    25    31    27    32    28    32    26    32    26    32    27    33    32    37    32    36    32    34    32    35    32    35    32    34    33    34    31    35    32    36    32    35    32    35    33    36    34    37    32    36    32    36    32    36    32    36    32    37    33    37    32    37    33    38    34    36    33    36    33    36    34    36    32    35    32    35    32    35    32    35    30    33    28    32    28    32    28    31    29    32    30    31    30    31    29    30    29    30    29    30    28    29    29    30    29    31    30    33    30    33    33    37    34    38    33    38    36    40    33    39    32    42    40    46    46    51    53    58    57    64    69    74    75    80    83    88    87    93    89    97    94   102   100   106   104   110   106   112   105   111   109   117   112   116   113   117   115   117   116   117   104   116   113   114   106   115   115   117   115   117   113   118   113   119   114   119   116   120   117   118   111   118   113   116   112   116   109   116   111   116   110   114   114   119   108   119   113   118   115   118   115   120   116   119   117   119   117   119   116   119   111   118   111   117   115   116   116   117   113   117   116   116   112   116   114   117   112   117   114   117   115   117   114   117   116   116   111   115   111   114   104   113   103   111   106   108    96   104    98   103    94    97    38    46     8    14     6     7
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----T--T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --T-------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -T--------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------G--G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -G---------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------A-----
                                               BLH ATG      80    2255                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               BLH MIN      77     325                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               BLH OVR      80      44                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               CDS MIN      80      17                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               EST CLI      32      17                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               ORF LNG      80      11                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Br ---= 5e-010     AAM88902.1 guanine nucleotide-binding protein [Branchiostoma lanceolatum] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Br ---= 5e-010     AAX54700.1 receptor of activated protein kinase C 1 [Branchiostoma belcheri tsingtaunese] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Ci ---- 1e-017     BAC57516.1 beta-transducin repeat-containing homologue protein [Ciona intestinalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Bf ---- 4e-025     AAM18868.1 unknown [Branchiostoma floridae] ---------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Xt ---- 4e-073     AAH96500.1 Hypothetical protein mgc108081 [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Sc ==== 0          NP_010136.1 alpha subunit of the coatamer complex; gamma-alpha-COP; Cop1p [Saccharomycescerevisiae] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Ce ==== 0          NP_491069.1 coatomer (137.7 kD) (1D464) [Caenorhabditis elegans] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Dm ==== 0          NP_477395.1 alpha-coatomer protein CG7961-PA [Drosophila melanogaster] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Sp ==== 0          XP_001179078.1 PREDICTED: similar to alpha-cop protein, partial [Strongylocentrotus purpuratus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Dr ==== 0          NP_001001941.1 coatomer protein complex, subunit alpha [Danio rerio] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Mm ==== 0          NP_034068.2 coatomer protein complex subunit alpha [Mus musculus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Hs ==== 0          NP_004362.1 coatomer protein complex, subunit alpha; alpha coat protein; xenin [Homosapiens] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Gg ==== 0          NP_001026576.1 coatomer protein complex, subunit alpha [Gallus gallus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xl ==== 0          AAH75251.1 Copa-prov protein [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === ?? ==== 0          NP_001086488.1 coatomer protein complex, subunit alpha [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABJ4233.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGA---------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATGATG------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG---------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------ATG------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
  5   1   2   14  bld Te4  5g3  in                        CAAN10455.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCGGACTAGCGTTGCGCAGGCGCAGTGAGGGGGCGTAGCGGTGTCCAACGCGGCACTTCCGGGAGGAAGCGAGAGACAGGGTGACGTGGGCCGAGCGGTGCGACACAAGCCGGGGAGATGCTGACCAAGTTTGAGACTAAGTCCGCCCGAGTGAAAGGGCTGAGCTTCCACCCGAAGAGACCGTGGGTCCTCACCAGCCTGCACAATGGGGTCATCCAGCTGTGGGACTACCGCATGTGCACCCTTATCGACAAGTTTGATGAGCACGACGGTCCCGTCCGTGGCATTGACTTCCACAAGCAGCAGCCATTGTTCGTATCAGGAGGGGACGACTACAAAATCAAGGTGTGGAATTACAAGCTCCGGCGCTGCCTCTTCACCCTGCTGGGACATCTCGATTATATCCGCACCACCTTTTTCCATCATGAGTACCCCTGGATCCTGAGTGCCTCTGATGATCAGACCATCCGCATCTGGAACTGGCAATCTCGCACTTGCGTTTGCGTTCTGACGGGTCACAACCATTACGTCATGTGTGCTCAGTTCCACCCCTCTGAAGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATATTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTATTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGGGCACGATCGTGGCGTTAACTGGGCTGCCTTCCACCCCACCATGCCTCTCATTGTATCTGGAGCAGATGACCGACAAGTCAAAATCTGGAGGATGAACGAGT
  5   1   2   14  bld Te4  5g3  in                         CAAN6092.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGACTAGCGTTGCGCAGGCGCAGTGAGGGGGCGTAGCGGTGTCCAACGCGGCACTTCCGGGAGGAAGCGAGAGACAGGGTGACGTGGGCCGAGCGGTGCGACACAAGCCGGGGAGATGCTGACCAAGTTTGAGACTAAGTCCGCCCGAGTGAAAGGGCTGAGCTTCCACCCGAAGAGACCGTGGGTCCTCACCAGCCTGCACAATGGGGTCATCCAGCTGTGGGACTACCGCATGTGCACCCTTATCGACAAGTTTGATGAGCACGACGGTCCCGTCCGTGGCATTGACTTCCACAAGCAGCAGCCATTGTTCGTATCAGGAGGGGACGACTACAAAATCAAGGTGTGGAATTACAAGCTCCGGCGCTGCCTCTTCACCCTGCTGGGACATCTCGATTATATCCGCACCACCTTTTTCCATCATGAGTACCCCTGGATCCTGAGTGCCTCTGATGATCAGACCATCCGCATCTGGAACTGGCAATCTCGCACTTGCGTTTGCGTTCTGACGGGTCACAACCATTACGTCATGTGTGCTCAGTTCCACCCCTCTGAAGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATATTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTATTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGGGCACGATCGTGGCGTTAACTGGGCTGCCTTCCACCCCACCATGCCTCTCATTGTATCTGGAGCAGATGACCGANCAGTCAAAATCTGGAGGATGAACGAGTCCAAAGCCTGGGAAGTGGACACGTGCCGCGGTCATTACAACAACGTCTC
  5   1   2       bld Te4       in                        CAAN11014.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGCGTAGCGGTGTCCAACGCGGCACTTCCGGGAGGAAGCGAGAGACAGGGTGACGTGGGCCGAGCGGTGCGACACAAGCCGGGGAGATGCTGACCAAGTTTGAGACTAAGTCCGCCCGAGTGAAAGGGCTGAGCTTCCACCCGAAGAGACCGTGGGTCCTCACCAGCCTGCACAATGGGGTCATCCAGCTGTGGGACTACCGCATGTGCACCCTTATCGACAAGTTTGATGAGCACGACGGTCCCGTCCGTGGCATTGACTTCCACAAGCAGCAGCCATTGTTCGTATCAGGAGGGGACGACTACAAAATCAAGGTGTGGAATTACAAGCTCCGGCGCTGCCTCTTCACCCTGCTGGGACATCTCGATTATATCCGCACCACCTTTTTCCATCATGAGTACCCCTGGATCCTGAGTGCCTCTGATGATCAGACCATCCGCATCTGGAACTGGCAATCTCGCACTTGCGTTTGCGTTCTGACGGGTCACAACCATTACGTCATGTGTGCTCAGTTCCACCCCTCTGAAGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATATTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTATTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGGGCACGATCGTGGCGTTAACTGGGCTGCCTTCCACCCCACCATGCCTCTCATTGTATCTGGAGCAGATGACCGACAAGTCAAAATCTGGAGGATGAACGAGTCCAAAGCCTGGGAAGTGGA
  5   1   2   14  bld Brn3 5g3  in                         CAAK2612.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGCGGCACTTCCGGGAGGAAGCGAGAGACAGGGTGACGTGGGCCGAGCGGTGCGACACAAGCCGGGGAGATGCTGACCAAGTTTGAGACTAAGTCCGCCCGAGTGAAAGGGCTGAGCTTCCACCCGAAGAGACCGTGGGTCCTCACCAGCCTGCACAATGGGGTCATCCAGCTGTGGGACTACCGCATGTGCACCCTTATCGACAAGTTTGATGAGCACGACGGTCCCGTCCGTGGCATTGACTTCCACAAGCAGCAGCCATTGTTCGTATCAGGAGGGGACGACTACAAAATCAAGGTGTGGAATTACAAGCTCCGGCGCTGCCTCTTCACCCTGCTGGGACATCTCGATTATATCCGCACCACCTTTTTCCATCATGAGTACCCCTGGATCCTGAGTGCCTCTGATGATCAGACCATCCGCATCTGGAACTGGCAATCTCGCACTTGCGTTTGCGTTCTGACGGGTCACAACCATTACGTCATGTGTGCTCAGTTCCACCCCTCTGAAGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATATTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTATTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGGGCACGATCGTGGCGTTAACTGGGCTGCCTTCCACCCCACCATGCCTCTCATTGTATCTGGAGCAGATGACCGACAAGTCAAAATCTGGAGGATGAACGAGTCCAAAGCCTGGGAAGTGGACACGTGCCGCGGTCATTACACAACGTCTCGTGCGCCGTCTTTCATCCCGCCAAGAGCTGATTCTCAGTAAC
  5   1   2       chi Te4       in                        CAAN11838.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGCCGGGGCTTGTGGGCAACTCTTGAAACAACTTGGTCTCCAGTTCCTACAGTGCCTTGCAGCGTTGCCGTTAGTCATTTGCTCAAAGGAATTATACTTAAATATGGGGGCTGAGCTTCCACCCGAAGAGACCGTGGGTCCTCACCAGCCTGCACAATGGGGTCATCCAGCTGTGGGACTACCGCATGTGCACCCTTATCGACAAGTTTGATGAGCACGACGGTCCCGTCCGTGGCATTGACTTCCACAAGCAGCAGCCATTGTTCGTATCAGGAGGGGACGACTACAAAATCAAGGTGTGGAATTACAAGCTCCGGCGCTGCCTCTTCACCCTGCTGGGACATCTCGATTATATCCGCACCACCTTTTTCCATCATGAGTACCCCTGGATCCTGAGTGCCTCTGATGATCAGACCATCCGCATCTGGAACTGGCAATCTCGCACTTGCGTTTGCGTTCTGACGGGTCACAACCATTACGTCATGTGTGCTCAGTTCCACCCCTCTGAAGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATATTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTATTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGGGCACGATCGTGGCGTTAACTGGGCTGCCTTCCACCCCACCATGACTCTCATTGTATCTGGAGCAGATGACCGACAAGTCAAAATCTGGAGGATGAACGA
  5   1   2   14  bld Te4  5g3  in                         CAAN4557.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGCGGCACTTCCGGGAGGAAGCGAGAGACAGGGTGACGTGGGCCGAGCGGTGCGACACAAGCCGGGGAGATGCTGACCAAGTTTGAGACTAAGTCCGCCCGAGTGAAAGGGCTGAGCTTCCACCCGAAGAGACCGTGGGTCCTCACCAGCCTGCACAATGGGGTCATCCAGCTGTGGGACTACCGCATGTGCACCCTTATCGACAAGTTTGATGAGCACGACGGTCCCGTCCGTGGCATTGACTTCCACAAGCAGCAGCCATTGTTCGTATCAGGAGGGGACGACTACAAAATCAAGGTGTGGAATTACAAGCTCCGGCGCTGCCTCTTCACCCTGCTGGGACATCTCGATTATATCCGCACCACCTTTTTCCATCATGAGTACCCCTGGATCCTGAGTGCCTCTGATGATCAGACCATCCGCATCTGGAACTGGCAATCTCGCACTTGCGTTTGCGTTCTGACGGGTCACAACCATTACGTCATGTGTGCTCAGTTCCACCCCTCTGAAGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATATTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTATTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGGGCACGATCGTGGCGTTAACTGGGCTGCCTTCCACCCCACCATGCCTCTCATTGTATCTGGAGCAGATGACCGACAAGTCAAAATCTGGAGGATGAACGAGTCCAAAGC
  5   1   2   14  bld Te4  5g3  in                         CAAN5090.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGCACTTCCGGGAGGAAGCGAGAGACAGGGTGACGTGGGCCGAGCGGTGCGACACAAGCCGGGGAGATGCTGACCAAGTTTGAGACTAAGTCCGCCCGAGTGAAAGGGCTGAGCTTCCACCCGAAGAGACCGTGGGTCCTCACCAGCCTGCACAATGGGGTCATCCAGCTGTGGGACTACCGCATGTGCACCCTTATCGACAAGTTTGATGAGCACGACGGTCCCGTCCGTGGCATTGACTTCCACAAGCAGCAGCCATTGTTCGTATCAGGAGGGGACGACTACAAAATCAAGGTGTGGAATTACAAGCTCCGGCGCTGCCTCTTCACCCTGCTGGGACATCTCGATTATATCCGCACCACCTTTTTCCATCATGAGTACCCCTGGATCCTGAGTGCCTCTGATGATCAGACCATCCGCATCTGGAACTGGCAATCTCGCACTTGCGTTTGCGTTCTGACGGGTCACAACCATTACGTCATGTGTGCTCAGTTCCACCCCTCTGAAGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATATTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTATTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGGGCACGATCGTGGCGTTAACTGGGCTGCCTTCCACCCCACCATGCCTCTCATTGTATCTGGAGCAGATGACCGACAAGTCAAAATCTGGAGGATGAACGAGTCCAAAG
  5   1   2   14  bld Te4  5g3  in                         CAAN6337.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGGAAGCGAGAGACAGGGTGACGTGGGCCGAGCGGTGCGACACAAGCCGGGGAGATGCTGACCAAGTTTGAGACTAAGTCCGCCCGAGTGAAAGGGCTGAGCTTCCACCCGAAGAGACCGTGGGTCCTCACCAGCCTGCACAATGGGGTCATCCAGCTGTGGGACTACCGCATGTGCACCCTTATCGACAAGTTTGATGAGCACGACGGTCCCGTCCGTGGCATTGACTTCCACAAGCAGCAGCCATTGTTCGTATCAGGAGGGGACGACTACAAAATCAAGGTGTGGAATTACAAGCTCCGGCGCTGCCTCTTCACCCTGCTGGGACATCTCGATTATATCCGCACCACCTTTTTCCATCATGAGTACCCCTGGATCCTGAGTGCCTCTGATGATCAGACCATCCGCATCTGGAACTGGCAATCTCGCACTTGCGTTTGCGTTCTGACGGGTCACAACCATTACGTCATGTGTGCTCAGTTCCACCCCTCTGAAGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATATTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTATTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGGGCACGATCGTGGCGTTAACTGGGCTGCCTTCCACCCCACCATGCCTCTCATTGTATCTGGAGCAGATGACCGACAAGTCAAAATCTGGAGGATGAACGAGTCCAAAGCCTGTGAAGTGGACACGTGCCGCGGTCATTACAACAACGTCTC
  5   1   2   14  bld Te4  PIPE in                         CAAN9906.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAAGCGAGAGACAGGGTGACGTGGGCCGAGCGGTGCGACACAAGCCGGGGAGATGCTGACCAAGTTTGAGACTAAGTCCGCCCGAGTGAAAGGGCTGAGCTTCCACCCGAAGAGACCGTGGGTCCTCACCAGCCTGCACAATGGGGTCATCCAGCTGTGGGACTACCGCATGTGCACCCTTATCGACAAGTTTGATGAGCACGACGGTCCCGTCCGTGGCATTGACTTCCACAAGCAGCAGCCATTGTTCGTATCAGGAGGGGACGACTACAAAATCAAGGTGTGGAATTACAAGCTCCGGCGCTGCCTCTTCACCCTGCTGGGACATCTCGATTATATCCGCACCACCTTTTTCCATCATGAGTACCCCTGGATCCTGAGTGCCTCTGATGATCAGACCATCCGCATCTGGAACTGGCAATCTCGCACTTGCGTTTGCGTTCTGACGGGTCACAACCATTACGTCATGTGTGCTCAGTTCCACCCCTCTGAAGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATATTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTATTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGGGCACGATCGTGGCGTTAACTGGGCTGCCTTCCACCCCACCATGCCTCTCATTGTATCTGGAGCAGATGACCGATCAGTCAAAATCTGGAGGATGAACGAGTCCAAAAGCTGGGAAGTGGACACGTGCCGCGGTCATTACAACAACGTCTCGTGCGCCGTCTTTTCATCCCCGCCAGAGCTGATTCT
  5   1   2   14  bld Brn3 5g3  in                         CAAK2680.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGAGAGACAGGGTGACGTGGGCCGAGCGGTGCGACACAAGCCGGGGAGATGCTGACCAAGTTTGAGACTAAGTCCGCCCGAGTGAAAGGGCTGAGCTTCCACCCGAAGAGACCGTGGGTCCTCACCAGCCTGCACAATGGGGTCATCCAGCTGTGGGACTACCGCATGTGCACCCTTATCGACAAGTTTGATGAGCACGACGGTCCCGTCCGTGGCATTGACTTCCACAAGCAGCAGCCATTGTTCGTATCAGGAGGGGACGACTACAAAATCAAGGTGTGGAATTACAAGCTCCGGCGCTGCCTCTTCACCCTGCTGGGACATCTCGATTATATCCGCACCACCTTTTTCCATCATGAGTACCCCTGGATCCTGAGTGCCTCTGATGATCAGACCATCCGCATCTGGAACTGGCAATCTCGCACTTGCGTTTGCGTTCTGACGGGTCACAACCATTACGTCATGTGTGCTCAGTTCCACCCCTCTGAAGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATATTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTATTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGGGCACGATCGTGGCGTTAACTGGGCTGCCTTCCACCCCACCATGCCTCTCATTGTATCTGGAGCAGATGACCGACAAGTCAAAATCTGGAGGATGAACGAGTCCAAAGCCTGGGAAGTGGACACGTGCCGCGGTCATTACAACACGTCTC
  5   1   2   14  bld Te4  5g3  in                         CAAN6893.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGAGAGACAGGGTGACGTGGGCCGAGCGGTGCGACACAAGCCGGGGAGATGCTGACCAAGTTTGAGACTAAGTCCGCCCGAGTGAAAGGGCTGAGCTTCCACCCGAAGAGACCGTGGGTCCTCACCAGCCTGCACAATGGGGTCATCCAGCTGTGGGACTACCGCATGTGCACCCTTATCGACAAGTTTGATGAGCACGACGGTCCCGTCCGTGGCATTGACTTCCACAAGCAGCAGCCATTGTTCGTATCAGGAGGGGACGACTACAAAATCAAGGTGTGGAATTACAAGCTCCGGCGCTGCCTCTTCACCCTGCTGGGACATCTCGATTATATCCGCACCACCTTTTTCCATCATGAGTACCCCTGGATCCTGAGTGCCTCTGATGATCAGACCATCCGCATCTGGAACTGGCAATCTCGCACTTGCGTTTGCGTTCTGACGGGTCACAACCATTACGTCATGTGTGCTCAGTTCCACCCCTCTGAAGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATATTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTATTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGGGCACGATCGTGGCGTTAACTGGGCTGCCTTCCACCCCACCATGCCTCTCATTGTATCTGGAGCAGATGACCGACAAGTCAAAATCTGGAGGATGAACGAGTCCAAAGCCTGGGAAGTGGACACGTGCCGCGGTCATTACAACAACGTCTCGTGCNGCGTCTTTCATCCCCGCCNAGAGCTGATTCTCAGTAACTCC
  5   1   2   14  bld Te4  5g3  in                         CAAN2137.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAGAGACAGGGTGACGTGGGCCGAGCGGTGCGACACAAGCCGGGGAGATGCTGACCAAGTTTGAGACTAAGTCCGCCCGAGTGAAAGGGCTGAGCTTCCACCCGAAGAGACCGTGGGTCCTCACCAGCCTGCACAATGGGGTCATCCAGCTGTGGGACTACCGCATGTGCACCCTTATCGACAAGTTTGATGAGCACGACGGTCCCGTCCGTGGCATTGACTTCCACAAGCAGCAGCCATTGTTCGTATCAGGAGGGGACGACTACAAAATCAAGGTGTGGAATTACAAGCTCCGGCGCTGCCTCTTCACCCTGCTGGGACATCTCGATTATATCCGCACCACCTTTTTCCATCATGAGTACCCCTGGATCCTGAGTGCCTCTGATGATCAGACCATCCGCATCTGGAACTGGCAATCTCGCACTTGCGTTTGCGTTCTGACGGGTCACAACCATTACGTCATGTGTGCTCAGTTCCACCCCTCTGAAGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATATTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTGTTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGGGCACGATCGTGGCGTTAACTGGGCTGCCTTCCACCCCACCATGCCTCTCATTGTATCTGGAGCAGATGACCGANCAGTCAAAATCTGGAGGATGAACGAGTCCAAAGC
  5   1   2   14  bld Te4  5g3  in                         CAAN5502.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ACAGGGTGACGTGGGCCGAGCGGTGCGACACAAGCCGGGGAGATGCTGACCAAGTTTGAGACTAAGTCCGCCCGAGTGAAAGGGCTGAGCTTCCACCCGAAGAGACCGTGGGTCCTCACCAGCCTGCACAATGGGGTCATCCAGCTGTGGGACTACCGCATGTGCACCCTTATCGACAAGTTTGATGAGCACGACGGTCCCGTCCGTGGCATTGACTTCCACAAGCAGCAGCCATTGTTCGTATCAGGAGGGGACGACTACAAAATCAAGGTGTGGAATTACAAGCTCCGGCGCTGCCTCTTCACCCTGCTGGGACATCTCGATTATATCCGCACCACCTTTTTCCATCATGAGTACCCCTGGATCCTGAGTGCCTCTGATGATCAGACCATCCGCATCTGGAACTGGCAATCTCGCACTTGCGTTTGCGTTCTGACGGGTCACAACCATTACGTCATGTGTGCTCAGTTCCACCCCTCTGAAGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATATTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTATTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGGGCACGATCGTGGCGTTAACTGGGCTGCCTTCCACCCCACCATGCCTCTCATTGTATCTGGAGCAGATGACCGACAAGTCAAAATCTGGAGGATGAACGAGTCCAAAGCCTGGGAAGTGGACACGTGCCGCGGTCATTACAACAACGTCTCGTGCGCCGTCTTTCATCCCCGCCAAGAGCTGAATCTCAGTAACTC
  5   1   2   14  bld Brn3 5g3  in                         CAAK1831.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGTGACGTGGGCCGAGCGGTGCGACACAAGCCGGGGAGATGCTGACCAAGTTTGAGACTAAGTCCGCCCGAGTGAAAGGGCTGAGCTTCCACCCGAAGAGACCGTGGGTCCTCACCAGCCTGCACAATGGGGTCATCCAGCTGTGGGACTACCGCATGTGCACCCTTATCGACAAGTTTGATGAGCACGACGGTCCCGTCCGTGGCATTGACTTCCACAAGCAGCAGCCATTGTTCGTATCAGGAGGGGACGACTACAAAATCAAGGTGTGGAATTACAAGCTCCGGCGCTGCCTCTTCACCCTGCTGGGACATCTCGATTATATCCGCACCACCTTTTTCCATCATGAGTACCCCTGGATCCTGAGTGCCTCTGATGATCAGACCATCCGCATCTGGAACTGGCAATCTCGCACTTGCGTTTGCGTTCTGACGGGTCACAACCATTACGTCATGTGTGCTCAGTTCCACCCCTCTGAAGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATATTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTATTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGGGCACGATCGTGGCGTTAACTGGGCTGCCTTCCACCCCACCATGCCTCTCATTGTATCTGGAGCAGATGACCGACAAGTCAAAATCTGGAGGATGAACGAGTCCAAAGCCTGGGAAGTGGACACGTGCCGCGGTCATTACAACAACGTCTCGTGCGCCGTCTTTCATCCCCGCCAGAGCTGATTCTCAGTAACT
  5   1   2   14  bld Brn3 5g3  in                         CAAK2812.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGACGTGGGCCGAGCGGTGCGACACAAGCCGGGGAGATGCTGACCAAGTTTGAGACTAAGTCCGCCCGAGTGAAAGGGCTGAGCTTCCACCCGAAGAGACCGTGGGTCCTCACCAGCCTGCACAATGGGGTCATCCAGCTGTGGGACTACCGCATGTGCACCCTTATCGACAAGTTTGATGAGCACGACGGTCCCGTCCGTGGCATTGACTTCCACAAGCAGCAGCCATTGTTCGTATCAGGAGGGGACGACTACAAAATCAAGGTGTGGAATTACAAGCTCCGGCGCTGCCTCTTCACCCTGCTGGGACATCTCGATTATATCCGCACCACCTTTTTCCATCATGAGTACCCCTGGATCCTGAGTGCCTCTGATGATCAGACCATCCGCATCTGGAACTGGCAATCTCGCACTTGCGTTTGCGTTCTGACGGGTCACAACCATTACGTCATGTGTGCTCAGTTCCACCCCTCTGAAGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATATTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTATTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGGGCACGATCGTGGCGTTAACTGGGCTGCCTTCCACCCCACCATGCCTCTCATTGTATCTGGAGCAGATGACCGACAAGTCAAAATCTGGAGGATGAACGAGTCCAAAGCCTGGGAAGTGGACACGTGCCGCGGTCATTACAACAACGTCTCGTGCGCCGTCTTTCATCCCCGCCAAGAGCTGATTCTCAGTAACTC
  5   1   2   24  bld Te4  5g                             CAAN12448.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGTGGGCCGAGCGGTGCGACACAAGCCGGGGAGATGCTGACCAAGTTTGAGACTAAGTCCGCCCGAGTGAAAGGGCTGAGCTTCCACCCGAAGAGACCGTGGGTCCTCACCAGCCTGCACAATGGGGTCATCCAGCTGTGGGACTACCGCATGTGCACCCTTATCGACAAGTTTGATGAGCACGACGGTCCCGTCCGTGGCATTGACTTCCCCAAGCAGCAGCCATTGTTCGTATCAGGAGGGGACGACTACAAAAT
  5   1   2   12  bld Tad5 5g3  in                         XZT25292.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGTGGGCCGAGCGGTGCGACACAAGCCGGGGAGATGCTGACCAAGTTTGAGACTAAGTCCGCCCGAGTGAAAGGGCTGAGCTTCCACCCGAAGAGACCGTGGGTCCTCACCAGCCTGCACAATGGGGTCATCCAGCTGTGGGACTACCGCATGTGCACCCTTATCGACAAGTTTGATGAGCACGACGGTCCCGTCCGTGGCATTGACTTCCACAAGCAGCAGCCATTGTTCGTATCAGGAGGGGACGACTACAAAATCAAGGTGTGGAATTACAAGCTCCGGCGCTGCCTCTTCACCCTGCTGGGACATCTCGATTATATCCGCACCACCTTTTTCCATCATGAGTACCCCTGGATCCTGAGTGCCTCTGATGATCAGACCATCCGCATCTGGAACTGGCAATCTCGCACTTGCGTTTGCGTTCTGACGGGTCACAACCATTACGTCATGTGTGCTCAGTTCCACCCCTCTGAAGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATATTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTATTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGGGCACGATCGTGGCGTTAACTGGGCTGCCTTCCACCCCACCATGCCTCTCATTGTATCTGGAGCAGATGACCGACAAGTCAAAATCTGGAGGATGAACGAGTCCAAAGC
  5   1   2   14  bld Te4  5g3  in                         CAAN6842.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGGGCCGAGCGGTGCGACACAAGCCGGGGAGATGCTGACCAAGTTTGAGACTAAGTCCGCCCGAGTGAAAGGGCTGAGCTTCCACCCGAAGAGACCGTGGGTCCTCACCAGCCTGCACAATGGGGTCATCCAGCTGTGGGACTACCGCATGTGCACCCTTATCGACAAGTTTGATGAGCACGACGGTCCCGTCCGTGGCATTGACTTCCACAAGCAGCAGCCATTGTTCGTATCAGGAGGGGACGACTACAAAATCAAGGTGTGGAATTACAAGCTCCGGCGCTGCCTCTTCACCCTGCTGGGACATCTCGATTATATCCGCACCACCTTTTTCCATCATGAGTACCCCTGGATCCTGAGTGCCTCTGATGATCAGACCATCCGCATCTGGAACTGGCAATCTCGCACTTGCGTTTGCGTTCTGACGGGTCACAACCATTACGTCATGTGTGCTCAGTTCCACCCCTCTGAAGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATATTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTATTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGGGCACGATCGTGGCGTTAACTGGGCTGCCTTCCACCCCACCATGCCTCTCATTGTATCTGGAGCAGATGACCGACAAGTCAAAATCTGGAGGATGAACGAGTCCAAAGCCTGGGAAGTGGACACGTGCCGCGGTCATTACAACAACGTCTCGTGCGCCGTCTTTCATCCCCGCCAAGAGCTGATTCTCAGTAACTCCGAAAGACAAAGCATTAGAGTGTGGGATATG
  5   1   2       bld Tbd0 5g                            IMAGE:6978006                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGCCGAGCGGTGCGACACAAGCCGGGGAGATGCTGACCAAGTTTGAGACTAAGTCCGCCCGAGTGAAAGGGCTGAGCTTCCACCCGAAGAGACCGTGGGTCCTCACCAGCCTGCACAATGGGGTCATCCAGCTGTGGGACTACCGCATGTGCACCCTTATCGACAAGTTTGATGAGCACGACGGTCCCGTCCGTGGCATTGACTTCCACAAGCAGCAGCCATTGTTCGTATCAGGAGGGGACGACTACAAAATCAAGGTGTGGAATTACAAGCTCCGGCGCTGCCTCTTCACCCTGCTGGGACATCTCGATTATATCCGCACCACCTTTTTCCATCATGAGTACCCCTGGATCCTGAGTGCCTCTGATGATCAGACCATCCGCATCTGGAACTGGCAATCTCGCACTTGCGTTTGCGTTCTGACGGGTCACAACCATTACGTCATGTGTGCTCAGTTCCACCCCTCTGAAGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATATTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTATTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGGGCACGATCGTGGCGTTAACTGGGCTGCCTTCCACCCCACCATGCCTCTCATTGTATCTGGAGCAGATGACCGACAAGTCAAAATCTGGAGGATGAACGAGTCCCAAACCCTGGGAAGTGGACACGTGCCCGCGGTCATTACAACAACGTTCTCGTGCGCCCGTCTTTCATCCCCCGCCCAAGAGCTGGATTCTCAGTTACTTCCGAAAGACAAAAGCATTTAAAGTGTGGGGATATGTTC
  3  -1   2       bld Lun1      in                        CABD10809.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCCGAGCGGTGCGACACAAGCCGGGGAGATGCTGACCAAGTTTGAGACTAAGTCCGCCCGAGTGAAAGGGCTGAGCTTCCACCCGAAGAGACCGTGGGTCCTCACCAGCCTGCACAATGGGGTCATCCAGCTGTGGGACTACCGCATGTGCACCCTTATCGACAAGTTTGATGAGCACGACGGTCCCGTCCGTGGCATTGACTTCCACAAGCAGCAGCCATTGTTCGTATCAGGAGGGGACGACTACAAAATCAAGGTGTGGAATTACAAGCTCCGGCGCTGCCTCTTCACCCTGCTGGGACATCTCGATTATATCCGCACCACCTTTTTCCATCATGAGTACCCCTGGATCCTGAGTGCCTCTGATGATCAGACCATCCGCATCTGGAACTGGCAATCTCGCACTTGCGTTTGCGTTCTGACGGGTCACAACCATTACGTCATGTGTGCTCAGTTCCACCCCTCTGAAGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATGTTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTGTTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGGGCACGATCGTGGCGTTAACTGGGCTGCCTTCCACCCCACCATGCCTCTCATTGTATCTGGAGCAGATGACCGACAAGTCAAAATCTGGAGGATGAACGAGTCCAAAGCCTGGGAAGTGGACACGTGCCGCGGTCATTACAACAACGTCTCGTGCGCCGTCTTTCATCCCCGCCAAGAGCTGATTCTCAGTAACT
  5   1   2   24  bld Te4  5g   ?                          CAAN1193.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCGAGCGGTGCGACACAAGCCGGGGAGATGCTGACCAAGTTTGAGACTAAGTCCGCCCGAGTGAAAGGGCTGAGCTTCCACCCGAAGAGACCGTGGGTCCTCACCAGCCTGCACAATGGGGTCATCCAGCTGTGGGACTACCGCATGTGCACCCTTATCGACAAGTTTGATGAGCACGACGGTCCCGTCCGTGGCATTGACTTCCACAAGCAGCAGCCATTGTTCGTATCAGGAGGGGACGACTACAAAATCAAGGTGTGGAATTACAAGCTCCGGCGCTGCCTCTTCACCCTGCTGGGACATCTCGATTATATCCGCACCACCTTTTTCCATCATGAGTACCCCTGGATCCTGAGTGCCTCTGATGATCAGACCATCCGCATCTGGAACTGGCAATCTCGCACTTGCGTTTGCGTTCTGACGGGTCACAACCATTACGTCATGTGTGCTCAGTTCCACCCCTCTGAAGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATATTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTATTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGGGCACGATCGTGGCGTTAACTGGGCTGCCTTCCACCCCACCATGCCTCTCATTGTATCTGGAGCAGATGACCGACAAGTCAAAATCTGGAGGATGAACGAGTCCAAAGCCTGGGAAGTGGACACGTGCCGCGGTCATTACAACAACGTCTCGTGCGCCGTCTTTCAT
  5   1   2   14  bld Te4  5g3  in                         CAAN5698.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCGAGCGGTGCGACACAAGCCGGGGAGATGCTGACCAAGTTTGAGACTAAGTCCGCCCGAGTGAAAGGGCTGAGCTTCCACCCGAAGAGACCGTGGGTCCTCACCAGCCTGCACAATGGGGTCATCCAGCTGTGGGACTACCGCATGTGCACCCTTATCGACAAGTTTGATGAGCACGACGGTCCCGTCCGTGGCATTGACTTCCACAAGCAGCAGCCATTGTTCGTATCAGGAGGGGACGACTACAAAATCAAGGTGTGGAATTACAAGCTCCGGCGCTGCCTCTTCACCCTGCTGGGACATCTCGATTATATCCGCACCACCTTTTTCCATCATGAGTACCCCTGGATCCTGAGTGCCTCTGATGATCAGACCATCCGCATCTGGAACTGGCAATCTCGCACTTGCGTTTGCGTTCTGACGGGTCACAACCATTACGTCATGTGTGCTCAGTTCCACCCCTCTGAAGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATATTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTATTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGGGCACGATCGTGGCGTTAACTGGGCTGCCTTCCACCCCACCATGCCTCTCATTGTATCTGGAGCAGATGACCGACAAGTCAAAATCTGGAGGATGAACGAGTCCAAAGC
  5   1   2   14  bld Te4  5g3  in                         CAAN8497.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGTGCGACACAAGCCGGGGAGATGCTGACCAAGTTTGAGACTGAGTCCGCCCGAGTGAAAGGGCTGAGCTTCCACCCGAAGAGACCGTGGGTCCTCACCAGCCTGCACAATGGGGTCATCCAGCTGTGGGACTACCGCATGTGCACCCTTATCGACAAGTTTGATGAGCACGACGGTCCCGTCCGTGGCATTGACTTCCACAAGCAGCAGCCATTGTTCGTATCAGGAGGGGACGACTACAAAATCAAGGTGTGGAATTACAAGCTCCGGCGCTGCCTCTTCACCCTGCTGGGACATCTCGATTATATCCGCACCACCTTTTTCCATCATGAGTACCCCTGGATCCTGAGTGCCTCTGATGATCAGACCATCCGCATCTGGAACTGGCAATCTCGCACTTGCGTTTGCGTTCTGACGGGTCACAACCATTACGTCATGTGTGCTCAGTTCCACCCCTCTGAAGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATATTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTATTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGGGCACGATCGTGGCGTTAACTGGGCTGCCTTCCACCCCACCATGCCTCTCATTGTATCTGGAGCAGATGACCGACAAGTCAAAATCTGGAGGATGAACGAGTCCAAAGCCTG
  5   1   2   14  bld Te4  5g3  in                         CAAN9393.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGACACAAGCCGGGGAGATGCTGACCAAGTTTGAGACTAAGTCCGCCCGAGTGAAAGGGCTGAGCTTCCACCCGAAGAGACCGTGGGTCCTCACCAGCCTGCACAATGGGGTCATCCAGCTGTGGGACTACCGCATGTGCACCCTTATCGACAAGTTTGATGAGCACGACGGTCCCGTCCGTGGCATTGACTTCCACAAGCAGCAGCCATTGTTCGTATCAGGAGGGGACGACTACAAAATCAAGGTGTGGAATTACAAGCTCCGGCGCTGCCTCTTCACCCTGCTGGGACATCTCGATTATATCCGCACCACCTTTTTCCATCATGAGTACCCCTGGATCCTGAGTGCCTCTGATGATCAGACCATCCGCATCTGGAACTGGCAATCTCGCACTTGCGTTTGCGTTCTGACGGGTCACAACCATTACGTCATGTGTGCTCAGTTCCACCCCTCTGAAGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATATTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTATTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGGGCACGATCGTGGCGTTAACTGGGCTGCCTTCCACCCCACCATGCCTCTCATTGTATCTGGAGCAGATGACCGACAAGTCAAAATCTGGAGGATGAACGAGTCCAAAGCCTGGGAAGTGGACACGTGCCGCGGTCATTACAACAACGTCTCGTGCGCCGTCTTTCATCCCCGCCAAGAGCTGATTCTCAGNTA
  5   1   2       bld Tbd0 5g                            IMAGE:6979154                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CACAAGCCGGGGAGATGCTGACCAAGTTTGAGACTAAGTCCGCCCGAGTGAAAGGGCTGAGCTTCCACCCGAAGAGACCGTGGGTCCTCACCAGCCTGCACAATGGGGTCATCCAGCTGTGGGACTACCGCATGTGCACCCTTATCGACAAGTTTGATGAGCACGACGGTCCCGTCCGTGGCATTGACTTCCACAAGCAGCAGCCATTGTTCGTATCAGGAGGGGACGACTACAAAATCAAGGTGTGGAATTACAAGCTCCGGCGCTGCCTCTTCACCCTGCTGGGACATCTCGATTATATCCGCACCACCTTTTTCCATCATGAGTACCCCTGGATCCTGAGTGCCTCTGATGATCAGACCATCCGCATCTGGAACTGGCAATCTCGCACTTGCGTTTGCGTTCTGACGGGTCACAACCATTACGTCATGTGTGCTCAGTTCCACCCCTCTGAAGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATGTTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTATTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGGGCACGATCGTGGCGTTAACTGGGCTGCCTTCCACCCACCATGCCTCTCATTGTATCTGGAGCAGATGACCGACAAGTCAAAATCTGGAGGATGAACGAGTCCAAGCCTGGGAAGTGAAACGTGCCGCGGTCATTACACACGTCTCGTGCGCGTCTTCATCCCGCAAGACTG
  5   1   2       bld Gas8 5g3  in                          st63g23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGCCGGGGAGATGCTGACCAAGTTTGAGACTAAGTCCGCCCGAGTGAAAGGGCTGAGCTTCCACCCGAAGAGACCGTGGGTCCTCACCAGCCTGCACAATGGGGTCATCCAGCTGTGGGACTACCGCATGTGCACCCTTATCGACAAGTTTGATGAGCACGACGGTCCCGTCCGTGGCATTGACTTCCACAAGCAGCAGCCATTGTTCGTATCAGGAGGGGACGACTACAAAATCAAGGTGTGGAATTACAAGCTCCGGCGCTGCCTCTTCACCCTGCTGGGACATCTCGATTATATCCGCACCACCTTTTTCCATCATGAGTACCCCTGGATCCTGAGTGCCTCTGATGATCAGACCATCCGCATCTGGAACTGGCAATCTCGCACTTGCGTTTGCGTTCTGACGGGTCACAACCATTACGTCATGTGTGCTCAGTTCCACCCCTCTGAAGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATATTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTGTTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGTACTGAGCGCAGCCATAGAGTTATATGTACATCC
  5   1   2       bld Gas8 5g3  in                          st63h23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCGGGGAAGATGCTGACCAAGTTTGAGACTAAGTCCGCCCGAGTGAAAGGGCTGAGCTTCCACCCGAAGAGACCGTGGGTCCTCACCAGCCTGCACAATGGGGTCATCCAGCTGTGGGACTACCGCATGTGCACCCTTATCGACAAGTTTGATGAGCACGACGGTCCCGTCCGTGGCATTGACTTCCACAAGCAGCAGCCATTGTTCGTATCAGGAGGGGACGACTACAAAATCAAGGTGTGGAATTACAAGCTCCGGCGCTGCCTCTTCACCCTGCTGGGACATCTCGATTATATCCGCACCACCTTTTTCCATCATGAGTACCCCTGGATCCTGAGTGCCTCTGATGATCAGACCATCCGCATCTGGAACTGGCAATCTCGCACTTGCGTTTGCGTTCTGACGGGTCACAACCATTACGTCATGTGTGCTCAGTTCCACCCCTCTGAAGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATATTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTGTTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGTACTGAGCGCAGCCATAGAGTTATATGTACATCCTAGAG
  5   1   2   20  bld Te1  5g                             CBWN11892.b1 ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCGGGGAGATGCTGACCAAGTTTGAGACTAAGTCCGCCCGAGTGAAAGGGCTGAGCTTCCACCCGAAGAGACCGTGGGTCCTCACCAGCCTGCACAATGGGGTCATCCAGCTGTGGGACTACCGCATGTGCACCCTTATCGACAAGTTTGATGAGCACGACGGTCCCGTCCGTGGCATTGACTTCCACAAGCAGCAGCCATTGTTCGTATCAGGAGGGGACGACTACAAAATCAAGGTGTGGAATTACAAGCTCCGGCGCTGCCTCTTCACCCTGCTGGGACATCTCGATTATATCCGCACCACCTTTTTCCATCATGAGTACCCCTGGATCCTGAGTGCCTCTGATGATCAGACCATCCGCATCTGGAACTGGCAATCTCGCACTTGCGTTTGCGTTCTGACGGGTCACAACCATTACGTCATGTGTGCTCAGTTCCACCCCTCTGAAGACCTGGGTGGTATCTGCCAGCTTGGGATCAGACT
  5   1   2   10  bld Te1  5g3  in                         CBWN1748.b1 ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATGCTGACCAAGTTTGAGACTAAGTCCGCCCGAGTGAAAGGGCTGAGCTTCCACCCGAAGAGACCGTGGGTCCTCACCAGCCTGCACAATGGGGTCATCCAGCTGTGGGACTACCGCATGTGCACCCTTATCGACAAGTTTGATGAGCACGACGGTCCCGTCCGTGGCATTGACTTCCACAAGCAGCAGCCATTGTTCGTATCAGGAGGGGACGACTACAAAATCAAGGTGTGGAATTACAAGCTCCGGCGCTGCCTCTTCACCCTGCTGGGACATCTCGATTATATCCGCACCACCTTTTTCCATCATGAGTACCCCTGGATCCTGAGTGCCTCTGATGATCAGACCATCCGCATCTGGAACTGGCAATCTCGCACTTGCGTTTGCGTTCTGACGGGTCACAACCATTACGTCATGTGCGCTCAGTTCCACCCCTCTGAAGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATATTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTGTTCGGGACGTCGGATGCTGTGGTGAAGCATGTACTAGAGGGGCACGATCGTGGTGTTAACTGGGCTGCCTTCCACCCCACCATGCCTCTCATTGTATCTGGAGCAGATGACCGACAAGTCAAAATCTGGAGGATGAACGAGTCCAAAGCCTGGGAAGTGGACACGTGCCGCGGTCATTACAACAACGTCTCGTGCG
  5   1   2       bld Te4       in                         CAAN9790.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCTGACCAAGTTTGAGACTAAGTCCGCCCGAGTGAAAGGGCTGAGCTTCCACCCGAAGAGACCGTGGGTCCTCACCAGCCTGCACAATGGGGTCATCCAGCTGTGGGACTACCGCATGTGCACCCTTATCGACAAGTTTGATGAGCACGACGGTCCCGTCCGTGGCATTGACTTCCACAAGCAGCAGCCATTGTTCGTATCAGGAGGGGACGACTACAAAATCAAGGTGTGGAATTACAAGCTCCGGCGCTGCCTCTTCACCCTGCTGGGACATCTCGATTATATCCGCACCACCTTTTTCCATCATGAGTACCCCTGGATCCTGAGTGCCTCTGATGATCAGACCATCCGCATCTGGAACTGGCAATCTCGCACTTGCGTTTGCGTTCTGACGGGTCACAACCATTACGTCATGTGTGCTCAGTTCCACCCCTCTGAAGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATATTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGNGAATCTCTGGGGTGGATCTATTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGGGCACGATCGTGGCGTTAACTGGGCTGCCTTCCACCCCACCATGCCTCTCATTGTATCTGGAGCAGATGACCGACAAGTCAAAATCTGAAGGATGAACG
  5   1   2       bld Te4       in                         CAAN5924.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGACCAAGTTTGAGACTAAGTCCGCCCGAGTGAAAGGGCTGAGCTTCCACCCGAAGAGACCGTGGGTCCTCACCAGCCTGCACAATGGGGTCATCCAGCTGTGGGACTACCGCATGTGCACCCTTATCGACAAGTTTGATGAGCACGACGGTCCCGTCCGTGGCATTGACTTCCACAAGCAGCAGCCATTGTTCGTATCAGGAGGGGACGACTACAAAATCAAGGTGTGGAATTACAAGCTCCGGCGCTGCCTCTTCACCCTGCTGGGACATCTCGATTATATCCGCACCACCTTTTTCCATCATGAGTACCCCTGGATCCTGAGTGCCTCTGATGATCAGACCATCCGCATCTGGAACTGGCAATCTCGCACTTGCGTTTGCGTTCTGACGGGTCACAACCATTACGTCATGTGTGCTCAGTTCCACCCCTCTGAAGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATATTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTATTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGGGCACGATCGTGGCGTTAACTGGGCTGCCTTCCACCCCACCATGCCTCTCATTGTATCTGGAGCAGATGACCGACAAGTCAAAATCTGGAGGATGAACGAGTCCAAAGCCTGGGAAGTGGACACGTGCCGCGGTCATTACAACAACGTCTCGTGCGCCGTCTTTCATCCCCGCCAAGAGCTGATTCTCAGTAACTCCGAAGACAAAAGCATTAGAGTGTGGGATATGTCCAAAAGGACTGGAGTCCAGACTTTCCGCAGAGACCACGACCGTTTCTGGGTACT
  5   1   2       bld Gas8      in                          st30c11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CNAGTTTGAGACTAAGTCCGCCCGAGTGAAAGGGCTGAGCTTCCACCCGAAGAGACCGTGGGTCCTCACCAGCCTGCACAATGGGGTCATCCAGCTGTGGGACTACCGCATGTGCACCCTTATCGACAAGTTTGATGAGCACGACGGTCCCGTCCGTGGCATTGACTTCCACAAGCAGCAGCCATTGTTCGTATCAGGAGGGGACGACTACAAAATCAAGGTGTGGAATTACAAGCTCCGGCGCTGCCTCTTCACCCTGCTGGGACATCTCGATTATATCCGCACCACCTTTTTCCATCATGAGTACCCCTGGATCCTGAGTGCCTCTGATGATCAGACCATCCGCATCTGGAACTGGCAATCTCGCACTTGCGTTTGCGTTCTGACGGGTCACAACCATTACGTCATGTGTGCTCAGTTCCACCCCTCTGAAGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATATTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTGTTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGGGCACGATCGTGGCGTTAACTGGGCTGCCTTCCACCCCACCATGCCTCTCATTGTATCTGGAGCAGATGACCGACAAGTCAAAATCTGGAGGATGAACGAGTC
  5   1   2       chi Brn2                                CAAJ23468.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCAGCCTGCACAATGGGGTCATCCAGCTGTGGGACTACCGCATGTGCACCCTTATCGACAAGTTTGATGAGCACGACGGTCCCGTCCGTGGCATTGACTTCCACAAGCAGCAGCCATTGTTCGTATCAGGAGGGGACGACTACAAAATCAAGGTGTGGAATTACAAGCTCCGGCGCTGCCTCTTCACCCTGCTGGGACATCTCGATTATATCCGCACCACCTTTTTCCATCATGAGTACCCCTGGATCCTGAGTGCCTCTGATGATCAGACCATCCGCATCTGGAACTGGCAATCTCGCACTTGCGTTTGGTAAAAATGAGCTTGTTTCCTGTCCATCAGAGGCTCTGATTGGCTGGCTGGGTGGATCCTTGCCCTTAGTGTCACCGTAACAACCTTCTCCTTCTATTGCAGCGTTCTGACGGGTCACAACCATTACGTCATGTGTGCTCAGTTCCACCCCTCTGAAGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATATTTCTGGTGAGCTGCCCAGGTTGAGGGGGTCCATGTGGTACCTGTCCATTCCCAACTGCACGGGGGGAGAAGCGTTGGAGCAGGGGAAGTGGTGTAGGGGGTCAGATGCAAGTTTCAGGGAGTTGCAGCACATTGAACAATACATAGGGCACCGAAATTCACCCACAAATGGTTTCCCCCACCAGTGGTCCGGCCCAGTATCTATCACATGACGCGTTTATCACAAGTAGTAATGTCAGCACTTCTAGTAATAGATATCACACACACTGATTAGGTTTTGTTTGTCT
  5   1   2       bld TbA       in                   TTbA066a15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCTTGCCTTGGGACCATCCTCCGATTTAATATCCCCCACCCACCCCTTTTTTTCCATCCATGAGTACCCCTGGATCCTGAGTGCCCTCTGATGATTCAGACCATCCGCATCTGGAACTGGCAATCCTCCGCACTTTGCGTTTGCGTTCTGACGGGTCCACAACCATTACGTCCTGTGTGCTCAGTTCCACCCCTCCTGAGGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATATTTCTGGCCTGAGGAAGAAGACCTGTCTCCTGGAGCAGTNGAAGCTGATGTCCGGGGAATCTCCTGGGNGTGGATTCTGTTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGGGCACGATCGTGGCGTTAACTGGGCTGCCTTCCACCCCACCATGCCTCTCATTGT
  5   1   2       bld Te1       in                        CBWN17267.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGATTATATCCGCACCACCTTTTTCCATCATGAGTACCCCTGGATCCTGAGTGCCTCTGATGATCAGACCATCCGCATCTGGAACTGGCAATCTCGCACTTGCGTTTGCGTTCTGACGGGTCACAACCATTACGTCATGTGCGCTCAGTTCCACCCCTCTGAAGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATATTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTGTTCGGGACGTCGGATGCTGTGGTGAAGCATGTACTAGAGGGGCACGATCGTGGTGTTAACTGGGCTGCCTTCCACCCCACCATGCCTCTCATTGTATCTGGAGCAGATGACCGACAAGTCAAAATCTGGAGGATGAACGAGTCCAAAGCCTGGGAAGTGGACACGTGCCGCGGTCATTACAACAACGTCTCGTGCGCCGTCTTTCATCCCCGCCAAGAGCTGATTCTCAGTAACTCCGAAGACAAAAGCATTAGAGTGTGGGATATGTCCAAAAGGACTGGAGTCCAGACTTTCCGCAGAGACCACGACCGTTTCTGGGTACTGGCCGCCCACCCAAATCTTAACCTTTTTGCCGCAGGGCATGACGGTGGCATGATTGTATTCAAGCTGGAACGAGAGCGCCCCGCCTATGCCGTGCACGGCA
  5   1   2       bld Neu       in                   TNeu097i05.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCTGATGATCAGACCATCCGCATCTGGAACTGGCAATCTCGCATTTGCGTTTGCGTTCTGACGGGTCACAACCATTACGTCATGTGTGCTCAGTTCCACCCCTCTGAAGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATATTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTGTTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGGGCACGATCGTGGCGTTAACTGGGCTGCCTTCCACCCCACCATGCCTCTCATTGTATCTGGAGCAGATGACCGACAAGTCAAAATCTGGAGGATGAACGAGTCCAAAGCCTGGGAAGTGGACACGTGCCGCGGTCATTACAACAACGTCTCGTGCGCCGTCTTTCATCCCCGCCAAGAGCTGATTCTCAGTAACTCCGAAGACAAAAGCATTAGAGTGTGGGATATGTCCAAAAGGACTGGAGTCCAGACTTTCCGCAGAGACCACGACCGTTTCTGGGTACTGGCCGCCCACCCAAATCTTAACCTGTTTGCT
  5   1   2       bld Te4       in                         CAAN4408.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GATTCCGGGATTCGTCGACCCCGCGTCCGCTCGCACTTGCGTTTGCGTTCTGACGGGTCACAACCATTACGTCATGTGTGCTCAGTTCCACCCCTCTGAAGACCTGGTGGTATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATATTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTATTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGGGCACGATCGTGGCGTTAACTGGGCTGCCTTCCACCCCACCATGCCTCTCATTGTATCTGGAGCAGATGACCGACAAGTCAAAATCTGGAGGATGAACGAGTCCAAAGCCTGGGAAGTGGACACGTGCCGCGGTCATTACAACAACGTCTCGTGCGCCGTCTTTCATCCCCGCCAAGAGCTGATTCTCAGTAACTCCGAAGACAAAAGCATTAGAGTGTGGGATATGTCCAAAAGGACTGGAGTCCAGACTTTCCGCAGAGACCACGACCGTTTCTGGGTACTGGCCGCCCACCCAAATCTTAACCTGTTTGCTGCAGGGCATGACGGTGGCATGATTGTATTCAAGCTGGAACGAGAGCGTCCCGCCTATGCCGTGCACGGCAATATCTTGTATTATGTGAAGGACAGATTCCTGCGCCAGTTGGACTTTAACAGCTCCAAGGATGTGGCTGTTATGCAGCTAAGGAGCGGCTCCAAGTTCCCTGTGTTCAATATGTCGTACAACCCAGCTGAAAATTCCGTCCTGCTTTGCACGAGAGCCAGCAACCTGGAGAACAGCACTTATGACCTG
  5   1   2       bld Te4       in                          CAAN600.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATCTGCCAGCTTGGATCAGACTGTGCGCGTTTGGGATATTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTATTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGGGCACGATCGTGGCGTTAACTGGGCTGCCTTCCACCCCACCATGCCTCTCATTGTATCTGGAGCAGATGACCGACAAGTCAAAATCTGGAGGATGAACGAGTCCAAAGCCTGGGAAGTGGACACGTGCCGCGGTCATTACAACAACGTCTCGTGCGCCGTCTTTCATCCCCGCCAAGAGCTGATTCTCAGTAACTCCGAAGACAAAAGCATTAGAGTGTGGGATATGTCCAAAAGGACTGGAGTCCAGACTTTCCGCAGAGACCACGACCGTTTCTGGGTACTGGCCGCCCACCCAAATCTTAACCTGTTTGCTGCAGGGCATGACGGTGGCATGATTGTATTCAAGCTGGAACGAGAGCGTCCCGCCTATGCCGTGCACGGCAATATCTTGTATTATGTGAAGGACAGATTCCTGCGCCAGTTGGACTTTAACAGCTCCAAGGATGTGGCTGTTATGCAGCTAAGGAGCGGCTCCAAGTTCCCTGTGTTCAATATGTCGTACAACCCAGCTGAAAATTCCGTCCTGCTTTGCACGAGAGCCAGCAACCTGGAGAACAGCACTTATGACCTGTACACCATCCCCAGGATACCGACTCCCAG
  5   1   2       bld Te4       in                         CAAN2644.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TATTTCTGGCCTGAGGAAGAAGAACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTATTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGGGCACGATCGTGGCGTTAACTGGGCTGCCTTCCACCCCACCATGCCTCTCATTGTATCTGGAGCAGATGACCGACAAGTCAAAATCTGGAGGATGAACGAGTCCAAAGCCTGGGAAGTGGACACGTGCCGCGGTCATTACAACAACGTCTCGTGCGCCGTCTTTCATCCCCGCCAAGAGCTGATTCTCAGTAACTCCGAAGACAAAAGCATTAGAGTGTGGGATATGTCCAAAAGGACTGGAGTCCAGACTTTCCGCAGAGACCACGACCGTTTCTGGGTACTGGCCGCCCACCCAAATCTTAACCTGTTTGCTGCAGGGCATGACGGTGGCATGATTGTATTCAAGCTGGAACGAGAGCGTCCCGCCTATGCCGTGCACGGCAATATCTTGTATTATGTGAAGGACAGATTCCTGCGCCAGTTGGACTTTAACAGCTCCAAGGATGTGGCTGTTATGCAGCTAAGGAGCGGCTCCAAGTTCCCTGTGTTCAATATGTCGTACAACCCAGCTGAAAATTCCGTCCTGCTTTGCACGAGAGCCAGCAACCTGGAGAACAGCACTTATGACCTGTACACCATCCCCAAGGATACCGACTCCCAGAATCCCGATGCCCCTGAGGGGAAGCGATCCTCTGGTCTGACTGCAGTGTGGGTGGCA
  5   1   2       bld Te4       ?                         CAAN12216.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACCTGTCTCCTGGAGCAGTGGAAGCTGATGTCCGGGGAATCTCTGGGGTGGATCTATTTGGGACGTCGGATGCTGTAGTGAAGCATGTACTAGAGGGGCACGATCGTGGCGTTAACTGGGCTGCCTTCCACCCCACCATGCCTCTCATTGTATCTGGAGCAGATGACCGACAAGTCAAAATCTGGAGGATGAACGAGTCCAAAGCCTGGGAAGTGGACACGTGCCGCGGTCATTACAACAACGTCTCGTGCGCCGTCTTTCATCCCCGCCAAGAGCTGATTCTCAGTAACTCCGAAGACAAAAGCATTAGAGTGTGGGATATGTCCAAAAGGACTGGAGTCCAGACTTTCCGCAGAGACCACGACCGTTTCTGGGTACTGGCCGCCCACCCAAATCTTAACCTGTTTGCTGCAGGGCATGACGGTGGCATGATTGTATTCAAGCTGGAACGAGAGCGTCCCGCCTATGCCGTGCACGGCAATATCTTGTATTATGTGAAGGACAGATTCCTGCGCCAGTTGGACTTTAACAGCTCCAAGGATGTGGCTGTTATGCAGCTAAGGAGCGGCTCCAAGTTCCCTGTGTTCAATATGTCGTACAACCCAGCTGAAAATTCCGTCCTGCTTTGCACGAGAGCCAGCAACCTGGAGAACAGCACTTATGACCTGTACACCATCCCCAAGGATACCGACTCCCAGAATCCCGATGCCCCTGAAGGGAAGCGATCCTCTGGTCTGACTGCAGTGTGGGTGGCACGGAATAGATTTGCCGTCCTGGATCGCATGCATTCTATTCTCATCAAGACCTGAAAGATGAGATCACCCAG
  5   1   2       bld Te4       in                        CAAN10226.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGGAGGATGAACGAGTCCAAAGCCTGGGAAGTGGACACGTGCCGCGGTCATTACAACAACGTCTCGTGCGCCGTCTTTCATCCCCGCCAAGAGCTGATTCTCAGTAACTCCGAAGACAAAAGCATTAGAGTGTGGGATATGTCCAAAAGGACTGGAGTCCAGACTTTCCGCAGAGACCACGACCGTTTCTGGGTACTGGCCGCCCACCCAAATCTTAACCTGTTTGCTGCAGGGCATGACGGTGGCATGATTGTATTCAAGCTGGAACGAGAGCGTCCCGCCTATGCCGTGCACGGCAATATCTTGTATTATGTGAAGGACAGATTCCTGCGCCAGTTGGACTTTAACAGCTCCAAGGATGTGGCTGTTATGCAGCTAAGGAGCGGCTCCAAGTTCCCTGTGTTCAATATGTCGTACAACCCAGCTGAAAATTCCGTCCTGCTTTGCACGAGAGCCAGCAACCTGGAGAACAGCACTTATGACCTGTACACCATCCCCAAGGATACCGACTCCCAGAATCCCGATGCCCCTGAAGGGAAGCGATCCTCTGGTCTGACTGCAGTGTGGGTGGCACGGAATAGATTTGCCGTCCTGGATCGCATGCATTCTATTCTCATCAAGAACCTGAAGAATGAGATCACCAAGAAGGTCCAGGTGCCCAACTGTGATGAGATCTTCTATGCCGGCACTGGGAACCTGCTGCTCCGGGATTCCGACTCCATCACTCTATTTGATGTGCAGC
  5   1   2       bld Te4       in                         CAAN6315.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGATTCTCAGTAACTCCGAAGACAAAAGCATTAGAGTGTGGGATATGTCCAAAAGGACTGGAGTCCAGACTTTCCGCAGAGACCACGACCGTTTCTGGGTACTGGCCGCCCACCCAAATCTTAACCTGTTTGCTGCAGGGCATGACGGTGGCATGATTGTATTCAAGCTGGAACGAGAGCGTCCCGCCTATGCCGTGCACGGCAATATCTTGTATTATGTGAAGGACAGATTCCTGCGCCAGTTGGACTTTAACAGCTCCAAGGATGTGGCTGTTATGCAGCTAAGGAGCGGCTCCAAGTTCCCTGTGTTCAATATGTCGTACAACCCAGCTGAAAATTCCGTCCTGCTTTGCACGAGAGCCAGCAACCTGGAGAACAGCACTTATGACCTGTACACCATCCCCAAGGATACCGACTCCCAGAATCCCGATGCCCCTGAAGGGAAGCGATCCTCTGGTCTGACTGCAGTGTGGGTGGCACGGAATAGATTTGCCGTCCTGGATCGCATGCATTCTATTCTCATCAAGAACCTGAAGAATGAGATCACCAAGAAGGTCCAGGTGCCCAACTGTGATGAGATCTTCTATGCCGGCACTGGGAACCTGCTGCTCCGGGATTCCGACTCCATCACTCTATTTGATGTGCAGCAGAAGCGCACCCTGGCATCTGTGAAGATCTCCAAAGTGAAGTATGTCATTTGGTCCTCCGACATGTCCCACGTGGCTCTTCT
  3  -1   2       bld Fat1      in                         CABC6961.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAGGGCGAGAGGCCTCCGAAGACAAAAGCATTAGAGTGTGGGATATGTCCAAAAGGACTGGAGTCCAGACTTTCCGCAGAGACCACGACCGTTTCTGGGTACTGGCCGCCCACCCAAATCTTAACCTGTTTGCTGCAGGGCATGACGGTGGCATGATTGTATTCAAGCTGGAACGAGAGCGTCCCGCCTATGCCGTGCACGGCAATATCTTGTATTATGTGAAGGACAGATTCCTGCGCCAGTTGGACTTTAACAGCTCCAAGGATGTGGCTGTTATGCAGCTAAGGAGCGGCTCCAAGTTCCCTGTGTTCAATATGTCGTACAACCCAGCTGAAAATTCCGTCCTGCTTTGCACGAGAGCCAGCAACCTGGAGAACAGCACTTATGACCTGTACACCATCCCCAAGGATACCGACTCCCAGAATCCCGATGCCCCTGAAGGGAAGCGATCCTCTGGTCTGACTGCAGTGTGGGTGGCACGGAATAGATTTGCCGTCCTGGATCGCATGCATTCTATTCTCATCAAGAACCTGAAGAATGAGATCACCAAGAAGGTCCAGGTGCCCAACTGTGATGAGATCTTCTATGCCGGCACTGGGAACCTGCTGCTCCGGGATTCCGACTCCATCACTCTATTTGATGTGCAGCAGAAGCGCACCCTGGCATCTGTGAAGATCTCCAAAGTGAAGTATGTCATTTGGTCCTCCGACATGTCCCACGTGGCTCTTCTTGCCAAGCATGCCATTATGATCTGCAATAGAAAGCTGGAGTCCCTCTGCAACATCCATGAAAATATCCGTGTCAAGAGCGGTGCCTGGG
  5   1   2       bld Te4       in                         CAAN4789.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAAGCATTAGAGTGTGGGATATGTCCAAAAGGACTGGAGTCCAGACTTTCCGCAGAGACCACGACCGTTTCTGGGTACTGGCCGCCCACCCAAATCTTAACCTGTTTGCTGCAGGGCATGACGGTGGCATGATTGTATTCAAGCTGGAACGAGAGCGTCCCGCCTATGCCGTGCACGGCAATATCTTGTATTATGTGAAGGACAGATTCCTGCGCCAGTTGGACTTTAACAGCTCCAAGGATGTGGCTGTTATGCAGCTAAGGAGCGGCTCCAAGTTCCCTGTGTTCAATATGTCGTACAACCCAGCTGAAAATTCCGTCCTGCTTTGCACGAGAGCCAGCAACCTGGAGAACAGCACTTATGACCTGTACACCATCCCCAAGGATACCGACTCCCAGAATCCCGATGCCCCTGAAGGGAAGCGATCCTCTGGTCTGACTGCAGTGTGGGTGGCACGGAATAGATTTGCCGTCCTGGATCGCATGCATTCTATTCTCATCAAGAACCTGAAGAATGAGATCACCAAGAAGGTCCAGGTGCCCAACTGTGATGAGATCTTCTATGCCGGCACTGGGAACCTGCTGCTCCGGGATTCCGACTCCATCACTCTATTTGATGTGCAGCAGAAGCGCACCCTGGCATCTGTGAAGATCTCCAAAGTGAAGTATGTCATTTGGTCCTCCGACATGTCCCACGTGGCTCTTCTTGCCAAGCATGCCATTATGATCTGCAATAGAAAGCTGGAGTCCCTCTGCAACATCCATGAAAATATCCGTGTCAAGAGCGGTGCCT
  5   1   2       bld Te4       in                         CAAN9513.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAAGCATTAGAGTGTGGGATATGTCCAAAAGGACTGGAGTCCAGACTTTCCGCAGAGACCACGACCGTTTCTGGGTACTGGCCGCCCACCCAAATCTTAACCTGTTTGCTGCAGGGCATGACGGTGGCATGATTGTATTCAAGCTGGAACGAGAGCGTCCCGCCTATGCCGTGCACGGCAATATCTTGTATTATGTGAAGGACAGATTCCTGCGCCAGTTGGACTTTAACAGCTCCAAGGATGTGGCTGTTATGCAGCTAAGGAGCGGCTCCAAGTTCCCTGTGTTCAATATGTCGTACAACCCAGCTGAAAATTCCGTCCTGCTTTGCACGAGAGCCAGCAACCTGGAGAACAGCACTTATGACCTGTACACCATCCCCAAGGATACCGACTCCCAGAATCCCGATGCCCCTGAAGGGAAGCGATCCTCTGGTCTGACTGCAGTGTGGGTGGCACGGAATAGATTTGCCGTCCTGGATCGCATGCATTCTATTCTCATCAAGAACCTGAAGAATGAGATCACCAAGAAGGTCCAGGTGCCCAACTGTGATGAGATCTTCTATGCCGGCACTGGGAACCTGCTGCTCCGGGATTCCGACTCCATCACTCTATTTGATGTGCAGCAGAAGCGCACCCTGGCATCTGTGAAGATCTCCAAAGTGAAGTATGTCATTTGGTCCTCCGACATGTCCCACGTGGCTCTTCTTGCCAAGCATGCCATTATGATCTGCAATAGAAAGCTGGAGTCCCTCTGCAACATCCATGAAAATATCCGTGTCAAGAGCGGTGCCT
  5   1   2       bld TbA                            TTbA022d18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGGGTACTGGGCCGCCCACCCAAATCTTAACCTGTTTGCTGCAGGGCATGACGGTGGCATGATTGTATTCAAGCTGGAACGAGAGCGTCCCGCCTATGCCGTGCACGGCAATATCTTGTATTATGTGAAGGACAGATTCCTGCGCCAGTTGGACTTTAACAGCTCCAAGGATGTGGCTGTTATGCAGCTAAGGAGCGGCTCCAAGTTCCCTGTGTTCAATATGTCGTACAACCCAGCTGAAAATTCCGTCCTGCTTTGCACGAGAGCCAGCAACCTGGAGAACAGCACTTATGACCTGTACACCATCCCCAAGGATACCGACTCCCAGAATCCCGATGCCCCTGAAGGGAAGCGATCCTCTGGTCTGACTGCAGTGTGGGTGGCACGGAATAGATTTGCCGTCCTGGATCGCATGCATTCTATTCTCATCAAGAACCTGAAGAATGAGATCACCAAGAAGGTCCAGGTGCCCAACTGTGATGAGATCTTCTATGCCGGCACTGGGAACCTGCTGCTCCGGGATTCCGACTCCATCACTCTATTTGATGTGCAGCAGAAGCGCACCCTGGCATCTGTGAAGATCTCCAAAGTGAAGTATGTCATTTGGTCCTCCGACATGTCCCACGTGGCTCTTCTTGCCAAGCATGCCATTATGATCTGCAATAGAAAGCTGGAGTCCCTCTGCAACATCCATGAAAATATCCGTGTCAAGAGCGGTGCCTGGGACGAGAGCGGGGTTTTCATCTACACGACCAGCAACCATATCAAATACGCACTCACCACTGGAGATCACGGTATTATTCGAACACTGGATCTGCCCATTTACATCACACGCGTNCAGGGCAACAACGTCTACTGC
  5   1   2       bld Te4       in                         CAAN5287.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGCGGCTCCAAGTTCCCTGTGTTCATATGTCGTACAACCCAGCTGAAAATTCCGTCCTGCTTTGCACGAGAGCCAGCAACCTGGAGAACAGCACTTATGACCTGTACACCATCCCCAAGGATACCGACTCCCAGAATCCCGATGCCCCTGAAGGGAAGCGATCCTCTGGTCTGACTGCAGTGTGGGTGGCACGGAATAGATTTGCCGTCCTGGATCGCATGCATTCTATTCTCATCAAGAACCTGAAGAATGAGATCACCAAGAAGGTCCAGGTGCCCAACTGTGATGAGATCTTCTATGCCGGCACTGGGAACCTGCTGCTCCGGGATTCCGACTCCATCACTCTATTTGATGTGCAGCAGAAGCGCACCCTGGCATCTGTGAAGATCTCCAAAGTGAAGTATGTCATTTGGTCCTCCGACATGTCCCACGTGGCTCTTCTTGCCAAGCATGCCATTATGATCTGCAATAGAAAGCTGGAGTCCCTCTGCAACATCCATGAAAATATCCGTGTCAAGAGCGGTGCCTGGGACGAGAGCGGGGTTTTCATCTACACGACCAGCAACCATATCAAATACGCACTCACCACTGGAGATCACGGTATTATTCGAACACTGGATCTGCCCATTTACATCACACGCGTCAAGGGCAACAACGTCTACTGCCTGGACCGGGAGTGCAGACCTCGGGTGCTGACCATTGACCCCACTGAATTNCAGTTCAAGCTCGCTTTGATTAACAGGAAGTACGATGAGGTGCTGCACATGGTGAGAAATGCTAAACTGGTGGGACAGTCCATCATTGCCTACC
  5   1   2       bld HdA       in                  THdA036f15.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCGTACAACCCAGCTGAAAATTCCGTCCTGCTTTGCACGAGAGCCAGCAACCTGGAGAACAGCACTTATGACCTGTACACCATCCCCAAGGATACCGACTCCCAGAATCCCGATGCCCCTGAAGGGAAGCGATCCTCTGGTCTGACTGCAGTGTGGGTGGCACGGAATAGATTTGCCGTCCTGGATCGCATGCATTCTATTCTCATCAAGAACCTGAAGAATGAGATCACCAAGAAGGTCCAGGTGCCCAACTGTGATGAGATCTTCTATGCCGGCACTGGGAACCTGCTGCTCCGGGATTCCGACTCCATCACTCTATTTGATGTGCAGCAGAAGCGCACCCTGGCATCTGTGAAGATCTCCAAAGTGAAGTATGTCATTTGGTCCTCCGACATGTCCCACGTGGCTCTTCTTGCCAAGCATGCCATTATGATCTGCAATAGAAAGCTGGAGTCCCTCTGCAACATCCATGAAAATATCCGTGTCAAGAGCGGTGCCTGGGACGAGAGCGGGGTTTTCATCTACACGACCAGCAACCATATCAAATACGCACTCACCACTGGAGATCACGGTATTATTCGAACACTGGATCTGCCCATTTACATCACACGCGTCAAGGGCAACAACGTCTACTGCCTGGACCGGGAGTGCAGACCTCGGGTGCTGACCATTGACCCCACTGAATTCAAGTTCAAGCTCGCTTTGATTAACAGGAAGTACGATGAGGTGCTGCACATGGTGAGAAATGCTANACTGGNTGGGACAGTCCATCATTGCCTACCTCCAAAA
  5   1   2       bld Gas1                               IMAGE:6989093                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCACTTATGACCTGTACACCATCCCCAAGGATACCGACTCCCAGAATCCCGATGCCCCTGAAGGGAAGCGATCCTCTGGTCTGACTGCAGTGTGGGTGGCACGGAATAGATTTGCCGTCCTGGATCGCATGCATTCTATTCTCATCAAGAACCTGAAGAATGAGATCACCAAGAAGGTCCAGGTGCCCAACTGTGATGAGATCTTCTATGCCGGCACTGGGAACCTGCTGCTCCGGGATTCCGACTCCATCACTCTATTTGATGTGCAGCAGAAGCGCACCCTGCCATCTGTGAAGATCTCCAAAGTGAAGTATGTCATTTGGTCCTCCGACATGTCCCACGTGGCTCTTCTTGCCAAGCATGCCATTATGATCTGCAATAGAAAGCTGGAGTCCCTCTGCAACATCCATGAAAATATCCGTGTCAAGAGCGGTGCCTGGGACGAGAGCGGGGTTTTCATCTACACGACCAGCAACCATATCAAATACGCACTCACCACTGGAGATCACGGTATTATTCGAACACTGGATCTGCCCATTTACATCACACGCGTCAAGGGCAACAACGTCTACTGCCTGGACCGGGAGTGCAGACCTCGGGTGCTGACCATTGACCCCACTGAATTCAAGTTCAAGCTCGCTTTGATTAACAGGAAGTACGATGAGGTGCTGCACATGGTGAGAAATGCTAAACTGGTGGGACAGTCCATCATTGCCTACCTCCAAAAGAAGGGCTACCCAGAGGTGGCATTGCACTTTGTGAAGGACGAGAAGACCCGATTCAGCTTGGCTCTGGAATGTGGGAACATAGAGATCGCCCCTTGAAGCAGCGAAAGCTCTGGGACGACAAAATTGCTGGGAAGAAACTGGGGGGAAGTGGGCCCCTGCTCCCGGGGGGAACCACCCAGAATTGGTGGGAGGATTGTGCCTAACCAGCCGCAACCCAGGAAAAT
  5   1   2       bld Tad5      in                          XZT6202.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCAGGTGCCCAACTGTGATGAGATCTTCTATGCCGGCACTGGGAACCTGCTGCTCCGGGATTCCGACTCCATCACTCTATTTGATGTGCAGCAGAAGCGCACCCTGGCATCTGTGAAGATCTCCAAAGTGAAGTATGTCATTTGGTCCTCCGACATGTCCCACGTGGCTCTTCTTGCCAAGCATGCCATTATGATCTGCAATAGAAAGCTGGAGTCCCTCTGCAACATCCATGAAAATATCCGTGTCAAGAGCGGTGCCTGGGACGAGAGCGGGGTTTTCATCTACACGACCAGCAACCATATCAAATACGCACTCACCACTGGAGATCACGGTATTATTCGAACACTGGATCTGCCCATTTACATCACACGCGTCAAGGGCAACAACGTCTACTGCCTGGACCGGGAGTGCAGACCTCGGGTGCTGACCATTGACCCTACTGAATTCAAGTTCAAGCTCGCTTTGATTAACAGGAAGTACGATGAGGTGCTGCACATGGTGAGAAATGCTAAACTGGTGGGACAGTCCATCATTGCCTACCTCCAAAAGAAGGGCTACCCAGAGGTGGCATTGCACTTTGTGAAGGACGAGAAGACCCGATTCAGCTTGGCTCTGGAATGTGGAAACATAGAGATCGCCCTTGAAGCAGCGAAGGCTCTGGACGACAAGAATTGCTGGGAGAAGCTGGNGGAGGTGGCCCTGCTCCAGGGGAACCACCAGATTGTGGAGATGTGCTACCAGCGCACCAAGAACTTTGACAAGCTCTCC
  5   1   2       bld Te4       in                         CAAN3217.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTCTATGCCGGCACTGGGAACCTGCTGCTCCGGGATTCCGACTCCATCACTCTATTTGATGTGCAGCAGAAGCGCACCCTGGCATCTGTGAAGATCTCCAAAGTGAAGTATGTCATTTGGTCCTCCGACATGTCCCACGTGGCTCTTCTTGCCAAGCATGCCATTATGATCTGCAATAGAAAGCTGGAGTCCCTCTGCAACATCCATGAAAATATCCGTGTCAAGAGCGGTGCCTGGGACGAGAGCGGGGTTTTCATCTACACGACCAGCAACCATATCAAATACGCACTCACCACTGGAGATCACGGTATTATTCGAACACTGGATCTGCCCATTTACATCACACGCGTCAAGGGCAACAACGTCTACTGCCTGGACCGGGAGTGCAGACCTCGGGTGCTGACCATTGACCCCACTGAATTCAAGTTCAAGCTCGCTTTGATTAACAGGAAGTACGATGAGGTGCTGCACATGGTGAGAAATGCTAAACTGGTGGGACAGTCCATCATTGCCTACCTCCAAAAGAAGGGCTACCCAGAGGTGGCACTGCACTTTGTGAAGGACGAGAAGACCCGATTCAGCTTGGCTCTGGAATGTGGAAACATAGAGATCGCCCTTGAAGCAGCGAAGGCTCTGGACGACAAGAATTGCTGGGAGAAGCTGGGGGAGGTGGCCCTGCTCCAGGGGAACCACCAGATTGTGGAGATGTGCTACCAGCGCACCAAGAACTTTGACAAGCTCTCCTTCCTTTACCTCATCACCGGCAACCTGGAAAAACTGCGCAAGATGATGAAGATCGCGGAGATCCGTAAGGACATGAGCGGCCAGTACCAGAATGCACTGTTCC
  3   1   2       bld Neu       in                    TNeu097i05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTGCAGCAGAAGCGCACCCTGGCATCTGTGAAGATCTCCAAAGTGAAGTATGTCATTTGTTCCTCCGACATGTCCCACGTGGCTCTTCTTGCCAAGCATGCCATTATGATCTGCAATAGAAAGCTGGAGTCCCTCTGCAACATCCATGAAAATATCCGTGTCAAGAGCGGTGCCTGGGACGAGAGCGGGGTTTTCATCTACACGACCAGCAACCATATCAAATACGCACTCACCACTGGAGATCACGGTATTATTCGAACACTGGATCTGCCCATTTACATCACACGCGTCAAGGGCAACAACGTCTACTGCCTGGACCGGGAGTGCAGACCTCGGGTGCTGACCATTGACCCCACTGAATTCAAGTTCAAGCTCGCTTTGATTAACAGGAAGTACGATGAGGTGCTGCACATGGTGAGAAATGCTAAACTGGTGGGACAGTCCATCATTGCCTACCTCCAAAAGAAGGGCTACCCAGAGGTGGCATTGCACTTTGTGAAGGACGAGAAGACCCGATTCAGCTTGGCTCTGGAATGTGGAAACATAGAGATCGCCCTTGAAGCAGCGAAGGCTCTGGACGACAAGAATTGCTGGGAGAAGCTGGGGGAGGTGGCCCTGCTCCAGGGGAACCACCAGATTGTGGAGATGTGCTACCAGCGCACCAAGAACTTTGACAAGCTCTCCTTCCTTTACCTCATCACCGGCAACCTGGAAAAACTGCGCAAGATGATGAAAATCGCGGAGATCCGTAAGGACATGAGCGGCCAGTACCAGAATGCACTGTTCCTGGGGGACGTAGACGAAAGAGTGCGGATACTAAAGAACTGTGGGCAGAAATCTCTGGCCTACCTGACAGCCGCCACCCACGGAATCAACGATGAAGAAAGAGGGCTTGAGGGAGACTTTCGACCCAGAAAAAGAAAAAAAAAAAAA
  5   1   2       bld Brn3      in                         CAAK6289.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCAAAGTGAAGTATGTCATTTGGTCCTCCGACATGTCCCACGTGGCTCTTCTTGCCAAGCATGCCATTATGATCTGCAATAGAAAGCTGGAGTCCCTCTGCAACATCCATGAAAATATCCGTGTCAAGAGCGGTGCCTGGGACGAGAGCGGGGTTTTCATCTACACGACCAGCAACCATATCAAATACGCACTCACCACTGGAGATCACGGTATTATTCGAACACTGGATCTGCCCATTTACATCACACGCGTCAAGGGCAACAACGTCTACTGCCTGGACCGGGAGTGCAGACCTCGGGTGCTGACCATTGACCCCACTGAATTCAAGTTCAAGCTCGCTTTGATTAACAGGAAGTACGATGAGGTGCTGCACATGGTGAGAAATGCTAAACTGGTGGGACAGTCCATCATTGCCTACCTCCAAAAGAAGGGCTACCCAGAGGTGGCATTGCACTTTGTGAAGGACGAGAAGACCCGATTCAGCTTGGCTCTGGAATGTGGAAACATAGAGATCGCCCTTGAAGCAGCGAAGGCTCTGGACGACAAGAATTGCTGGGAGAAGCTGGGGGAGGTGGCCCTGCTCCAGGGGAACCACCAGATTGTGGAGATGTGCTACCAGCGCACCAAGAACTTTGACAAGCTCTCCTTCCTTTACTTCATCACCGGCAACCTGGAAAAACTGCGCAAGATGATGAAAATCGCGGAGATCCGTAAGGACATGAGCGGCCAGTACCAGAATGCACTGTTCCTGGGGGACGTAGACGAAAGAGTGCGGATACTAAAGAACTGTGGGCAGAAATCTCTGGCCTACCTGACAGCCGCCACCCACGGAATCAACGAT
  5   1   2       bld Te3       in                          CAAM753.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCATTTGGTCCTCCGACATGTCCCACGTGGCTCTTCTTGCCAAGCATGCCATTATGATCTGCAATAGAAAGCTGGAGTCCCTCTGCAACATCCATGAAAATATCCGTGTCAAGAGCGGTGCCTGGGACGAGAGCGGGGTTTTCATCTACACGACCAGCAACCATATCAAATACGCACTCACCACTGGAGATCACGGTATTATTCGAACACTGGATCTGCCCATTTACATCACACGCGTCAAGGGCAACAACGTCTACTGCCTGGACCGGGAGTGCAGACCTCGGGTGCTGACCATTGACCCCACTGAATTCAAGTTCAAGCTCGCTTTGATTAACAGGAAGTACGATGAGGTGCTGCACATGGTGAGAAATGCTAAACTGGTGGGACAGTCCATCATTGCCTACCTCCAAAAGAAGGGCTACCCAGAGGTGGCATTGCACTTTGTGAAGGACGAGAAGACCCGATTCAGCTTGGCTCTGGAATGTGGAAACATAGAGATCGCCCTTGAAGCAGCGAAGGCTCTGGACGACAAGAATTGCTGGGAGAAGCTGGGGGAGGTGGCCCTGCTCCAGGGGAACCACCAGATTGTGGAGATGTGCTACCAGCGCACCAAGAACTTTGACAAGCTCTCCTTCCTTTACCTCATCACCGGCAACCTGGAAAAACTGCGCAAGATGATGAAAATCGCGGAGATCCGTAAGGACATGAGCGGCCAGTACCAGAATGCACTGTTCCTGGGGGGACGTAGACGAAAGAGTGCGGATACTAAAGAACTGTGGGCAGAAATCTCTGGGCTACCTG
  5   1   2       bld In62                            IMAGE:8956761.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTCCTCCGAACATGTCCCACGTGGCTCTTCTTGCCAAGCATGCCATTATGATCTGCAATAGAAAGCTGGAGTCCCTTCTGCAACATCCATGAAAATATCCGTGTCAAGAGCGGTGCCTGGGACGAGAGCGGGGTTTTCATCTACACGACCAGCAACCATATCAAATACGCACTCACCACTGGAGATCACGGTATTATTCGAACACTGGATCTGCCCATTTACATCACACGCGTCAAGGGCAACAACGTCTACTGCCTGGACCGGGAGTGCAGACCTCGGGTGCTGACCATTGACCCCACTGAATTCAAGTTCAAGCTCGCTTTGATTAACAGGAAGTACGATGAGGTGCTGCACATGGTGAGAAATGCTAAACTGGTGGGACAGTCCATCATTGCCTACCTCCAAAAGAAGGGCTACCCAGAGGTGGCATTGCACTTTGTGAAGGACGAGAAGACCCGATTCAGCTTGGCTCTGGAATGTGGAAACATAGAGATCGCCCTTGAAGCAGCGAAGGCTCTGGACGACAAGAATTGCTGGGAGAAGCTGGGGGAGGTGGCCCTGCTCCAGGGGAACCACCAGATTGTGGAGATGTGCTACCAGCGCACCAAGAACTTTGACAAGCTCTCCTTCCTTTACCTCATCACCGGCAACCTGAAAAACTGCGCAAGATGATGAAAATCGCGGAGATCCGTAAGGACATGAGCGGCAGTACAGATGCACTGTTCTGGGGGACGTAGACGAAGATGCGATACTAAAGACTGTGGCAGAATCTCTGCTACTGACGGCGCACCCACGATCACGATGAGAAGGCCTGAGAACTTTCGAACTGAAAGAATATTCGAGGTGAACCTGAATGCT
  5   1   2       bld Te1       in                        CBWN17746.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCTCTGCAACATCCATGAAAATATCCGTGTCAAGAGCGGTGCCTGGGACGAGAGCGGGGTTTTCATCTACACGACCAGCAACCATATCAAATACGCACTCACCACTGGAGATCACGGTATTATTCGAACACTGGATCTGCCCATTTACATCACACGCGTCAAGGGCAACAACGTCTACTGCCTGGACCGGGAGTGCAGACCTCGGGTGCTGACCATTGACCCCACTGAATTCAAGTTCAAGCTCGCTTTGATTAACAGGAAGTACGATGAGGTGCTGCACATGGTGAGAAATGCTAAACTGGTGGGACAGTCCATCATTGCCTACCTCCAAAAGAAGGGCTACCCAGAGGTGGCACTGCACTTTGTGAAGGACGAGAAGACCCGATTCAGCTTGGCTCTGGAATGTGGAAACATAGAGATCGCCCTTGAAGCAGCGAAGGCTCTGGACGACAAGAATTGCTGGGAGAAGCTGGGGGAGGTGGCCCTGCTCCAGGGGAACCACCAGATTGTGGAGATGTGCTACCAGCGCACCAAGAACTTTGACAAGCTCTCCTTCCTTTACCTCATCACCGGCAACCTGGAAAAACTGCGCAAGATGATGAAAATCGCGGAGATCCGTAAGGACATGAGCGGCCAGTACCAGAATGCACTGTTCCTGGGGGACGTAGACGAAAGAGTGCGGATACTAAAGAACTGTGGGCAGAAATCTCTGGCCTACCTGACAGCCGCCACCCACGGAATCAACGATGAAGAAGAGGGCT
  5   1   2       bld Gas7      in                         XZG43929.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCTCTGCAACATCCATGAAAATATCCGTGTCAAGAGCGGTGCCTGGGACGAGAGCGGGGTTTTCATCTACACGACCAGCAACCATATCAAATACGCACTCACCACTGGAGATCACGGTATTATTCGAACACTGGATCTGCCCATTTACATCACACGCGTCAAGGGCAACAACGTCTACTGCCTGGACCGGGAGTGCAGACCTCGGGTGCTGACCATTGACCCCACTGAATTCAAGTTCAAGCTCGCTTTGATTAACAGGAAGTACGATGAGGTGCTGCACATGGTGAGAAATGCTAAACTGGTGGGACAGTCCATCATTGCCTACCTCCAAAAGAAGGGCTACCCAGAGGTGGCACTGCACTTTGTGAAGGACGAGAAGACCCGATTCAGCTTGGCTCTGGAATGTGGAAACATAGAGATCGCCCTTGAAGCAGCGAAGGCTCTGGACGACAAGAATTGCTGGGAGAAGCTGGGGGAGGTGGCCCTGCTCCAGGGGAACCACCAGATTGTGGAGATGTGCTACCAGCGCACCAAGAACTTTGACAAGCTCTCCTTCCTTTACCTCATCACCGGCAACCTGGAAAAACTGCGCAAGATGATGAAAATCGCGGAGATCCGTAAGGACATGAGCGGCCAGTACCAGAATGCACTGTTCCTGGGGGACGTAGACGAAAGAGTGCGGATACTAAAGAACTGTGGGCAGAAATCTCTGGCCTACCTGACAGCCGCCACCCACGGAATCAACGATGAAGAAGAGGGCTTGAGGGAGACTTTCGACCC
  5   1   2       bld Abd0      in                     IMAGE:6999859.b                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CATCCTGAAAATATCCGTGTCAAGAGCGGTGCCTGGGACGAGAGCGGGGTTTTCATCTACACGACCAGCAACCATATCAAATACGCACTCACCACTGGAGATCACGGTATTATTCGAACACTGGATCTGCCCATTTACATCACACGCGTCAAGGGCAACAACGTCTACTGCCTGGACCGGGAGTGCAGACCTCGGGTGCTGACCATTGACCCCACTGAATTCAAGTTCAAGCTCGCTTTGATTAACAGGAAGTACGATGAGGTGCTGCACATGGTGAGAAATGCTAAACTGGTGGGACAGTCCATCATTGCCTACCTCCAAAAGAAGGGCTACCCAGAGGTGGCACTGCACTTTGTGAAGGACGAGAAGACCCGATTCAGCTTGGCTCTGGAATGTGGAAACATAGAGATCGCCCTTGAAGCAGCGAAGGCTCTGGACGACAAGAATTGCTGGGAGAAGCTGGGGGAGGTGGCCCTGCTCCAGGGGAACCACCAGATTGTGGAGATGTGCTACCAGCGCACCAAGAACTTTGACAAGCTCTCCTTCCTTTACCTCATCACCGGCAACCTGGAAAAACTGCGCAAGATGATGAAGATCGCGGAGATCCGTAAGGACATGAGCGGCCAGTACCAGAATGCACTGTTCCTGGGGGACGTAGACGAAAGAGTGCGGATACTGAAGAACTGTGGGCAGAAATCTCTGGCCTACCTGACAGCCGC
  5   1   2       bld In66                            IMAGE:8963058.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGTGCCTGGGACTTATGTTGCGGGGTTTTCATCTACACGACCAGCAACCATATCAAATACGCACTCACCACTGGAGATCACGGTATTATTCGAACACTGGATCTGCCCATTTACATCACACGCGTCAAGGGCAACAACGTCTACTGCCTGGACCGGGAGTGCAGACCTCGGGTGCTGACCATTGACCCCACTGAATTCAAGTTCAAGCTCGCTTTGATTAACAGGAAGTACGATGAGGTGCTGCACATGGTGAGAAATGCTAAACTGGTGGGACAGTCCATCATTGCCTACCTCCAAAAGAAGGGCTACCCAGAGGTGGCATTGCACTTTGTGAAGGACGAGAAGACCCGATTCAGCTTGGCTCTGGAATGTGGAAACATAGAGATCGCCCTTGAAGCAGCGAAGGCTCTGGACGACAAGAATTGCTGGGAGAAGCTGGGGGAGGTGGCCCTGCTCCAGGGGAACCACCAGATTGTGGAGATGTGCTACCAGCGCACCAAGAACTTTGACAAGCTCTCCTTCCTTTACCTCATCACCGGCAACCTGGAAAAACTGCGCAAGATGATGAAAATCGCGGAGATCCGTAAGGACATGAGCGGCCAGTACCAGAATGCACTGTTCCTGGGGGACGTAGACGAAGAGTGCGGATACTAAAGAACTGTGGGCAGAATCTCTGGCCTACCTGACAGCCGCCACCCACGGAATCACGATGAGAGAGGCTTGAGGAGACTTTCGACCCAGAAAAAGAAATAATTCAGAGTGACCCTGATGCTAGCTGCTGATGCCCCCACCCCCCATCATGCTCTGAACCACTGCCTCTGTGACATGTCTAGCTTCTTGAGAATCATTGCACAGTAGTGGAGCTGGCTGCGATTCGATGTAATATCTTGTGAGGAAGGCTTGGCGAGACAT
  5  -1   2       bld Fat1      in                         CABC6961.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACGAGAGCGGGGTTTTCATCTACCCGACCAGCAACCATATCAAATACGCACTCACCACTGGAGATCACGGTATTATTCGAACACTGGATCTGCCCATTTACATCACACGCGTCAAGGGCAACAACGTCTACTGCCTGGACCGGGAGTGCAGACCTCGGGTGCTGACCATTGACCCCACTGAATTCAAGTTCAAGCTCGCTTTGATTAACAGGAAGTACGATGAGGTGCTGCACATGGTGAGAAATGCTAAACTGGTGGGACAGTCCATCATTGCCTACCTCCAAAAGAAGGGCTACCCAGAGGTGGCACTGCACTTTGTGAAGGACGAGAAGACCCGATTCAGCTTGGCTCTGGAATGTGGAAACATAGAGATCGCCCTTGAAGCAGCGAAGGCTCTGGACGACAAGAATTGCTGGGAGAAGCTGGGGGAGGTGGCCCTGCTCCAGGGGAACCACCAGATTGTGGAGATGTGCTACCAGCGCACCAAGAACTTTGACAAGCTCTCCTTCCTTTACCTCATCACCGGCAACCTGGAAAAACTGCGCAAGATGATGAAGATCGCGGAGATCCGTAAGGACATGAGCGGCCAGTACCAGAATGCACTGTTCCTGGGGGACGTAGACGAAAGAGTGCGGATACTGAAGAACTGTGGGCAGAGTAAGTCCAGTCACTTTTCCTTACCCCATGCTGTTTCTTTGGTTCCTTGCTGTGAGCTAATCTTCTGCTCTTCCTCAGAATCTCTGGCCTACCTGACAGCCGCCACCCACGGAATCAACGATGAAGAAGAGGGCTTGAGGGAGACTTTCGACCCAGAAAAAGAAATAGTAAGGATTACGGTGAAGTTCTTGGGTTGGCTCCGATTTAGCATTTCTTTAGGCAGCCCTCGTAAAGTCAAA
  5   1   2       bld Te5       in                         CAAO4499.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGAGAGCGGGGTTTTCATCTACACGACCAGCAACCATATCAAATACGCACTCACCACTGGAGATCACGGTATTATTCGAACACTGGATCTGCCCATTTACATCACACGCGTCAAGGGCAACAACGTCTACTGCCTGGACCGGGAGTGCAGACCTCGGGTGCTGACCATTGACCCCACTGAATTCAAGTTCAAGCTCGCTTTGATTAACAGGAAGTACGATGAGGTGCTGCACATGGTGAGAAATGCTAAACTGGTGGGACAGTCCATCATTGCCTACCTCCAAAAGAAGGGCTACCCAGAGGTGGCATTGCACTTTGTGAAGGACGAGAAGACCCGATTCAGCTTGGCTCTGGAATGTGGAAACATAGAGATCGCCCTTGAAGCAGCGAAGGCTCTGGACGACAAGAATTGCTGGGAGAAGCTGGGGGAGGTGGCCCTGCTCCAGGGGAACCACCAGATTGTGGAGATGTGCTACCAGCGCACCAAGAACTTTGACAAGCTCTCCTTCCTTTACCTCATCACCGGCAACCTGGAAAAACTGCGCAAGATGATGAAAATCGCGGAGATCCGTAAGGACATGAGCGGCCAGTACCAGAATGCACTGTTCCTGGGGGACGTAGACGAAAGAGTGCGGATACTAAAGAACTGTGGGCAGAAATCTCTGGCCTACCTGACAGCCGCCACCCACGGAATCAACGATGAAGAAGAGGGCTTGAGGGAGACTTTCGACCC
  5   1   2       bld Te4       in                          CAAN483.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACCATATCAAATACGCACTCACCACTGGAGATCACGGTATTATTCGAACACTGGATCTGCCCATTTACATCACACGCGTCAAGGGCAACAACGTCTACTGCCTGGACCGGGAGTGCAGACCTCGGGTGCTGACCATTGACCCCACTGAATTCAAGTTCAAGCTCGCTTTGATTAACAGGAAGTACGATGAGGTGCTGCACATGGTGAGAAATGCTAAACTGGTGGGACAGTCCATCATTGCCTACCTCCAAAAGAAGGGCTACCCAGAGGTGGCATTGCACTTTGTGAAGGACGAGAAGACCCGATTCAGCTTGGCTCTGGAATGTGGAAACATAGAGATCGCCCTTGAAGCAGCGAAGGCTCTGGACGACAAGAATTGCTGGGAGAAGCTGGGGGAGGTGGCCCTGCTCCAGGGGAACCACCAGATTGTGGAGATGTGCTACCAGCGCACCAAGAACTTTGACAAGCTCTCCTTCCTTTACCTCATCACCGGCAACCTGGAAAAACTGCGCAAGATGATGAAAATCGCGGAGATCCGTAAGGACATGAGCGGCCAGTACCAGAATGCACTGTTCCTGGGGGACGTAGACGAAAGAGTGCGGATACTAAAGAACTGTGGGCAGAAATCTCTGGCCTACCTGACAGCCGCCACCCACGGAATCAACGATGAAGAAGAGGGCTTGAGGGAGACTTTCGACCCAGAAAAAGAAATAATTCCAGAGGTTGACCCTGATGCTAAGCTGCTGATGCCCCCCACCCCCATCATGCCTCTGGACACCAACTGGCCTCTGTTGACCATGTCT
  5   1   2       chi Int1      in                        CAAP13387.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCATTTACATCACACGCGTCAAGGGCAACAACGTCTACTGCCTGGACCGGGAGTGCAGACCTCGGGTGCTGACCATTGACCCCACTGAATTCAAGTTCAAGCTCGCTTTGATTAACAGGAAGTACGATGAGGTGCTGCACATGGTGAGAAATGCTAAACTGGTGGGACAGTCCATCATTGCCTACCTCCAAAAGAAGGGCTACCCAGAGGTGGCACTGCACTTTGTGAAGGACGAGAAGACCCGATTCAGCTTGGCTCTGGAATGTGGAAACATAGAGATCGCCCTTGAAGCAGCGAAGGCTCTGGACGACAAGAATTGCTGGGAGAAGCTGGGGGAGGTGGCCCTGCTCCAGGGGAACCACCAGATTGTGGAGATGTGCTACCAGCGCACCAAGAACTTTGACAAGCTCTCCTTCCTTTACCTCATCACCGGCAACCTGGAAAAACTGCGCAAGATGATGAAGATCGGTAAGCCATGCCTATGCCACTCAGACTTTAAACCAGAGGGCTATGAAATGTAAAGCTTAACCTGCCTCTTGTCTTGGGCTACAGCGGAGATCCGTAAGGACATGAGCGGCCAGTACCAGAATGCACTGTTCCTGGGGGACGTAGACGAAAGAGTGCGGATACTGAAGAACTGTGGGCAGAGTAAGTCCAGTCACTTTTCCTTACCCCATGCTGTTTCTTTGGTTCCTTGCTGTGAGCTAATCTTCTGCTCTTCCTCAGAATCTCTGGCCTACCTGACAGCCGCCACCCACGGAATCAACGATGAAGAAGAGGGCTTGAGGGAGACTTTCGACCCAGAAAAAGAAATAGTAAGGATTACGGTGAAGTTCTTGGGTTGGCT
  5   1   2       bld In62                            IMAGE:8956523.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGCGGTTCAAGGGCAACAACGTCTACTGCCTGGACCGGGAGTGCAGACCTCGGGTGCTGACCATTGACCCCACTGAATTCAAGTTCAAGCTCGCTTTGATTAACAGGAAGTACGATGAGGTGCTGCACATGGTGAGAAATGCTAAACTGGTGGGACAGTCCATCATTGCCTACCTCCAAAAGAAGGGCTACCCAGAGGTGGCATTGCACTTTGTGAAGGACGAGAAGACCCGATTCAGCTTGGCTCTGGAATGTGGAAACATAGAGATCGCCCTTGAAGCAGCGAAGGCTCTGGACGACAAGAATTGCTGGGAGAAGCTGGGGGAGGTGGCCCTGCTCCAGGGGAACCACCAGATTGTGGAGATGTGCTACCAGCGCACCAAGAACTTTGACAAGCTCTCCTTCCTTTACCTCATCACCGGCAACCTGGAAAAACTGCGCAAGATGATGAAAATCGCGGAGATCCGTAAGGACATGAGCGGCCAGTACCAGAATGCACTGTTCCTGGGGGACGTAGACGAAAGAGTGCGGATACTAAAGAACTGTGGGCAGAAATCTCTGGCCTACCTGACAGCCGCCACCCACGGAATCAACGATGAAGAAGAGGGCTTGAGGGAGACTTTCGACCCAGAAAAAGAAATAATTCCAGAGGTTGACCCTGATGCTAAGCTGCTGATGCCCCCACCCCCCCATCATGCCTCTGGACACCAACTGGCTCTGTTGACCATGTCTAAGGCTTCTTTGAAGATCATGCACAAGTAAAGGTGGAGCCCTGCTGCGAATTCGATGTAGATACTGTGGAGTGAGCTGGGAAAGATGCAGGCTCAGCTGATGAATGATTGTGGATGCTGGAGAAAACTTTGGAACCAGGGTGCCAGGC
  5   1   2       bld Gas7      in                         XZG23250.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGGAAGTACGATGAGGTGCTGCACATGGTGAGAAATGCTAAACTGGTGGGACAGTCCATCATTGCCTACCTCCAAAAGAAGGGCTACCCAGAGGTGGCACTGCACTTTGTGAAGGACGAGAAGACCCGATTCAGCTTGGCTCTGGAATGTGGAAACATAGAGATCGCCCTTGAAGCAGCGAAGGCTCTGGACGACAAGAATTGCTGGGAGAAGCTGGGGGAGGTGGCCCTGCTCCAGGGGAACCACCAGATTGTGGAGATGTGCTACCAGCGCACCAAGAACTTTGACAAGCTCTCCTTCCTTTACCTCATCACCGGCAACCTGGAAAAACTGCGCAAGATGATGAAAATCGCGGAGATCCGTAAGGACATGAGCGGCCAGTACCAGAATGCACTGTTCCTGGGGGACGTAGACGAAAGAGTGCGGATACTAAAGAACTGTGGGCAGAAATCTCTGGCCTACCTGACAGCCGCCACCCACGGAATCAACGATGAAGAAGAGGGCTTGAGGGAGACTTTCGACCCCGAAAAAGAAATAATTCCAGAGGTTGACCCCTGATGCTAAGCTGCTGATGCCCCCACCCCCCATCATGCCTCTGGACACCAACTGGGCCTCTGTTGACCATGTCTAAGGGCCTCTTTGAAGGATCCATTGGGCAACAAAGGAAAAGGGGG
  5   1   2       bld Te4       in                         CAAN8860.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAGTACGATGAGGTGCTGCACATGGTGAGAAATGCTAAACTGGTGGGACAGTCCATCATTGCCTACCTCCAAAAGAAGGGCTACCCAGAGGTGGCACTGCACTTTGTGAAGGACGAGAAGACCCGATTCAGCTTGGCTCTGGAATGTGGAAACATAGAGATCGCCCTTGAAGCAGCGAAGGCTCTGGACGACAAGAATTGCTGGGAGAAGCTGGGGGAGGTGGCCCTGCTCCAGGGGAACCACCAGATTGTGGAGATGTGCTACCAGCGCACCAAGAACTTTGACAAGCTCTCCTTCCTTTACCTCATCACCGGCAACCTGGAAAAACTGCGCAAGATGATGAAGATCGCGGAGATCCGTAAGGACATGAGCGGCCAGTACCAGAATGCACTGTTCCTGGGGGACGTAGACGAAAGAGTGCGGATACTGAAGAACTGTGGGCAGAAATCTCTGGCCTACCTGACAGCCGCCACCCACGGAATCAACGATGAAGAAGAGGGCTTGAGGGAGACTTTCGACCCAGAAAAAGAAATAATTCCAGAGGTTGACCCTGATGCTAAGCTGCTGATGCCCCCACCCCCCATCATGCCTCTGGACACCAACTGGCCTCTGTTGACCATGTCTAAGGGCTTCTTTGAAGGATCCATTGGCAACAAAGGTAAAGGTGGAGCCCTGGCTGCGGATATCGATGTAGATACTGTGGGAGGTGAAGGCTGGGGAGAAGATGCCGAGCTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGAGAAAACTTTGGAGACGAGGTGGCAGGCAAAGGGCAA
  5   1   2       bld In62                            IMAGE:8954993.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTTAATTACGGCCGGGTACAAATTTGTTAATAAATTCGTCCCACAGTCCATCATTGCCTACCTCCAAAAGAAGGGCTACCCAGAGGTGGCATTGCACTTTGTGAAGGACGAGAAGACCCGATTCAGCTTGGCTCTGGAATGTGGAAACATAGAGATCGCCCTTGAAGCAGCGAAGGCTCTGGACGACAAGAATTGCTGGGAGAAGCTGGGGGAGGTGGCCCTGCTCCAGGGGAACCACCAGATTGTGGAGATGTGCTACCAGCGCACCAAGAACTTTGACAAGCTCTCCTTCCTTTACCTCATCACCGGCAACCTGGAAAAACTGCGCAAGATGATGAAAATCGCGGAGATCCGTAAGGACATGAGCGGCCAGTACCAGAATGCACTGTTCCTGGGGGACGTAGACGAAAGAGTGCGGATACTAAAGAACTGTGGGCAGAAATCTCTGGCCTACCTGACAGCCGCCACCCACGGAATCAACGATGAAGAAGAGGGCTTGAGGGAGACTTTCGACCCAGAAAAAGAAATAATTCCAGAGGTTGACCCTGATGCTAAGCTGCTGATGCCCCCACCCCCCATCATGCCTCTGGACACCAACTGGCCTCTGTTGACCATGTCTAAGGGCTTCTTTGAAGGATCCATTGGCAACAAAGGTAAAGGTGGAGCCCTGGCTGCGGATATCGATGTAGATACTGTGGGAGGTGAAGGCTGGGGAGAAGATGCCGAGCTTCAGCTGGATGAGATGGTTTTGTGGATGCTGGAGAAAACTTTGGAGACGAGTGGCAGGCAAAGGGCAGAGAGGGCGGTGATGGATGTGGAGAGGATCTTGACCTTCCCCTGAACTGGATGTTCCCTCTGCCGTCTGCACAGCTGAGATGATTCTTTGTGCCTCCACTAAAGCACAGTCATCGCAGACTGATTATAACTCCAGCTCTGTGATCGTCTGCGTCCTGAACTGCATGCATGCTCATGACAGTTGAGTGTGGACTGCCGTCAGGCACTTCTCTAATCTTCCCGGGTCGACACTAACAGGCCGTGCAGGATA
  5   1   2       bld In63                            IMAGE:8957370.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACGGTTTTTTTTGAGGATACTATTAATATAAAATCGTCCCAAAGAAGGGCTACCCAGAGGTGGCATTGCACTTTGTGAAGGACGAGAAGACCCGATTCAGCTTGGCTCTGGAATGTGGAAACATAGAGATCGCCCTTGAAGCAGCGAAGGCTCTGGACGACAAGAATTGCTGGGAGAAGCTGGGGGAGGTGGCCCTGCTCCAGGGGAACCACCAGATTGTGGAGATGTGCTACCAGCGCACCAAGAACTTTGACAAGCTCTCCTTCCTTTACCTCATCACCGGCAACCTGGAAAAACTGCGCAAGATGATGAAAATCGCGGAGATCCGTAAGGACATGAGCGGCCAGTACCAGAATGCACTGTTCCTGGGGGACGTAGACGAAAGAGTGCGGATACTAAAGAACTGTGGGCAGAAATCTCTGGCCTACCTGACAGCCGCCACCCACGGAATCAACGATGAAGAAGAGGGCTTGAGGGAGACTTTCGACCCAGAAAAAGAAATAATTCCAGAGGTTGACCCTGATGCTAAGCTGCTGATGCCCCCACCCCCCATCATGCCTCTGGACACCAACTGGCCTCTGTTGACCATGTCTAAGGGCTTCTTTGAAGGATCCATTGGCAACAAAGGTAAAGGTGGAGCCCTGGCTGCGGATATCGATGTAGATACTGTGGGAGGTGAAGGCTGGGGAGAAGATGCCGAGCTTCAGCTGGATGAGATGGTTTTGTGGATGCTGGAGAAAACTTTGGAGACGAGTGCAGCAAAGGGCAGAGAGGGCGTGATGGGATGTGAGAGATCTGACTTCCCCTGACTGATGTCCTCTGTCGTCTGCCAGCTGAGATGATTCTTTTGTGCTCCACCTAAGGCAACAGTTCCATCGC
  5   1   2       bld In66                            IMAGE:8962665.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CACCCTTCCAAAAAGAAGGGCTACCCAGAGGTGGCATTGCACTTTGTGAAGGACGAGAAGACCCGATTCAGCTTGGCTCTGGAATGTGGAAACATAGAGATCGCCCTTGAAGCAGCGAAGGCTCTGGACGACAAGAATTGCTGGGAGAAGCTGGGGGAGGTGGCCCTGCTCCAGGGGAACCACCAGATTGTGGAGATGTGCTACCAGCGCACCAAGAACTTTGACAAGCTCTCCTTCCTTTACCTCATCACCGGCAACCTGGAAAAACTGCGCAAGATGATGAAAATCGCGGAGATCCGTAAGGACATGAGCGGCCAGTACCAGAATGCACTGTTCCTGGGGGACGTAGACGAAAGAGTGCGGATACTAAAGAACTGTGGGCAGAAATCTCTGGCCTACCTGACAGCCGCCACCCACGGAATCAACGATGAAGAAGAGGGCTTGAGGGAGACTTTCGACCCAGAAAAAGAAATAATTCCAGAGGTTGACCCTGATGCTAAGCTGCTGATGCCCCCACCCCCCATCATGCCTCTGGACACCAACTGGCCTCTGTTGACCATGTCTAAAGGGCTTCTTTGAAGGATCCATTGGCAACAAGGTAAAGGTGGAGCCCTGGCTGCGGATATCGATGTAGATACTGTGGGAGGTGAAGGCTGGGGAGAAGATGCCGAGCTTCAGCTGGATGAGATGGTTTGTGGATGCTGAGAAACTTGAGACGAGTGCAGCAAGGCAGAGAGGCGGTGATGGGATGTGAGAGATCTGACTCCCTGACTGGATGTCTCTGTCGGTCTGCAGCTGAATGATCTTGGACCTCAACTAAGGCACAGTCATCGCAGACATGGGGTAATACTTC
  5   1   2       bld Limb      in                        CBSU2750.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACTTTGTGAAGGACGAGAAGACCCGATTCAGCTTGGCTCTGGAATGTGGAAACATAGAGATCGCCCTTGAAGCAGCGAAGGCTCTGGACGACAAGAATTGCTGGGAGAAGCTGGGGGAGGTGGCCCTGCTCCAGGGGAACCACCAGATTGTGGAGATGTGCTACCAGCGCACCAAGAACTTTGACAAGCTCTCCTTCCTTTACCTCATCACCGGCAACCTGGAAAAACTGCGCAAGATGATGAAGATCGCGGAGATCCGTAAGGACATGAGCGGCCAGTACCAGAATGCACTGTTCCTTGGGGACGTAGACGAAAGAGTGCGGATACTGAAGAACTGTGGGCAGAAATCTCTGGCCTACCTGACAGCCGCCACCCACGGAATCAACGATGAAGAAGAGGGCTTGAGGGAGACTTTCGACCCAGAAAAAGAAATAATTCCAGAGGTTGACCCTGATGCTAAGCTGCTGATGCCCCCACCCCCCATCATGCCTCTGGACACCAACTGGCCTCTGTTGACCATGTCTAAGGGCTTCTTTGAAGGATCCATTGGCAACAAAGGTAAAGGTGGAGCCCTGGCTGCGGATATCGATGTAGATACTGTGGGAGGTGAAGGCTGGGGAGAGGATGCCGAGCTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGAGAAAACTTTGGAGACGAGGTGTCAGGCAAAGGGCAAGAAGAGGGCGGTGGATGGGATGTGGAAGAGGATCTTGACCTTCCCCCTGAACTGGATGTTCCCTCTGGCCCGTCTGGCACAGCTG
  5   1   2       bld Te1       in                        CBWN10388.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GATTCAGCTTGGCTCTGGAATGTGGAAACATAGAGATCGCCCTTGAAGCAGCGAAGGCTCTGGACGACAAGAATTGCTGGGAGAAGCTGGGGGAGGTGGCCCTGCTCCAGGGGAACCACCAGATTGTGGAGATGTGCTACCAGCGCACCAAGAACTTTGACAAGCTCTCCTTCCTTTACCTCATCACCGGCAACCTGGAAAAACTGCGCAAGATGATGAAGATCGCGGAGATCCGTAAGGACATGAGCGGCCAGTACCAGAATGCACTGTTCCTGGGGGACGTAGACGAAAGAGTGCGGATACTGAAGAACTGTGGGCAGAAATCTCTGGCCTACCTGACAGCCGCCACCCACGGAATCAACGATGAAGAAGAGGGCTTGAGGGAGACTTTCGACCCAGAAAAAGAAATAATTCCAGAGGTTGACCCTGATGCTAAGCTGCTGATGCCCCCACCCCCCATCATGCCTCTGGACACCAACTGGCCTCTGTTGACCATGTCTAAGGGCTTCTTTGAAGGATCCATTGGCAACAAAGGTAAAGGTGGAGCCCTGGCTGCGGATATCGATGTAGATACTGTGGGAGGTGAAGGCTGGGGAGAAGATGCCGAGCTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGAGAAAACTTTGGAGACGAGGTGGCAGGCAAAGGGCAAGAAGAGGGCGGTGGA
  5   1   2       bld Eye       in                          CCAX410.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTCTAGATCGCCCTTGAAGCAGCGAAGGCTCTGGACGACAAGAATTGCTGGGAGAAGCTGGGGGAGGTGGCCCTGCTCCAGGGGAACCACCAGATTGTGGAGATGTGCTACCAGCGCACCAAGAACTTTGACAAGCTCTCCTTCCTTTACCTCATCACCGGCAACCTGGAAAAACTGCGCAAGATGATGAAGATCGCGGAGATCCGTAAGGACATGAGCGGCCAGTACCAGAATGCACTGTTCCTGGGGGACGTAGACGAAAGAGTGCGGATACTGAAGAACTGTGGGCAGAAATCTCTGGCCTACCTGACAGCCGCCACCCACGGAATCAACGATGAAGAAGAGGGCTTGAGGGAGACTTTCGACCCAGAAAAAGAAATAATTCCAGAGGTTGACCCTGATGCTAAGCTGCTGATGCCCCCACCCCCCATCATGCCTCTGGACACCAACTGGCCTCTGTTGACCATGTCTAAGGGCTTCTTTGAAGGATCCATTGGCAACAAAGGTAAAGGTGGAGCCCTGGCTGCGGATATCGATGTAGATACTGTGGGAGGTGAAGGCTGGGGAGAAGATGCCGAGCTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGAGAAAACTTTGGAGACGAGGTGGCAGGCAAAGGGCAAGAAGAGGGCGGTGGATGGGATGTGGAAGAGGATCTTGACCTTCCCCCTGAACTGGATGTTCCCTCTGGCCCGTCTGGCACAGCTGAAGATGGATTCTTTGTGCCCCCAACTAAAGGCAACAGTCCATCGCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACGTCCTG
  5   1   2       bld Gas8      in                          st43c17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGATCGCCCTTGAAGCAGCGAAGGCTCTGGACGACAAGAATTGCTGGGAGAAGCTGGGGGAGGTGGCCCTGCTCCAGGGGAACCACCAGATTGTGGAGATGTGCTACCAGCGCACCAAGAACTTTGACAAGCTCTCCTTCCTTTACCTCATCACCGGCAACCTGGAAAAACTGCGCAAGATGATGAAGATCGCGGAGATCCGTAAGGACATGAGCGGCCAGTACCAGAATGCACTGTTCCTGGGGGACGTAGACGAAAGAGTGCGGATACTGAAGAACTGTGGGCAGAAATCTCTGGCCTACCTGACAGCCGCCACCCACGGAATCAACGATGAAGAAGAGGGCTTGAGGGAGACTTTCGACCCAGAAAAAGAAATAATTCCAGAGGTTGACCCTGATGCTAAGCTGCTGATGCCCCCACCCCCCATCATGCCTCTGGACACCAACTGGCCTCTGTTGACCATGTCTAAGGGCTTCTTTGAAGGATCCATTGGCAACAAAGGTAAAGGTGGAGCCCTGGCTGCGGATATCGATGTAGATACTGTGGGAGGTGAAGGCTGGGGAGAAGATGCCGAGCTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGAGAAAACTTTGGAGACGAGGTGGCAGGCAAAGGGCAAGAAGAGGGCGGTGGATGGG
  5   1   2       bld Brn4      in                        CAAL18389.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGAATTGCTGGGAGAAGCTGGGGGAGGTGGCCCTGCTCCAGGGGAACCACCAGATTGTGGAGATGTGCTACCAGCGCACCAAGAACTTTGACAAGCTCTCCTTCCTTTACCTCATCACCGGCAACCTGGAAAAACTGCGCAAGATGATGAAAATCGCGGAGATCCGTAAGGACATGAGCGGCCAGTACCAGAATGCACTGTTCCTGGGGGACGTAGACGAAAGAGTGCGGATACTAAAGAACTGTGGGCAGAAATCTCTGGCCTACCTGACAGCCGCCACCCACGGAATCAACGATGAAGAAGAGGGCTTGAGGGAGACTTTCGACCCAGAAAAAGAAATAATTCCAGAGGTTGACCCTGATGCTAAGCTGCTGATGCCCCCACCCCCCATCATGCCTCTGGACACCAACTGGCCTCTGTTGACCATGTCTAAGGGCTTCTTTGAAGGATCCATTGGCAACAAAGGTAAAGGTGGAGCCCTGGCTGCGGATATCGATGTAGATACTGTGGGAGGTGAAGGCTGGGGAGAAGATGCCGAGCTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGAGAAAACTTTGGAGACGAGGTGGCAGGCAAAGGGCAAGAAGAGGGCGGTGGATGGGATGTGGAAGAGGATCTTGACCTTCCCCCTGAACTGGATGTTCCCTCTGGCCCGTCTGGCACAGCTGAAGATGGATTCTTTGTGCCCCCAACTAAAGGCAACAGTCCATCGCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACGTCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTG
  5   1   2       bld Limb      in                        CBSU1538.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGCAAAATAAAGAACAGTGGGGAGGTGGCCCTGCTCCAGGGGAACCACCAGATTGTGGAGATGTGCTACCAGCGCACCAAGAACTTTGACAAGCTCTCCTTCCTTTACCTCATCACCGGCAACCTGGAAAAACTGCGCAAGATGATGAAGATCGCGGAGATCCGTAAGGACATGAGCGGCCAGTACCAGAATGCACTGTTCCTTGGGGACGTAGACGAAAGAGTGCGGATACTGAAGAACTGTGGGCAGAAATCTCTGGCCTACCTGACAGCCGCCACCCACGGAATCAACGATGAAGAAGAGGGCTTGAGGGAGACTTTCGACCCAGAAAAAGAAATAATTCCAGAGGTTGACCCTGATGCTAAGCTGCTGATGCCCCCACCCCCCATCATGCCTCTGGACACCAACTGGCCTCTGTTGACCATGTCTAAGGGCTTCTTTGAAGGATCCATTGGCAACAAAGGTAAAGGTGGAGCCCTGGCTGCGGATATCGATGTAGATACTGTGGGAGGTGAAGGCTGGGGAGAGGATGCCGAGCTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGAGAAAACTTTGGAGACGAGGTGGCAGGCAAAGGGCAAGAAGAGGGTGGTGGATGGGATGTGGAAGAGGATCTTGACCTTCCCCCTGAACTGGATGTTCCCTCTGGCCCGTCTGGCACAGCTGAAGATGGATTCTTTGTGCCTCCAACTAAAGGCAACAGTCCATCGCAGACATGGTGTAATAACTCCCAGCTTCCC
  5   1   2       bld In62                            IMAGE:8954845.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCCGTTGGCCCTGCTCCAGGGGAACCACCAGATTGTGGAGATGTGCTACCAGCGCACCAAGAACTTTGACAAGCTCTCCTTCCTTTACCTCATCACCGGCAACCTGGAAAAACTGCGCAAGATGATGAAAATCGCGGAGATCCGTAAGGACATGAGCGGCCAGTACCAGAATGCACTGTTCCTGGGGGACGTAGACGAAAGAGTGCGGATACTAAAGAACTGTGGGCAGAAATCTCTGGCCTACCTGACAGCCGCCACCCACGGAATCAACGATGAAGAAGAGGGCTTGAGGGAGACTTTCGACCCAGAAAAAGAAATAATTCCAGAGGTTGACCCTGATGCTAAGCTGCTGATGCCCCCACCCCCCATCATGCCTCTGGACACCAACTGGCCTCTGTTGACCATGTCTAAGGGCTTCTTTGAAGGATCCATTGGCAACAAAGGTAAAGGTGGAGCCCTGGCTGCGGATATCGATGTAGATACTGTGGGAGGTGAAGGCTGGGGAGAAGATGCCGAGCTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGAGAAAACTTTGGAGACGAGGTGGCAGGCAAAGGGCAAGAAGAGGGCGGTGGATGGGATGTGGAAGAGGATCTTGACCTTCCCCCTGAACTGGATGTTCCCTCTGGCCCGTCTGGCACAGCTGAAGATGGATTCTTTGTGCCCCCAACTAAAGCAACAGTCCATCGCAGACATGGTGTAATAACTCCCAGCTCTGTGATCACGTCCTGTCGGCTCTTTGAACTGCATGCGTGCTCCATGACAGTGATTGTGACTTGGCCCGTCAGCAACACTTCCTCCATACCTTCTCTCCGGGGGTCGCCAG
  5   1   2       bld Te4       in                         CAAN5971.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGGCCCTGCTCCAGGGGAACCACCAGATTGTGGAGATGTGCTACCAGCGCACCAAGAACTTTGACAAGCTCTCCTTCCTTTACCTCATCACCGGCAACCTGGAAAAACTGCGCAAGATGATGAAAATCGCGGAGATCCGTAAGGACATGAGCGGCCAGTACCAGAATGCACTGTTCCTGGGGGACGTAGACGAAAGAGTGCGGATACTAAAGAACTGTGGGCAGAAATCTCTGGCCTACCTGACAGCCGCCACCCACGGAATCAACGATGAAGAAGAGGGCTTGAGGGAGACTTTCGACCCAGAAAAAGAAATAATTCCAGAGGTTGACCCTGATGCTAAGCTGCTGATGCCCCCACCCCCCATCATGCCTCTGGACACCAACTGGCCTCTGTTGACCATGTCTAAGGGCTTCTTTGAAGGATCCATTGGCAACAAAGGTAAAGGTGGAGCCCTGGCTGCGGATATCGATGTAGATACTGTGGGAGGTGAAGGCTGGGGAGAAGATGCCGAGCTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGAGAAAACTTTGGAGACGAGGTGGCAGGCAAAGGGCAAGAAGAGGGCGGTGGATGGGATGTGGAAGAGGATCTTGACCTTCCCCCTGAACTGGATGTTCCCTCTGGCCCGTCTGGCACAGCTGAAGATGGATTCTTTGTGCCCCCAACTAAAGGCAACAGTCCATCGCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACGTCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAA
  5   1   2       bld Te4       in                         CAAN6876.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGATTGTGGAGATGTGCTACCAGCGCACCAAGAACTTTGACAAGCTCTCCTTCCTTTACCTCATCACCGGCAACCTGGAAAAACTGCGCAAGATGATGAAAATCGCGGAGATCCGTAAGGACATGAGCGGCCAGTACCAGAATGCACTGTTCCTGGGGGACGTAGACGAAAGAGTGCGGATACTAAAGAACTGTGGGCAGAAATCTCTGGCCTACCTGACAGCCGCCACCCACGGAATCAACGATGAAGAAGAGGGCTTGAGGGAGACTTTCGACCCAGAAAAAGAAATAATTCCAGAGGTTGACCCTGATGCTAAGCTGCTGATGCCCCCACCCCCCATCATGCCTCTGGACACCAACTGGCCTCTGTTGACCATGTCTAAGGGCTTCTTTGAAGGATCCATTGGCAACAAAGGTAAAGGTGGAGCCCTGGCTGCGGATATCGATGTAGATACTGTGGGAGGTGAAGGCTGGGGAGAAGATGCCGAGCTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGAGAAAACTTTGGAGACGAGGTGGCAGGCAAAGGGCAAGAAGAGGGCGGTGGATGGGATGTGGAAGAGGATCTTGACCTTCCCCCTGAACTGGATGTTCCCTCTGGCCCGTCTGGCACAGCTGAAGATGGATTCTTTGTGCCCCCAACTAAAGGCAACAGTCCATCGCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACGTCCTGGCCGGCTCCTTTGANACTGCAATGCGGTTGCTCCATGA
  5   1   2       bld AbdN                               IMAGE:7023630                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAACTTTGACAAGCTCTCCTTCCTTTACCTCATCACCGGCAACCTGGAAAAACTGCGCAAGATGATGAAGATCGCGGAGATCCGTAAGGACATGAGCGGCCAGTACCAGAATGCACTGTTCCTGGGGGACGTAGACGAAAGAGTGCGGATACTGAAGAACTGTGGGCAGAAATCTCTGGCCTACCTGACAGCCGCCACCCACGGAATCAACGATGAAGAAGAGGGCTTGAGGGAGACTTTCGACCCAGAAAAAGAAATAATTCCAGAGGTTGACCCTGATGCTAAGCTGCTGATGCCCCCACCCCCCATCATGCCTCTGGACACCAACTGGCCTCTGTTGACCATGTCTAAGGGCTTCTTTGAAGGATCCATTGGCAACAAAGGTAAAGGTGGAGCCCTGGCTGCGGATATCGATGTAGATACTGTGGGAGGTGAAGGCTGGGGAGAAGATGCCGAGCTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGAGAAAACTTTGGAGACGAGGTGGCAGGCAAAGGGCAAGAAGAGGGCGGTGGATGGGATGTGGAAGAGGATCTTGACCTTCCCCCTGAACTGGATGTTCCCTCTGGCCCGTCTGGCACAGCTGAAGATGGATTCTTTGTGCCCCCAACTAAAGGCAACAGTCCATCGCAGACATGGTGTAATAACTCCCAGCTTTCTGTTGATCACGTCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTTGGAGTGGTGGACTTTGGCCCCGTTCAAGCAACACTTTCCTCCATACCTTTCCTCCCGGGGTCGCAGCACCCTACCAGGCCCTGCCAAGGTCTCCCATCCATGTATTGGCTACCCTTCGCGCAATTGG
  5   1   2       bld Spl2      in                        CBSS2293.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCGGCAACCTGGAAAAACTGCGCAAGATGATGAAAATCGCGGAGATCCGTAAGGACATGAGCGGCCAGTACCAGAATGCACTGTTCCTGGGGGACGTAGACGAAAGAGTGCGGATACTAAAGAACTGTGGGCAGAAATCTCTGGCCTACCTGACAGCCGCCACCCACGGAATCAACGATGAAGAAGAGGGCTTGAGGGAGACTTTCGACCCAGAAAAAGAAATAATTCCAGAGGTTGACCCTGATGCTAAGCTGCTGATGCCCCCACCCCCCATCATGCCTCTGGACACCAACTGGCCTCTGTTGACCATGTCTAAGGGCTTCTTTGAAGGATCCATTGGCAACAAAGGTAAAGGTGGAGCCCTGGCTGCGGATATCGATGTAGATACTGTGGGAGGTGAAGGCTGGGGAGAAGATGCCGAGCTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGAGAAAACTTTGGAGACGAGGTGGCAGGCAAAGGGCAAGAAGAGGGCGGTGGATGGGATGTGGAAGAGGATCTTGACCTTCCCCCTGAACTGGATGTTCCCTCTGGCCCGTCTGGCACAGCTGAAGATGGATTCTTTGTGCCCCCAACTAAAGGCAACAGTCCATCGCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACGTCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTGGAGTGGTGGACTTTGGCCCGTTCAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACCTACC
  5   1   2       bld Egg       in                  TEgg074p24.p1kSP6w                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCGGGGGGAAAAACTGCGCAAGATGATGAAAATCGCGGAGATCCGTAAGGACATGAGCGGCCAGTACCAGAATGCACTGTTCCTGGGGGACGTAGACGAAAGAGTGCGGATACTAAAGAACTGTGGGCAGAAATCTCTGGCCTACCTGACAGCCGCCACCCACGGAATCAACGATGAAGAAGAGGGCTTGAGGGAGACTTTCGACCCAGAAAAAGAAATAATTCCAGAGGTTGACCCTGATGCTAAGCTGCTGATGCCCCCACCCCCCATCATGCCTCTGGACACCAACTGGCCTCTGTTGACCATGTCTAAGGGCTTCTTTGAAGGATCCATTGGCAACAAAGGTAAAGGTGGAGCCCTGGCTGCGGATATCGATGTAGATACTGTGGGAGGTGAAGGCTGGGGAGAAGATGCCGAGCTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGAGAAAACTTTGGAGACGAGGTGGCAGGCAAAGGGCAAGAAGAGGGCGGTGGATGGGATGTGGAAGAGGATCTTGACCTTCCCCCTGAACTGGATGTTCCCTCTGGCCCGTCTGGCACAGCTGAAGATGGATTCTTTGTGCCCCCAACTAAAGGCAACAGTCCATCGCAGACATGGTGTAATAACTCCCAGCTTCCT
  5   1   2       bld Te5       in                        CAAO11068.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GACATGAGCGGCCAGTACCAGAATGCACTGTTCCTGGGGGACGTAGACGAAAGAGTGCGGATACTAAAGAACTGTGGGCAGAAATCTCTGGCCTACCTGACAGCCGCCACCCACGGAATCAACGATGAAGAAGAGGGCTTGAGGGAGACTTTCGACCCAGAAAAAGAAATAATTCCAGAGGTTGACCCTGATGCTAAGCTGCTGATGCCCCCACCCCCCATCATGCCTCTGGACACCAACTGGCCTCTGTTGACCATGTCTAAGGGCTTCTTTGAAGGATCCATTGGCAACAAAGGTAAAGGTGGAGCCCTGGCTGCGGATATCGATGTAGATACTGTGGGAGGTGAAGGCTGGGGAGAAGATGCCGAGCTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGAGAAAACTTTGGAGACGAGGTGGCAGGCAAAGGGCAAGAAGAGGGCGGTGGATGGGATGTGGAAGAGGATCTTGACCTTCCCCCTGAACTGGATGTTCCCTCTGGCCCGTCTGGCACAGCTGAAGATGGATTCTTTGTGCCCCCAACTAAAGGCAACAGTCCATCGCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACGTCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTGGAGTGGTGGACTTTGGCCCGTTCAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACCTACCAGGCCCTGCCAGGTCTCCCATCCATGTATGGCTACCCTCAGCGCAATTGGAAGGACGCAGGGGTTAAGAATGGGCTTCCTGCTGTCGGCCTGAAGCTCAACGACTTGATACAGCGCCCTCAGCTGTGCTACCAGCT
  5   1   2       bld Te4       in                         CAAN6554.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCAGAATGCACTGTTCCTGGGGGACGTAGACGAAAGAGTGCGGATACTAAAGAACTGTGGGCAGAAATCTCTGGCCTACCTGACAGCCGCCACCCACGGAATCAACGATGAAGAAGAGGGCTTGAGGGAGACTTTCGACCCAGAAAAAGAAATAATTCCAGAGGTTGACCCTGATGCTAAGCTGCTGATGCCCCCACCCCCCATCATGCCTCTGGACACCAACTGGCCTCTGTTGACCATGTCTAAGGGCTTCTTTGAAGGATCCATTGGCAACAAAGGTAAAGGTGGAGCCCTGGCTGCGGATATCGATGTAGATACTGTGGGAGGTGAAGGCTGGGGAGAAGATGCCGAGCTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGAGAAAACTTTGGAGACGAGGTGGCAGGCAAAGGGCAAGAAGAGGGCGGTGGATGGGATGTGGAAGAGGATCTTGACCTTCCCCCTGAACTGGATGTTCCCTCTGGCCCGTCTGGCACAGCTGAAGATGGATTCTTTGTGCCCCCAACTAAAGGCAACAGTCCATCGCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACGTCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTGGAGTGGTGGACTTTGGCCCGTTCAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACCTACCAGGCCCTGCCAGGTCTCCCATCCATGTATGGCTACCCTCAGCGCAATTGGAAGGACGCAGGGTTAAAGAATGGGCTTCCTGCTGTCGGCCTGAAGCTCAACGACTTGATACAGCGCCTTCAGCTGTGCTACCAGCTCACCACATCCGGCAAGTT
  5   1   2       bld Tad5      in                          XZT6781.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGGGGGAGTAGACAAGAGTGCGGATACTAAAGAACTGTGGGCAGAAATCTCTGGCCTACCTGACAGCCGCCACCCACGGAATCAACGATGAAGAAGAGGGCTTGAGGGAGACTTTCGACCCAGAAAAAGAAATAATTCCAGAGGTTGACCCTGATGCTAAGCTGCTGATGCCCCCACCCCCCATCATGCCTCTGGACACCAACTGGCCTCTGTTGACCATGTCTAAGGGCTTCTTTGAAGGATCCATTGGCAACAAAGGTAAAGGTGGAGCCCTGGCTGCGGATATCGATGTAGATACTGTGGGAGGTGAAGGCTGGGGAGAAGATGCCGAGCTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGAGAAAACTTTGGAGACGAGGTGGCAGGCAAAGGGCAAGAAGAGGGCGGTGGATGGGATGTGGAAGAGGATCTTGACCTTCCCCCTGAACTGGATGTTCCCTCTGGCCCGTCTGGCACAGCTGAAGATGGATTCTTTGTGCCCCCAACTAAAGGCAACAGTCCATCGCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACGTCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTGGAGTGGTGGACTTTGGCCCGTTCAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACCTACCAGGCCCTGCCAGGTCTCCCATCCATGTATGGCTACCCTCAGCGCAATTGGAAGGACGCAGGGTTAAAGAATGGGCTTCCTGCTGTCGGCCTGAAACTCAACGACTTGATACAGCGCCTTCAGCTGTGCTACCAGCTCACCACATCCGGC
  5   1   2       bld Te1       in                         CBWN3014.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAAAGAACTGTGGGCAGAAATCTCTGGCCTACCTGACAGCCGCCACCCACGGAATCAACGATGAAGAAGAGGGCTTGAGGGAGACTTTCGACCCAGAAAAAGAAATAATTCCAGAGGTTGACCCTGATGCTAAGCTGCTGATGCCCCCACCCCCCATCATGCCTCTGGACACCAACTGGCCTCTGTTGACCATGTCTAAGGGCTTCTTTGAAGGATCCATTGGCAACAAAGGTAAAGGTGGAGCCCTGGCTGCGGATATCGATGTAGATACTGTGGGAGGTGAAGGCTGGGGAGAAGATGCCGAGCTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGAGAAAACTTTGGAGACGAGGTGGCAGGCAAAGGGCAAGAAGAGGGCGGTGGATGGGATGTGGAAGAGGATCTTGACCTTCCCCCTGAACTGGATGTTCCCTCTGGCCCGTCTGGCACAGCTGAAGATGGATTCTTTGTGCCCCCAACTAAAGGCAACAGTCCATCGCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACGTCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTGGAGTGGTGGACTTTGGCCCGTTCAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACCTACCAGGCCCTGCCAGGTCTCCCATCCATGTATGGCTACCCTC
  5   1   2       bld HeRe      in                     EC2CAA10BE03.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAACGATGAAGAAGAGGGCTTGAGGGAGACTTTCGACCCAGAAAAAGAAATAATTCCAGAGGTTGACCCTGATGCTAAGCTGCTGATGCCCCCACCCCCCATCATGCCTCTGGACACCAACTGGCCTCTGTTGACCATGTCTAAGGGCTTCTTTGAAGGATCCATTGGCAACAAAGGTAAAGGTGGAGCCCTGGCTGCGGATATCGATGTAGATACTGTGGGAGGTGAAGGCTGGGGAGAGGATGCCGAGCTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGAGAAAACTTTGGAGACGAGGTGGCAGGCAAAGGGCAAGAAGAGGGTGGTGGATGGGATGTGGAAGAGGATCTTGACCTTCCCCCTGAACTGGATGTTCCCTCTGGCCCGTCTGGCACAGCTGAAGATGGATTCTTTGTGCCTCCAACTAAAGGCAACAGTCCATCGCAGACATGGTGTAATAACTCCCAGCTTCCCGTTGATCACGTCCTGGCCGGCTCCTTTGAAACTGCAATGCGATTGCTCCATGACCAAGTTGGAGTGGTGGACTTTGGCCCGTTCAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACCTACCAGGCCCTGCCAGGTCTCCCATCCATGTATGGCTACCCTCAACGCAATTGGAAAGACGCTGG
  5   1   2       bld Limb      in                        CBSU8449.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGAGGTTGACCCTGATGCTAAGCTGCTGATGCCCCCACCCCCCATCATGCCTCTGGACACCAACTGGCCTCTGTTGACCATGTCTAAGGGCTTCTTTGAAGGATCCATTGGCAACAAAGGTAAAGGTGGAGCCCTGGCTGCGGATATCGATGTAGATACTGTGGGAGGTGAAGGCTGGGGAGAAGATGCCGAGCTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGAGAAAACTTTGGAGACGAGGTGGCAGGCAAAGGGCAAGAAGAGGGCGGTGGATGGGATGTGGAAGAGGATCTTGACCTTCCCCCTGAACTGGATGTTCCCTCTGGCCCGTCTGGCACAGCTGAAGATGGATTCTTTGTGCCCCCAACTAAAGGCAACAGTCCATCGCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACGTCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTGGAGTGGTGGACTTTGGCCCGTTCAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACCTACCAGGCCCTGCCAGGTCTCCCATCCATGTATGGCTACCCTCAGCGCAATTGGAAGGACGCAGGGTTAAAGAATGGGCTTCCTGCTGTCGGCCTGAAGCTCAACGACTTGATACAGCGCCTTCAGCTGTGCTACCAGCTCACCACATCCGGCAAGTTCGAGGAAGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGAACAATAAGCAAGAGATTTCCGAGGCCCATCAGC
  5   1   2       bld Spl2      in                        CBSS8965.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCTGATGCTAAGCTGCTGATGCCCCCACCCCCCATCATGCCTCTGGACACCAACTGGCCTCTGTTGACCATGTCTAAGGGCTTCTTTGAAGGATCCATTGGCAACAAAGGTAAAGGTGGAGCCCTGGCTGCGGATATCGATGTAGATACTGTGGGAGGTGAAGGCTGGGGAGAAGATGCCGAGCTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGAGAAAACTTTGGAGACGAGGTGGCAGGCAAAGGGCAAGAAGAGGGCGGTGGATGGGATGTGGAAGAGGATCTTGACCTTCCCCCTGAACTGGATGTTCCCTCTGGCCCGTCTGGCACAGCTGAAGATGGATTCTTTGTGCCCCCAACTAAAGGCAACAGTCCATCGCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACGTCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTGGAGTGGTGGACTTTGGCCCGTTCAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACCTACCAGGCCCTGCCAGGTCTCCCATCCATGTATGGCTACCCTCAGCGCAATTGGAAGGACGCAGGGTTAAAGAATGGGCTTCCTGCTGTCGGCCTGAAGCTCAACGACTTGATACAGCGCCTTCAGCTGTGCTACCAGCTCACCACATCCGG
  5   1   2       bld In60                            IMAGE:8950863.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGGACCCAATCTTAAAATCCAATCCTTTTAATAAAAACGTCCCCAACTGGCCTCTGTTGACCATGTCTAAGGGCTTCTTTGAAGGATCCATTGGCAACAAAGGTAAAGGTGGAGCCCTGGCTGCGGATATCGATGTAGATACTGTGGGAGGTGAAGGCTGGGGAGAAGATGCCGAGCTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGAGAAAACTTTGGAGACGAGGTGGCAGGCAAAGGGCAAGAAGAGGGCGGTGGATGGGATGTGGAAGAGGATCTTGACCTTCCCCCTGAACTGGATGTTCCCTCTGGCCCGTCTGGCACAGCTGAAGATGGATTCTTTGTGCCCCCAACTAAAGGCAACAGTCCATCGCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACGTCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTGGAGTGGTGGACTTTGGCCCGTTCAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACCTACCAGGCCCTGCCAGGTCTCCCATCCATGTATGGCTACCCTCAGCGCAATTGGAAAGACGCAGGTTAAAGAATGGGCTTCCTGCTGTCGGCCTGAAGCTCAACGACTTGATACAGCGCCTTCAGCTGTGCTACCAGCTCACACATCCGGCAAGTTCGAGGAGCTGTGAGAAGTTCCGCCTGATCTTCTCAGTGTGCCGCTGCTGTCGTGACAATAGCAGAAGATTTCGAGCCAGCAGCTGATCACTATTTGTCTGATTACTTGGGTCTGACTTGGAATGATCGCAGAACTCAAAGACCTTGGGAACATCAAACCATTGGATGCGCCATTCAACTCACCTTGACCGTGGCCGATGATATCCGGGTCA
  5   1   2       bld Neu                            TNeu021o17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGCTGTGCCCCCACCCCCCACATGCCTCTGGACACCAACTGGCCTCTGTTGACCATGTCTAAGGGCTTCTTTGAAGGATCCATTGGCAACAAAGGTAAAGGTGGAGCCCTGGCTGCGGATATCGATGTAGATACTGTGGGAGGTGAAGGCTGGGGAGAAGATGCCGAGCTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGAGAAAACTTTGGAGACGAGGTGGCAGGCAAAGGGCAAGAAGAGGGCGGTGGATGGGATGTGGAAGAGGATCTTGACCTTCCCCCTGAACTGGATGTTCCCTCTGGCCCGTCTGGCACAGCTGAAGATGGATTCTTTGTGCCCCCAACTAAAGGCAACAGTCCATCGCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACGTCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTGGAGTGGTGGACTTTGGCCCGTTCAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACCTACCAGGCCCTGCCAGGTCTCCCATCCATGTATGGCTACCCTCAGCGCAATTGGAAGGACGCAGGGTTAAAGAATGGGCTTCCTGCTGTCGGCCTGAAGCTCAACGACTTGATACAGCGCCTTCAGCTGTGCTACCAGCTCACCACATCCGGCAAGTTC
  5   1   2       bld Eye       in                         CCAX6377.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACCAACTGGCCTCTGTTGACCATGTCTAAGGGCTTCTTTGAAGGATCCATTGGCAACAAAGGTAAAGGTGGAGCCCTGGCTGCGGATATCGATGTAGATACTGTGGGAGGTGAAGGCTGGGGAGAAGATGCCGAGCTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGAGAAAACTTTGGAGACGAGGTGGCAGGCAAAGGGCAAGAAGAGGGCGGTGGATGGGATGTGGAAGAGGATCTTGACCTTCCCCCTGAACTGGATGTTCCCTCTGGCCCGTCTGGCACAGCTGAAGATGGATTCTTTGTGCCCCCAACTAAAGGCAACAGTCCATCGCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACGTCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTGGAGTGGTGGACTTTGGCCCGTTCAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACCTACCAGGCCCTGCCAGGTCTCCCATCCATGTATGGCTACCCTCAGCGCAATTGGAAGGACGCAGGGTTAAAGAATGGGCTTCCTGCTGTCGGCCTGAAGCTCAACGACTTGATACAGCGCCTACAGCTGTGCTACCAGCTCACCACATCTGGCAAGTTTGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGA
  5   1   2       bld Tad5      in                         XZT30879.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTGACCATGTCTAAGGGCTTCTTTGAAGGATCCATTGGCAACAAAGGTAAAGGTGGAGCCCTGGCTGCGGATATCGATGTAGATACTGTGGGAGGTGAAGGCTGGGGAGAAGATGCCGAGCTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGAGAAAACTTTGGAGACGAGGTGGCAGGCAAAGGGCAAGAAGAGGGCGGTGGATGGGATGTGGAAGAGGATCTTGACCTTCCCCCTGAACTGGATGTTCCCTCTGGCCCGTCTGGCACAGCTGAAGATGGATTCTTTGTGCCCCCAACTAAAGGCAACAGTCCATCGCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACGTCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTGGAGTGGTGGACTTTGGCCCGTTCAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACCTACCAGGCCCTGCCAGGTCTCCCATCCATGTATGGCTACCCTCAGCGCAATTGGAAGGACGCAGGGTTAAAGAATGGGCTTCCTGCTGTCGGCCTGAAGCTCAACGACTTGATACAGCGCCTTCAGCTGTGCTACCAGCTCACCACATCCGGCAAGTTCGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGNCACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCA
  5   1   2       bld Ski1      in                         CABJ7609.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CATTGGCAACAAAGGTAAAGGTGGAGCCCTGGCTGCGGATATCGATGTAGATACTGTGGGAGGTGAAGGCTGGGGAGAAGATGCCGAGCTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGAGAAAACTTTGGAGACGAGGTGGCAGGCAAAGGGCAAGAAGAGGGCGGTGGATGGGATGTGGAAGAGGATCTTGACCTTCCCCCTGAACTGGATGTTCCCTCTGGCCCGTCTGGCACAGCTGAAGATGGATTCTTTGTGCCCCCAACTAAAGGCAACAGTCCATCGCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACGTCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTGGAGTGGTGGACTTTGGCCCGTTCAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACCTACCAGGCCCTGCCAGGTCTCCCATCCATGTATGGCTACCCTCAGCGCAATTGGAAGGACGCAGGGTTAAAGAATGGGCTTCCTGCTGTCGGCCTGAAGCTCAACGACTTGATACAGCGCCTACAGCTGTGCTACCAGCTCACCACATCTGGCAAGTTTGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAAC
  5   1   2       bld Te5       in                         CAAO3705.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCCGCAAAGGTAAAGGTGGAGCCCTGGCTGCGGATATCGATGTAGATACTGTGGGAGGTGAAGGCTGGGGAGAAGATGCCGAGCTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGAGAAAACTTTGGAGACGAGGTGGCAGGCAAAGGGCAAGAAGAGGGCGGTGGATGGGATGTGGAAGAGGATCTTGACCTTCCCCCTGAACTGGATGTTCCCTCTGGCCCGTCTGGCACAGCTGAAGATGGATTCTTTGTGCCCCCAACTAAAGGCAACAGTCCATCGCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACGTCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTGGAGTGGTGGACTTTGGCCCGTTCAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACCTACCAGGCCCTGCCAGGTCTCCCATCCATGTATGGCTACCCTCAGCGCAATTGGAAGGACGCAGGGTTAAAGAATGGGCTTCCTGCTGTCGGCCTGAAGCTCAACGACTTGATACAGCGCCTACAGCTGTGCTACCAGCTCACCACATCTGGCAAGTTTGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGAT
  5   1   2       bld Ski1      in                         CABJ4233.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAACAAAGGTAAAGGTGGAGCCCTGGCTGCGGATATCGATGTAGATACTGTGGGAGGTGAAGGCTGGGGAGAAGATGCCGAGCTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGAGAAAACTTTGGAGACGAGGTGGCAGGCAAAGGGCAAGAAGAGGGCGGTGGATGGGATGTGGAAGAGGATCTTGACCTTCCCCCTGAACTGGATGTTCCCTCTGGCCCGTCTGGCACAGCTGAAGATGGATTCTTTGTGCCCCCAACTAAAGGCAACAGTCCATCGCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACGTCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTGGAGTGGTGGACTTTGGCCCGTTCAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACCTACCAGGCCCTGCCAGGTCTCCCATCCATGTATGGCTACCCTCAGCGCAATTGGAAGGACGCAGGGTTAAAGAATGGGCTTCCTGCTGTCGGCCTGAAGCTCAACGACTTGATACAGCGCCTACAGCTGTGCTACCAGCTCACCACATCTGGCAAGTTTGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAAC
  5   1   2       bld Gas7                                 XZG12066.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGGTAAGGTGGAGCCCTGGCTGCGGATATCGATGTAGATACTGTGGGAGGTGAAGGCTGGGGAGAAGATGCCGAGCTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGAGAAAACTTTGGAGACGAGGTGGCAGGCAAAGGGCAAGAAGAGGGCGGTGGATGGGATGTGGAAGAGGATCTTGACCTTCCCCCTGAACTGGATGTTCCCTCTGGCCCGTCTGGCACAGCTGAAGATGGATTCTTTGTGCCCCCAACTAAAGGCAACAGTCCATCGCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACGTCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTGGAGTGGTGGACTTTGGCCCGTTCAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACCTACCAGGCCCTGCCAGGTCTCCCATCCATGTATGGCTACCCTCAGCGCAATTGGAAGGACGCAGGGTTAAAGAATGGGCTTCCTGCTGTCGGCCTGAAGCTCAACGACTTGATACAGCGCCTACAGCTGTGCTACCAGCTCACCACATCTGGCAAGTTTGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAG
  5   1   2       bld Tad5      in                         XZT48702.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGTAAAGGTGGAGCCCTGGCTGCGGATATCGATGTAGATACTGTGGGAGGTGAAGGCTGGGGAGAAGATGCCGAGCTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGAGAAAACTTTGGAGACGAGGTGGCAGGCAAAGGGCAAGAAGAGGGCGGTGGATGGGATGTGGAAGAGGATCTTGACCTTCCCCCTGAACTGGATGTTCCCTCTGGCCCGTCTGGCACAGCTGAAGATGGATTCTTTGTGCCCCCAACTAAAGGCAACAGTCCATCGCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACGTCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTGGAGTGGTGGACTTTGGCCCGTTCAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACCTACCAGGCCCTGCCAGGTCTCCCATCCATGTATGGCTACCCTCAGCGCAATTGGAAGGACGCAGGGTTAAAGAATGGGCTTCCTGCTGTCGGCCTGAAGCTCAACGACTTGATACAGCGCCTTCAGCTGTGCTACCAGCTCACCACATCCGGCAAGTTCGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAAC
  5   1   2       bld Neu                            TNeu003e08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GATGTAGATACTGTGGGAGGTGAAGGCTGGGGAGAANTGCCGAGCTTCAGCTGGATGAAGATGGTTTTGTGGATGCTGGAGAAAACTTTGGAGACGAGGTGGCAGGCAAAGGGCAAGAAGAGGGCGGTGGATGGGATGTGGAAGAGGATCTTGACCTTCCCCCTGAACTGGATGTTCCCTCTGGCCCGTCTGGCACAGCTGAAGATGGATTCTTTGTGCCCCCAACTAAAGGCAACAGTCCATCGCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACGTCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTGGAGTGGTGGACTTTGGCCCGTTCAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACCTACCAGGCCCTGCCAGGTCTCCCATCCATGTATGGCTACCCTCAGCGCAATTGGAAGGACGCAGGGTTAAAGAATGGGCTTCCTGCTGTCGGCCTGAAGCTCAACGACTTGATACAGCGCCTTCAGCTGTGCTACCAGCTCACCACATCCGGCAAGTTCGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGT
  5   1   2       bld Brn2                                CAAJ22977.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCTGGATGAAGATGGTTTTGTGGATGCTGGAGAAAACTTTGGAGACGAGGTGGCAGGCAAAGGGCAAGAAGAGGGCGGTGGATGGGATGTGGAAGAGGATCTTGACCTTCCCCCTGAACTGGATGTTCCCTCTGGCCCGTCTGGCACAGCTGAAGATGGATTCTTTGTGCCCCCAACTAAAGGCAACAGTCCATCGCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACGTCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTGGAGTGGTGGACTTTGGCCCGTTCAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACCTACCAGGCCCTGCCAGGTCTCCCATCCATGTATGGCTACCCTCAGCGCAATTGGAAGGACGCAGGGTTAAAGAATGGGCTTCCTGCTGTCGGCCTGAAGCTCAACGACTTGATACAGCGCCTTCAGCTGTGCTACCAGCTCACCACATCCGGCAAGTTCGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGANACTTCCAAAAGACACTTTGGAGCA
  5   1   2       bld Tad5      in                         XZT56231.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTTTTGTGGATGCTGGAGAAAACTTTGGAGACGAGGTGGCAGGCAAAGGGCAAGAAGAGGGCGGTGGATGGGATGTGGAAGAGGATCTTGACCTTCCCCCTGAACTGGATGTTCCCTCTGGCCCGTCTGGCACAGCTGAAGATGGATTCTTTGTGCCCCCAACTAAAGGCAACAGTCCATCGCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACGTCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTGGAGTGGTGGACTTTGGCCCGTTCAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACCTACCAGGCCCTGCCAGGTCTCCCATCCATGTATGGCTACCCTCAGCGCAATTGGAAGGACGCAGGGTTAAAGAATGGGCTTCCTGCTGTCGGCCTGAAGCTCAACGACTTGATACAGCGCCTTCAGCTGTGCTACCAGCTCACCACATCCGGCAAGTTCGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTG
  5   1   2       bld Te5       in                        CAAO11766.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACGAGGTGGCAGGCAAAGGGCAAGAAGAGGGCGGTGGATGGGATGTGGAAGAGGATCTTGACCTTCCCCCTGAACTGGATGTTCCCTCTGGCCCGTCTGGCACAGCTGAAGATGGATTCTTTGTGCCCCCAACTAAAGGCAACAGTCCATCGCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACGTCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTGGAGTGGTGGACTTTGGCCCGTTCAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACCTACCAGGCCCTGCCAGGTCTCCCATCCATGTATGGCTACCCTCAGCGCAATTGGAAGGACGCAGGGTTAAAGAATGGGCTTCCTGCTGTCGGCCTGAAGCTCAACGACTTGATACAGCGCCTTCAGCTGTGCTACCAGCTCACCACATCCGGCAAGTTCGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGC
  5   1   2       bld Te5       in                         CAAO8516.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAAAGGGCAAGAAGAGGGCGGTGGATGGGATGTGGAAGAGGATCTTGACCTTCCCCCTGAACTGGATGTTCCCTCTGGCCCGTCTGGCACAGCTGAAGATGGATTCTTTGTGCCCCCAACTAAAGGCAACAGTCCATCGCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACGTCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTGGAGTGGTGGACTTTGGCCCGTTCAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACCTACCAGGCCCTGCCAGGTCTCCCATCCATGTATGGCTACCCTCAGCGCAATTGGAAGGACGCAGGGTTAAAGAATGGGCTTCCTGCTGTCGGCCTGAAGCTCAACGACTTGATACAGCGCCTTCAGCTGTGCTACCAGCTCACCACATCCGGCAAGTTCGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAATATTGTCCGCTTGTG
  5   1   2       bld Gas8      in                          st56m17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGGGCAAGAAGAGGGCGGTGGATGGGATGTGGAAGAGGATCTTGACCTTCCCCCTGAACTGGATGTTCCCTCTGGCCCGTCTGGCACAGCTGAAGATGGATTCTTTGTGCCCCCAACTAAAGGCAACAGTCCATCGCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACGTCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTGGAGTGGTGGACTTTGGCCCGTTCAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACCTACCAGGCCCTGCCAGGTCTCCCATCCATGTATGGCTACCCTCAGCGCAATTGGAAGGACGCAGGGTTAAAGAATGGGCTTCCTGCTGTCGGCCTGAAGCTCAACGACTTGATACAGCGCCTACAGCTGTGCTACCAGCTCACCACATCTGGCAAGTTTGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGA
  3  -1   2       chi Te3                                  CAAM7221.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGTTAATCTTTATTTGGGCTTGTTTCTTGAGAGAACAGAGCAGTTAGTTTATTCCCACAGCTAATACACACTGTGACAAGTTTCTAGGGCAGGAAAAAGAGAAAAGGGTTAAATCATGCAACACAAGGCGCATTCTACAATAACTCCCAGCTTCCTGTTGATCACGTCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTGGAGTGGTGGACTTTGGCCCGTTCAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACCTACCAGGCCCTGCCAGGTCTCCCATCCATGTATGGCTACCCTCAGCGCAATTGGAAGGACGCAGGGTTAAAGAATGGGCTTCCTGCTGTCGGCCTGAAGCTCAACGACTTGATACAGCGCCTTCAGCTGTGCTACCAGCTCACCACATCCGGCAAGTTCGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAACAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCAGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTG
  5   1   2       bld Int1      in                         CAAP1631.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGAGGCTCTGGCCCGTCTGGCACAGCTGAAGATGGATTCTTTGTGCCCCCAACTAAAGGCAACAGTCCATCGCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACGTCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTGGAGTGGTGGACTTTGGCCCGTTCAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACCTACCAGGCCCTGCCAGGTCTCCCATCCATGTATGGCTACCCTCAGCGCAATTGGAAGGACGCAGGGTTAAAGAATGGGCTTCCTGCTGTCGGCCTGAAGCTCAACGACTTGATACAGCGCCTACAGCTGTGCTACCAGCTCACCACATCTGGCAAGTTTGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCA
  5   1   2       bld Te4       in                         CAAN9309.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGGACGCGTGGGTCTTTGTGCCCCCAACTAAAGGCAACAGTCCATCGCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACGTCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTGGAGTGGTGGACTTTGGCCCGTTCAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACCTACCAGGCCCTGCCAGGTCTCCCATCCATGTATGGCTACCCTCAGCGCAATTGGAAGGACGCAGGGTTAAAGAATGGGCTTCCTGCTGTCGGCCTGAAGCTCAACGACTTGATACAGCGCCTTCAGCTGTGCTACCAGCTCACCACATCCGGCAAGTTCGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAAACTGACGGACACCTATCAGCTCAACTATGACATGCACAAT
  5   1   2       bld Te4       in                         CAAN1934.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTTTGTGCCCCCAACTAAAGGCAACAGTCCATCGCAGACATGGTGTAATAACTCCCAGCTTCCTGTTGATCACGTCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTGGAGTGGTGGACTTTGGCCCGTTCAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACCTACCAGGCCCTGCCAGGTCTCCCATCCATGTATGGCTACCCTCAGCGCAATTGGAAGGACGCAGGGTTAAAGAATGGGCTTCCTGCTGTCGGCCTGAAGCTCAACGACTTGATACAGCGCCTTCAGCTGTGCTACCAGCTCACCACATCCGGCAAGTTCGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAAATCCTTCGACATTTGCGCTGCCTCTTACGGCCCATCTACAGAGGGAAACCCGTGNAGAAATGCCCCTTGAGCGGCG
  5   1   2       bld Sto1      in                         CABG4698.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCCCAGCTTCCTGTTGATCACGTCCTGGCCGGCTCCTTTGAAACTGCAATGCGGTTGCTCCATGACCAAGTTGGAGTGGTGGACTTTGGCCCGTTCAAGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACCTACCAGGCCCTGCCAGGTCTCCCATCCATGTATGGCTACCCTCAGCGCAATTGGAAGGACGCAGGGTTAAAGAATGGGCTTCCTGCTGTCGGCCTGAAGCTCAACGACTTGATACAGCGCCTACAGCTGTGCTACCAGCTCACCACATCTGGCAAGTTTGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCTCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGAC
  5   1   2       bld Gas       in                   TGas077m08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACGTCCCTTGGCCGGCTTCCTTTTGAAACTGCAATTGCGGTTGCTTCCATGACCAAGTTGGAGTGGTGGACTTTGGCCCGTTCAAGCAACACTTTCCTCCATACCTTCTTCCCGGGGTCGCAGCACCTACCAGGCCCTGCCAGGTCTCCCATCCATGTATGGCTACCCTCAGCGCAATTGGAAGGACGCAGGGTTAAAGAATGGGCTTCCTGCTGTCGGCCTGAAGCTCAACGACTTGATACAGCGCCTTCAGCTGTGCTACCAGCTCACCACATCCGGCAAGTTCGAGGAAGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGG
  5   1   2       bld Gas7      in                         XZG37179.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCAACACTTCCTCCATACCTTCTCCCGGGGTCGCAGCACCTACCAGGCCCTGCCAGGTCTCCCATCCATGTATGGCTACCCTCAGCGCAATTGGAAGGACGCAGGGTTAAAGAATGGGCTTCCTGCTGTCGGCCTGAAGCTCAACGACTTGATACAGCGCCTTCAGCTGTGCTACCAGCTCACCACATCCGGCAAGTTCGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCA
  5   1   2       bld Ski1      in                        CABJ10340.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCAATTGGAAGGACGCAGGGTTAAAGAATGGGCTTCCTGCTGTCGGCCTGAAGCTCAACGACTTGATACAGCGCCTACAGCTGTGCTACCAGCTCACCACATCTGGCAAGTTTGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAA
  5   1   2       bld Neu       in                   TNeu076n03.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGGACGCAGGGTTAAAGAATGGGCTTCCTGCTGTCGGCCTGAAGCTCAACGACTTGATACAGCGCCTTCAGCTGTGCTACCAGCTCACCACATCCGGCAAGTTCGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTAC
  5   1   2       bld Te3                                  CAAM8233.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGCAGGGTTAAAGAATGGGCTTCCTGCTGTCGGCCTGAAGCTCAACGACTTGATACAGCGCCTACAGCTGTGCTACCAGCTCACCACATCTGGCAAGTTTGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGANATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGT
  3   1   2       chi Int1      in                        CAAP13387.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGAACCGCCGTCAACTTTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGGTAAAAGAGCATTATAAATTCCTCGTACAAGTTTGCTCGGGGATCTCCTACTAGATCCAGCGGTAATCCTTGTCTCCTCGCTCTCCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTAAGTAACTTCCATCTAGAACCTCTTGACTGCTGGACTGATAGCTGTGTTGTAGAACAGACTGCTGTTGTAGTTAAACTGCATCTGGGAGGCTCCTTGTGGAACAGACCAGTACACGTCCTTTATAAAAATCAGCCTGGGCCCTGCCCTGCTGCCATGTTGGATCCATTACCCAAGTATCCTTGGGGCCCAAAGCGCAGTATAGTAAGAATTTACTTCTCTCTGGTATATCTAACAGGCCTGTAATGTCTTTCTACCTAGGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGGAAAAAAG
  5   1   2       bld Tad5      in                          XZT7423.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTAAGAATGGGCTTCCTGCTGTCGGCCTGAAGCTCAACGACTTGATACAGCGCCTTCAGCTGTGCTACCAGCTCACCACATCCGGCAAGTTCGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTANGAACTTGTCACAGTGTGTATTAGCTGTGGGGATAAACTAACTGCTCTGTTCTCTNNCAGAACAAGACCCAATAAAGATTAACGGA
  5   1   2       bld Gas7                                 XZG13728.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGAATGGGCTTCCTGCTGTCGGCCTGAAGCTCAACGACTTGATACAGCGCCTTCAGCTGTGCTACCAGCTCACCACATCCGGCAAGTTCGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACAGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGANATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAAAAACTTGTCACAGTGTG
  5   1   2       bld Te3                                 CAAM15506.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCGGCCTGAAGCTCAACGACTTGATACAGCGCCTTCAGCTGTGCTACCAGCTCACCACATCCGGCAAGTTCGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGNGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTNNCAGAAACAGACCAAATAAAGATTAACGGAAAANGGANAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Ova1      in                         CABE8890.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGAAGCTCAACGACTTGATACAGCGCCTACAGCTGTGCTACCAGCTCACCACATCTGGCAAGTTTGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGNGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCT
  5  -1   2       bld Lun1      in                        CABD10809.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGAAGCTCAACGACTTGATACAGCGCCTACAGCTGTGCTACCAGCTCACCACATCTGGCAAGTTTGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGAAA
  3   1   2       bld Sto1      in                         CABG4698.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGCTCAACGACTTGATACAGCGCCTACAGCTGTGCTACCAGCTCACCACATCTGCAAGTTGAGGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGGAAAAAA
  5   1   2       bld Thy1      in                        CBST5618.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTCAACGACTTGATACAGCGCCTTCAGCTGTGCTACCAGTTCACCACATCCGGCAAGTTCGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCT
  3   1   2       bld Te4       in                         CAAN5924.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTGCTACCAGCTCACCACATCCGCAAAGTTCGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGG
  3   1   2       bld Brn3      in                         CAAK6289.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACCAGCTCACCACATCCGGCAAGTTCGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGG
  3   1   2       bld Te4  5g3  in                         CAAN4557.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACCAGCTCACCACATCGGCAAAGTTCGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGGAAAAAAG
  3   1   2      seed Ski1      in                         CABJ4233.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCAGCTCACCACATCTGGCAAGTTTGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGGAAAAAAG
  3   1   2       bld Neu       in                    TNeu076n03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCAAGTTCGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCNAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAGAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCNCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTTTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATTTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAAC
  3   1   2       bld Abd0      in                       IMAGE:6999859                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCACTCTGGCATGTTGAAGAGGCTGTGAGAAGTCCGCNTGTCCTTCTCAGTGTGCAGCTGCTTGTCGGGACAATAAGCAAGAGATTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGCGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCGTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTAGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTGTCA
  3   1   2       bld Egg       in                    TEgg074p24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAAGTTCGAGGAAGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTTTGGTGCTCAGAACCGCCGTCAACCTCTTTTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATAGGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAGGGCCAAATAAAGATTANCGGGAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Te4       in                         CAAN5971.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAGTTCGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGGAAAAAAG
  3   1   2       bld Ski1      in                         CABJ7609.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGAGGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGGAAAA
  3   1   2       bld Te4       in                         CAAN6315.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGGCTGTGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGG
  3   1   2       bld Te4       in                        CAAN11838.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTGGAGAAGTTCCCGCCTGATCCTTCCCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATCTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGG
  3   1   2       bld Te5       in                         CAAO4499.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGGAAAAAAG
  3   1   2       bld Te4  5g3  in                         CAAN5698.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACG
  5   1   2       bld HeRe      in                     EC2CAA29BF10.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTACTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGTCAGAGGTTGCCCAGCAGACCCGTAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTTCTGCC
  3   1   2       bld Gas8 5g3  in                          st63g23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAAT
  3   1   2       bld TbA  5x3  out                   TTbA029l20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTTTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Te5       in                        CAAO11766.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTGNTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGGAAAAAAG
  3   1   2       bld Te5       in                         CAAO8516.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGGAAAAAAG
  3   1   2       bld Te4       in                         CAAN9513.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGATCTTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGG
  3   1   2       bld Te4  5g3  in                        CAAN10455.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGGAAAAAAG
  3   1   2       bld Te4  5g3  in                         CAAN5502.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGG
  3   1   2       bld Tad5                                 XZT19547.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGG
  3   1   2       bld Gas8 5g3  in                          st63h23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAA
  3   1   2       bld Gas8      in                          st30c11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAA
  3   1   2       bld Limb      in                        CBSU8449.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGG
  3   1   2       bld Te4       in                         CAAN2644.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGGAAAAAAG
  3   1   2       bld Int1      in                         CAAP1631.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGG
  3   1   2       bld Gas7      in                         XZG43929.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGG
  3   1   2       bld Tad5      in                         XZT56231.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGGAAAAAAG
  3   1   2       bld Eye       in                          CCAX410.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGG
  3   1   2       bld Te4       in                         CAAN4789.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCTGCTTGTCGTGGACATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACG
  3   1   2       bld Brn3 5g3  in                         CAAK2812.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTACCGG
  3   1   2       bld Te4  5g3  in                         CAAN8497.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTNNCG
  3   1   2       bld Thy1      in                        CBST5618.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGTCGTGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGG
  5   1   2       bld Tad0      in                     NISC_no08e05.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCC
  3   1   2       bld Te4       in                         CAAN4408.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGGACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGG
  3   1   2       bld Te4       in                         CAAN6876.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGGAAAAAGG
  3   1   2       bld Te4       in                         CAAN8860.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGG
  3   1   2       bld Limb      in                        CBSU2750.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTACTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGTCAGAGGTTGCCCAGCAGACCCGTAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGG
  3   1   2       bld Spl2      in                        CBSS2293.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTTTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATTTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGG
  3   1   2       bld Te3       out                        CAAM2319.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTTTGGTGCTCAGAACCGCCGTCAACCTTTTTTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATTTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCCCAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCCCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCCCAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAG
  3   1   2       bld Te1       in                        CBWN17746.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGGAAAAAAAAAAAAAAA
  3   1   2       bld Te4  5g3  in                         CAAN5090.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGGAAAAAAG
  3   1   2       bld Brn3 5g3  in                         CAAK2612.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGG
  3   1   2       bld Te4  5g3  in                         CAAN6092.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGGAAAAAAG
  3   1   2       bld Te5       in                        CAAO11068.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATAAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGG
  3   1   2       bld Gas7      in                         XZG37179.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGGCCAAATAAAGATTAGCGG
  3   1   2       bld Gas8      in                          st56m17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAAGAGATTTCCGAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTC
  3   1   2       bld Brn3 5g3  in                         CAAK2680.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGGAAAAAAG
  3   1   2       bld Te4  PIPE in                         CAAN9906.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGGAAAAAAG
  3   1   2       bld Te4       in                        CAAN10226.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGG
  3   1   2       bld Tad5      in                          XZT7423.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGGCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGGAAAAAAAAAAAAAAAGGGCG
  3   1   2       chi Tad5      in                          XZT6781.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTGCTACCAGCTCACCACATCCGGCAAGTTCGAGGAGGCTGTGGAGAAGTTCCGCCTGATCCTTCTCAGTGTGCCGCTGCTTGTCGTGGACAATAAGCAAGAGATTTCCGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGG
  3   1   2       bld Te4       in                         CAAN3217.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGG
  3   1   2       bld Te5       in                         CAAO3705.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGG
  3   1   2       bld Ova1      in                         CABE8890.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGGAAAAAAG
  3   1   2       bld Tad5      in                         XZT48702.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGG
  3   1   2       bld Tad5 5g3  in                         XZT25292.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCAGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGGAAAAAAG
  3   1   2       chi Gas8      in                          st43c17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGTGTATAACCCAGACGTTATATGGGTCTACGCTACATCCTTACTGTGCATGAGCACTGTTAGTTGTGCAATCACCTGAGCGTGTTTCATTTTGTTTCCTGTGCACAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACCAGTGTGT
  3   1   2       bld Te4       in                        CAAN11014.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGGAAAAAAG
  3   1   2       bld Brn3 5g3  in                         CAAK1831.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGG
  3   1   2       bld Te4  5g3  in                         CAAN6842.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGCTGATCACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTTTGGTGCTCAGAACCGCCGTCAACCTTTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTTCCGGG
  3   1   2       bld HeRe      in                     EC2CAA10BE03.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACTATTTGTCGTGAATACATTGTGGGTCTGACCATGGAGATCGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTACTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGTCAGAGGTTGCCCAGCAGACCCGTAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTCTCTCAAGAAACAAGA
  5  -1   2       bld Te3       ?                         CAAM15721.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCTGAGGGTAGCCATACATGGATGGGAGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAAT
  3   1   2       bld Te4  5g3  in                         CAAN9393.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTGTCGTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTTTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTTCCGGAC
  3   1   2       bld Tad5      in                         XZT35859.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCACGCGTCCGTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGGAAAAAGG
  3   1   2       bld Eye       in                         CCAX6377.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTGAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTTTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGG
  3   1   2       bld Te1  5g3  in                         CBWN1748.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTACTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGTCAGAGGTTGCCCAGCAGACCCGTAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGGAAAAAAAAAAAAAAA
  3   1   2       bld Te4  5g3  in                         CAAN6337.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AATACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTTACGG
  3   1   2       bld Te4       in                          CAAN600.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TACATTGGGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGG
  3   1   2       bld Brn4      in                        CAAL18389.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACATTGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTTTGGTGCTCAGAACCGCCGTCAACCTCTTTTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTTTTACCGGCCCATTTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTTTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCCCAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGGAAAAAAG
  5   1   2       bld Tad5      in                         XZT35859.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTGGGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACG
  3   1   2       bld Te4       in                         CAAN9790.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGTCTGACCATGGAGATAGATCGCAAGAAACTTCCAAAAGACACTTTGGAGCAACAAAAACGCATCTGTGAGATGGCCGCCTATTTCACACACTCCAACCTGCAGCCCGTGCACATGATTCTGGTGCTCAGAACCGCCGTCAACCTCTTCTTCAAACTCAAGAATTTCAAAACAGCGGCTGCTTTTGCCCGGCGACTCCTAGAACTCGGCCCCAAGCCAGAGGTGGCCCAGCAGACCCGAAAAATATTGTCCGCTTGTGAGAAGAACCTGACGGACACCTATCAGCTCAACTATGACATGCACAATCCCTTCGACATTTGCGCTGCCTCTTACCGGCCCATCTACAGAGGGAAACCCGTGGAGAAATGCCCCTTGAGCGGCGCCTGTTACAGCCCCGAGTTCAAAGGACAGATCTGTAGGGTCACAACAGTGACGGAAATCGGCAAGGACGTGATTGGATTGAGGATCAGCCCTCTGCAGTTCCGTTAAGGACCCAACGTGCGACCCGTCCGGGGCTGCCCTTTTCTCTGTAGTCATTGTAGAATGCGCCTTGTGTTGCATGATTTAACCCTTTTCTCTTTTTCCTGCCCTAGAAACTTGTCACAGTGTGTATTAGCTGTGGGAATAAACTAACTGCTCTGTTCTCTCAAGAAACAAGACCAAATAAAGATTAACGG
  3   1   2       bld Te1       in