Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 421.0    0Xt7.1-TEgg066b22.3                        258 PI      79        114      700                Hypothetical LOC496458 [Xenopus tropicalis]
     2 404.0    0Xt7.1-CAAK8119.5                           50 PI      79        114      664                MGC88884 protein [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 95%

 1012070615 Xt7.1-TTpA005o20.5 - 132 ESTs
                                                                       ......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TTpA005o20.5       GGCGGAAGTGCTGCTCCTGTTTCTGGGAGGGGTTCGGACACTGCCGGGCTTCCTGGAGATCTGACGGTTGCTGCTGTTAGCCGCACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCCATCTTTCTGCCTCTGAAGCCAATGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCACTCACACGTGTATAAAATATGAAATAAAAGCATGTTGCCTTCTGGAGGCCTTCTCT
                                                  Xt7.1-CHK-1008222565             AGTGCTGCTCCTGTTTCTGGGAGGGGTTCGGACACTGCCGGGCTTCCTGGAGATCTGACGGTTGCTGCTGTTAGCCGCACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCCATCTTTCTGCCTCTGAAGCCAATGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCACTCACACGTGTATAAAATATGAAATAAAAGCATGTTGCCTTCTGGAGGCCxxxTCTCTCCTC
                                                      consensus depths            3     3     8     8     9    10    11    13    14    14    21    25    26    30    32    38    38    42    40    48    41    50    43    51    46    54    53    57    53    58    55    59    56    60    58    64    62    65    64    66    67    68    68    69    70    71    71    72    73    74    74    75    79    82    79    82    80    83    82    84    86    87    88    90    89    92    93    95    92    95    91    96    97   100    96   100   103   106   108   110   108   110   108   110   108   111   110   112   109   113   108   112   111   113   111   113   108   112   108   112   109   112   107   111   105   111   106   108   108   108   107   108   106   109   105   109   105   108   103   107    98   102    99   102    99   102    94   101    96   102    96   102    95   101    96   101    94   100    89    97    73    95    56    92    59    92    55    84    58    83    57    82    55    80    50    78    43    65    42    61    38    59    32    48    28    41    28    39    27    38    26    38    27    38    26    36    24    36    25    35    25    35    24    35    23    32    18    30    13    27    12    26
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -T-----T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----------C
                                               BLH ATG     113    1144       
                                               BLH MIN     113     134       
                                               BLH MPR     101     134       
                                               BLH OVR     113      60       
                                               CDS MIN     113      21       
                                               EST CLI      54      21       
                                               ORF LNG     113       2       
                                                                                                                                                                                                                PROTEIN --- Bb ---= 3e-017     BAE95627.1 GTP binding protein Rho [Branchiostoma belcheri] ========================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                  PROTEIN --- Br ---- 3e-020     ABB85359.1 Ran [Branchiostoma belcheri tsingtaunese] =======================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                             PROTEIN === Ci ==== 6e-047     BAC57527.1 GTP-binding protein rab-2 homologue [Ciona intestinalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                        PROTEIN --- Sc ---- 1e-069     NP_010948.1 probably involved in intra-Golgi transport or in the formation of transportvesicles at the most distal Golgi compartment; Ypt31p [Saccharomyces cerevisiae] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                              PROTEIN === Ce ==== 2e-091     NP_490675.1 RAB family member (23.4 kD) (rab-11.1) [Caenorhabditis elegans] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                              PREDICTED = Sp ==== 4e-097     XP_798729.1 PREDICTED: similar to RAB11B, member RAS oncogene family [Strongylocentrotus purpuratus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                              PROTEIN === Dm ==== 4e-099     NP_477170.1 Rab-protein 11 CG5771-PB [Drosophila melanogaster] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                              PROTEIN === Dr ==== 1e-112     NP_001007360.1 zgc:103679 [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                              PROTEIN === Gg ==== 1e-118     NP_001005827.1 Ras-related protein Rab-11A [Gallus gallus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                              PROTEIN === Mm ==== 2e-118     NP_059078.2 RAB11a, member RAS oncogene family [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                              PROTEIN === Hs ==== 1e-118     NP_004654.1 RAB11A, member RAS oncogene family; RAB 11A, member oncogene family [Homosapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                              PROTEIN === Xl ==== 8e-121     AAH81187.1 MGC84419 protein [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                              PROTEIN === Xt ==== 8e-121     CAJ83200.1 RAB11A, member RAS oncogene family [Xenopus tropicalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                              PROTEIN === ?? ==== 8e-121     NP_001087765.1 MGC84419 protein [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TTpA005o20.5                                                                                    TAG---------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG------------------------------------------------------------ATG------------------TAA------------------------------------------------------------------------------------------TAA---------------------------------TAA------TAA------------------------------------------TGA------------------TGA------------------------------------------------------------------------------------TGA------TGA---------------------------------------------------TGA---------ATG
                                                                   ORF                                                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
  0   1   1           TpA  FL                     TTpA022f13.FL-Sanger                                                                      ACGGTTGCTGCTGTTAGCCGCACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCCATCTTTCTGCCTCTGAAGCCAATGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCACTCACACGTGTATAAAATATGAAATAAAAGCATGTTGCCTTCTGGAGGCCTTCTCTCCTCAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Tad5 FL                          XZT64018.FL-MGC                                                                                               CGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCCATCTTTCTGCCTCTGAAGCCAATGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCACTCACACGTGTATAAAATATGAAATAAAAGCATGTTGCCTTCTGGAGGCCTTCTCTCCTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2   10  bld Spl2 5g3  in                         CBSS822.fwd GGAGTGGGCGGAAGTGCTGCTCCTGTTTCTGGGAGGGGTTCGGACACTGCCGGGCTTCCTGGAGATCTGACGGTTGCTGCTGTTAGCCGCACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCCACCACTGA
  5   1   2       bld Egg  5g                        TEgg137j04.p1kSP6       GGCGGAAGTGCTGCTCCTGTTTCTGGGAGGGGTTCGGACACTGCCGGGCTTCCTGGAGATCTGACGGTTGCTGCTGTTAGCCGCACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGAT
  5   1   2       bld HeRe 5g3  in                     EC2CAA25BE12.g1       GGCGGAAGTGCTGCTCCTGTTTCTGGGAGGGGTTCGGACACTGCCGGGCTTCCTGGAGATCTGACGGTTGCTGCTGTTAGCCGCACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAAGGCTGTACCAACTGATGAAGCCCGTGCATTTGCA
  5   1   2   10  bld Spl2 5g3  in                        CBSS5927.fwd .......GCGGAAGTGCTGCTCCTGTTTCTGGGAGGGGTTCGGACACTGCCGGGCTTCCTGGAGATCTGACGGTTGCTGCTGTTAGCCGCACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAA
  5   1   2       bld HeRe 5g3  in                     EC2CAA46BG06.g1         GGGAAGTGCTGCTCCTGTTTCTGGGAGGGGTTCGGACACTGCCGGGCTTCCTGGAGATCTGACGGTTGCTGCTGTTAGCCGCACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGGATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTTCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAAACA
  5   1   2       bld BrSp 5g3  in                     EC2BBA25DE02.g1              GGGCTGCTCCTGTTTCTGGGAGGGGTTCGGACACTGCCGGGCTTCCTGGAGATCTGGCGGTTGCTGCTGTTAGCCGCACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCGCACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAACCCTCTGCACT
  5   1   2       bld BrSp 5g3  in                     EC2BBA13BC06.g1                  GGGTCCTGTTTCTGGGAGGGGTTCGGACACTGCCGGGCTTCCTGGAGATCTGACGGTTGCTGCTGTTAGCCGCACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAAAAATCTACCGCATTG
  5   1   2       bld HeRe 5g3  in                      EC2CAA4CA05.g1                  GGCTCCTGTTTCTGGGAGGGGTTCGGACACTGCCGGGCTTCCTGGAGATCTGACGGTTGCTGCTGTTAGCCGCACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCC
  5   1   2   10  bld Hrt1 5g3  in                         CAAQ3140.5p ............................CATCGATTCGAATTGGCCGAGGCGGGCTTCCTGGAGATCTGACGGTTGCTGCTGTTAGCCGCACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTNTTGTTATATATATATATTTTTGTTTT
  5   1   2       bld Te5       in                         CAAO7711.5p                              CGGGGGGGGTTCGGACACTGCCGGGCTTCCTGGAGATCTGACGGTTGCTGCTGTTAGCCGCACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGATTCTTTTTTTTTTGGTT
  5   1   2   34  bld Te3  5x3                             CAAM4628.5p ...................................GGGTTCGGACACTGCCGGGCTTCCTGGAGATCTGACGGTTGCTGCTGTTAGCCGCACATCGCGAACGTCAGAAGTACCGCGAGGATTGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGGATTCTTTTTTTTTGTTTTTTTTTGGTAAAA
  5   1   2       bld BrSp 5g3  in                     EC2BBA22CC07.g1                                           GGGACTGCCGGGCTTCCTGGAGATCTGACGGTTGCTGCTGTTAGCCGCACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACT
  5   1   2       bld BrSp 5g3  in                     EC2BBA27CC12.g1                                           GGGGCTGCCGGGCTTCCTGGAGATCTGACGGTTGCTGCTGTTAGCCGCACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCAT
  5   1   2       bld HeRe 5g3  in                     EC2CAA41DD02.g1                                             GACTGCCGGGCTTCCTGGAGATCTGACGGTTGCTGCTGTCAGCCGCACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCCGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTTGTTTTGTGTGTACG
  5   1   2       bld Egg  5g3  in                   TEgg028e08.p1kSP6                                                             GAGATCTGACGGTTGCTGCTGTTAGCCGCACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAGAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTGTTGTCCAGATTCACTGGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACAGACTGGACAGGAGCGATACCGGGCCATCACGTCAAAGTATTACCACGAGCTGTGGGGG
  5   1   2   32  bld Tad5 5g                              XZT43012.5p ............................................................GGAGATCTGACGGTTGCTGCTGTTAGCCGCACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTT
  5   1   2   30  bld Tbd1 5x3                            CBXT20861.b1 ............................................................GGAGATCTGACGGTTGCTGCTGTTAGCCGCACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAAACTTT
  5   1   2      seed TpA  5g                        TTpA005o20.p1kSP6                                                              GAGATCTGACGGTTGCTGCTGTTAGCCGCACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAGAAATGATCTC
  5   1   2       bld TpA  5g                        TTpA033n14.p1kSP6                                                              GAGATCTGACGGTTGCTGCTGTTAGCCGCACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTANATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTT
  5   1   2       bld TbA  5g3  in                   TTbA059c19.p1kSP6                                                              GAGATCTGACGGTTGCTGCTGTTAGCCGCTTATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCNCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTT
  5   1   2   14  bld Te5  5g3  in                         CAAO2138.5p .............................................................GAGATCTGACGGTTGCTGCTGTTAGCCGCACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTT
  5   1   2       bld TpA  5g                        TTpA006b10.p1kSP6                                                               AGATCTGACGGTTGCTGCTGTTAGCCGCATATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTT
  3   1   2       bld Ovi1 5g3  in                        CABI10732.3p                                                                 AGATCTGACGGTTGCTGCTGTTAGCCGCACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTT
  5   1   2   11  bld Ovi1 5g3  in                        CABI10732.5p ................................................................AGATCTGACGGTTGCTGCTGTTAGCCGCACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTT
  5   1   2       bld Neu  5g                        TNeu031p13.p1kSP6                                                                  CCCCGGGCCCCGGGCTGTTAGCCGCACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCA
  5   1   2       bld TpA  FL   in                  TTpA022f13.p1kaSP6                                                                      ACGGTTGCTGCTGTTAGCCGCACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATNATATATTTTTNGTTTTGNGGTGTACGTGGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTANAGAAATGATCTCTTTCT
  5   1   2       bld HeRe 5g                          EC2CAA28CG02.g1                                                                       CGGTTGCTGCTGTTAGCCGCACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCCGAAAAGAATGGGTTGTCCTT
  5   1   2       bld Te5                                  CAAO8403.5p                                                                       CGGTTGCTGCTGTTAGCCGCACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTTGGTTTTTTTTTTGTAATATATATATATTTTTGTT
  5   1   2   10  bld Thy1 5g3  in                        CBST1778.fwd ..............................................................................GCTGTTAGCCGCACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTT
  5   1   2   10  bld Limb 5g3  in                        CBSU2092.fwd ..............................................................................GCTATTAGCCGCACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGACTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCACTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTGTTTTTTTTTTGT
  5   1   2   30  bld Ski1 5g                              CABJ5884.5p ...............................................................................CTGTTAGCCGCACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCT
  5   1   2   10  bld Thy1 5g3  in                       CBST10051.fwd ...............................................................................CTGTTAGCCGCACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTT
  5   1   2       bld BrSp 5g3  in                     EC2BBA32DE04.g1                                                                                    GGGGCACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAAGTAATCTCTTGTCCAGAATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAAT
  5   1   2       bld Egg                            TEgg030p24.p1kSP6                                                                                     TAATCCCCGGCGCTAACGTCATAAGTACCTCTAGGATGGGTACCACGGACTACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGA
  5   1   2       bld Gas8 5g   ?                           st19o01.5p                                                                                      GCCGCACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGA
  5   1   2       bld Gas8 5g3  in                          st18o01.5p                                                                                       CCGCACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCCACGTCCTGCCCTGGA
  5   1   2       bld 1030 5g                         IMAGE:7091236.5p                                                                                        GGCACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAAGTACAATGTGGTCCCCATCCACGTGCCCCCCC
  5   1   2       bld HdA  5g                        THdA004c13.p1kSP6                                                                                          CACATCGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAAAACTTTATTTTAATATTCCATCTGGATTTTTACTTGTCTTAAA
  3  -1   2       bld Fat1      in                         CABC4328.3p                                                                                               CGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGT
  5   1   2       bld Tad5 FL                              XZT64018.5p                                                                                               CGCGAACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAANTC
  5   1   2       bld Neu  5g                        TNeu107e03.p1cSP6                                                                                                   AACGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATG
  5   1   2   10  bld Limb 5g3  in                        CBSU2071.fwd ....................................................................................................GGTCAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTT
  5   1   2       bld TpA  5g                        TTpA013n14.p1kSP6                                                                                                        CAGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTTTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCATCTTTCTGCCTCTG
  5   1   2       bld HdA  5x3  out                 THdA001a10.p1kaSP6                                                                                                        TCGAATTACGCGAGGATGGGTACCAAGGCACGACTAATACGATTATCTGTTTGGGTGGTTCTGATCGGAGACTCCGAGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAATAGCACCATCCGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACGTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCACACTGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATACACCAAAGATGCAATGCTGTCAGAACATCTGATGGCTGCTGCCAGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTT
  5   1   2   34  bld Brn4 5g                             CAAL20894.5p ........................................................................................................AGAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGATTCTTTTTTTTTTGG
  5   1   2   30  bld Thy1 5x3  out                       CBST1394.fwd ........................................................................................................ATAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGCGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCTGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGTTAAAGGACTTAAGGGACCACGCAGACAATATTATAGTTATCATGTTGGTGGGTAACCAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGTCCGTGCATTTGCTGAAAAGAATGGGCTGTCCTTTATAGAAACCTCTGCACTGGATTCAACACATGTGGAAGCTGCTTTCCAGACTATACTCACAGATATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGATTGACATGTCCCCAAGCAACAATGTGGTCCGCATCCACGTGACCCCCACCACTGAAAAT
  5   1   2   11  bld Tail 5g3  in                         CBSW7741.b1 ..........................................................................................................GAAGTACCGCGAGGATGGGTACCAGGGACGACGAATACGACTATCTGTTTAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGANAAT
  5   1   2   11  bld Spl2 5g3  in                        CBSS7504.fwd ............................................................................................................AAGTCCGCGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTT
  5   1   2       bld TpA  5g                        TTpA008p16.p1kSP6                                                                                                                    CGAGGATGGGTACCAGGGACGACGAATACGATTATCTGTTTAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCT
  5   1   2       bld TpA                            TTpA069k08.p1kSP6                                                                                                                     CCGCGAGAGGGTCCGGGACGACGAATACTATTTCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATANTATTTTTGGTTTTGGTGTGGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCNTTAATTCTATGATTTTCTGTAT
  5   1   2       bld TpA                            TTpA069k09.p1kSP6                                                                                                                                   GGACGACGAATACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATANTATATTTTTGGTTTTGTGGTGTACCGTGTTTAAGAAACTTTTATTTTACTATTCCATCTGGATTTTTACTTGTC
  5   1   2       bld Tad5                                 XZT49901.5p                                                                                                                                             TACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCATTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTG
  5   1   2       bld Gas8      in                          st34m16.5p                                                                                                                                              ACGATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCT
  5   1   2       bld Gas8      in                          st35m16.5p                                                                                                                                                 ATTATCTGTTTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCNCACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCANACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCCACCACTGAAAAATAAACCAAAGATGCAATGCTGTCAGAAC
  5   1   2       bld Int1      ?                         CAAP10026.5p                                                                                                                                                          TTAAAGTGGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAA
  5   1   2       bld Lun1      in                         CABD2898.5p                                                                                                                                                                 GGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCCATCTTTCTGCCTCT
  5   1   2       bld Mus1      in                         CABH3917.5p                                                                                                                                                                 GGTTCTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCAAAAAAAAAAAAAAAACTCGAGCCTCTCGCCC
  5   1   2       bld Int1      in                        CAAP12144.5p                                                                                                                                                                      CTGATCGGAGACTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTNNCTAATTTCTATGA
  5   1   2       bld Fat1                                 CABC1175.5p                                                                                                                                                                                CTCCGGTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCT
  3   1   2       bld Mus1      in                         CABH3917.3p                                                                                                                                                                                     GTGTGGGGAAGAGTAATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTC
  5   1   2       bld Te5       out                        CAAO7424.5p                                                                                                                                                                                                   AATCTCTTGTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATCTTATGATTTTCTGTAT
  5   1   2       bld Ski1      in                         CABJ8420.5p                                                                                                                                                                                                        CGAGGTCCAGATTCACACGCAATGAGTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCAAAAAAAAAAAAAAAAAA
  5   1   2       bld Tbd1      in                        CBXT17669.b1                                                                                                                                                                                                           GTCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTTGTTTTTTTTTTTGTTAATATATATATATTTTTTGTTTTTGTGTGT
  3   1   2       bld Ski1      in                         CABJ8420.3p                                                                                                                                                                                                            TCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAAGTGATCTCTTTCTC
  3   1   2       bld Limb 5g3  in                        CBSU2071.rev                                                                                                                                                                                                            TCCAGATTCACACGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTC
  5   1   2       bld Tbd1                                CBXT12302.b1                                                                                                                                                                                                                        CGCAATGAGTTTAACCTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTC
  3   1   2       bld Limb 5g3  in                        CBSU2092.rev                                                                                                                                                                                                                                      CNTGGAGAGTAAGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCACTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAAGTGATCTCTTTCTCACCCTC
  5   1   2       bld TbA                            TTbA022m12.p1kSP6                                                                                                                                                                                                                                                   AGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTANATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCCATCTTTCTGCCTCTGAAGCCATGATTCCGTGAT
  5   1   2       bld Tad5                                 XZT26594.5p                                                                                                                                                                                                                                                   AGAGCACCATCGGGGTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCA
  3   1   2       bld BrSp 5g3  in                     EC2BBA22CC07.b1                                                                                                                                                                                                                                                               GTGGAATTTGCTACAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCT
  3   1   2       bld Tad0      in                       IMAGE:6983438                                                                                                                                                                                                                                                                           TCAAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATCCCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAAGTCCTATGACACTCAC
  5   1   2       bld Tad0      in                       IMAGE:6983438                                                                                                                                                                                                                                                                             CAGAAGCATCCAGGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCAAAAAN
  3   1   2       bld BrSp 5g3  in                     EC2BBA27CC12.b1                                                                                                                                                                                                                                                                                         GGTGGATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCT
  3   1   2       bld Lun1      in                         CABD2898.3p                                                                                                                                                                                                                                                                                             GATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCCATCTTTCTGCCTCTGAAGCCAATGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCACTCACACGTGTATAAAATATGAAATAAAAGCATGTTGCCTTCGGAGGCCTTCTCTCCTCATAAAA
  3   1   2       bld Tbd1      in                        CBXT17669.g1                                                                                                                                                                                                                                                                                             GATGGCAAAACCATTAAAGCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCAAAAAAAAAAAAAAA
  3   1   2       bld Te5  5g3  in                         CAAO2138.3p                                                                                                                                                                                                                                                                                                               GCTCAGATCTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCCATCTTTCTGCCTCTGAAGCCAATGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCACTCACACGTGTATAAAATATGAAATAAAAGCATGTTGCCTTC
  3   1   2       bld Gas8 5g3  in                          st18o01.3p                                                                                                                                                                                                                                                                                                                      TNTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACNTTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGNCCNCGCNGNCAATAAAATAGTTATCATGTTGGNGGGCAACAAGAGTGACCTGNGACNCTTGAGGGCTGTACCAACTGATGAAGCCCGTGCNTTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTNTGCNCTGGATTCAACAAATGTGGAAGNTGCTTTCCNGNCTATACTCACAGAGATNTACCGCNTTGTGTCCCNGACGCAGATGTCAGACNGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCNCCNCTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATTTAATGGNTGCTGCCTGCGCTNTGCCGGCCTNTGTATATTCCCNCGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTGTCTAAAT
  3   1   2       bld Egg       in                    TEgg042c22.q1kT7                                                                                                                                                                                                                                                                                                                       CTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCCATCTTTCTGCCTCTGAAGCCAATGATTCTGTGATTCCAAGCCTAGCCCTCCCATTCACTCACACGTGTATAAAATAGAAAAAAAGCATGTTGCCTTC
  3   1   2       bld Tail 5g3  in                         CBSW7741.g1                                                                                                                                                                                                                                                                                                                       CTGGGACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCACTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCAAAAAAAAAAAAAAA
  5   1   2       bld Egg       in                   TEgg042c22.p1kSP6                                                                                                                                                                                                                                                                                                                        CTGGGACCAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAATTCTTATGATTTTC
  3   1   2       bld TbA       out                   TTbA067b22.q1kT7                                                                                                                                                                                                                                                                                                                          GACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCNAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTTTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTTTTACTCCCCCGCCCATCTTTTTGCCTTTGAAGCCAATGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCACTCACACGTGTATAAAATATGAAATAAAAGCATGTGCTTTCGAAAAAAAAAAAAAAAAA
  3   1   2       bld TpA  FL   in                    TTpA022f13.q1kT7                                                                                                                                                                                                                                                                                                                           GACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCCATCTTTCTGCCTCTGAAGCCAATGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCACTCACACGTGTATAAAATATGAAATAAAAGCATGTTGCCTTCTGGAGGCCTTCTCTCTCAAAAAAAAAA
  3   1   2       bld HeRe 5g3  in                     EC2CAA25BE12.b1                                                                                                                                                                                                                                                                                                                           GACACAGCTGGACAGGAGCGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCACTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTA
  5   1   2       bld Egg                            TEgg055k23.p1kSP6                                                                                                                                                                                                                                                                                                                                             CGATACCGGGCCATCACTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTC
  5   1   2       bld Gas                            TGas036l16.p1kSP6                                                                                                                                                                                                                                                                                                                                                             CTTCAGCGTATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCT
  3   1   2       bld TbA  5g3  in                    TTbA059c19.q1kT7                                                                                                                                                                                                                                                                                                                                                                     TATTACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCCATCTTTCTGCCTCTGAAGCCAATGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCACTCACACGTGTATAAAATAGAAATAAAAGCATGTGCCTTCGGAGGCCTTCTCTCCAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Thy1 5g3  in                        CBST1778.rev                                                                                                                                                                                                                                                                                                                                                                        TACCGAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCCATCTTTCTGCCTCTGAAGCCAATGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCACTCACACGTGTATAAAATATGAAATAAAAGCCATGTTGCCTTCTGGAGGCCTTCTCTCCTCAT
  3   1   2       bld Te5       in                         CAAO7711.3p                                                                                                                                                                                                                                                                                                                                                                            GAGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTTGGTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCCATCTTTCTGCCTCTGAAGCCAATGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCACTCACACGTGTATAAAATATGAAATAAAAGGCATGTTGCCTTCTGGAGGCCTTCTCTCCTC
  3   1   2       bld Hrt1 5g3  in                         CAAQ3140.3p                                                                                                                                                                                                                                                                                                                                                                             AGGAGCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCCATCTTTCTGCCTCTGAAGCCAATGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCACTCACACGTGTATAAAATATGAAATAAAAGCCATGTTGCCTTCTGGAGGCCTTCTCTCCTC
  3   1   2       bld BrSp 5g3  in                     EC2BBA13BC06.b1                                                                                                                                                                                                                                                                                                                                                                                 GCTGTGGGGGCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCCATCTTTCTGCCTCTGAAGCCAATGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCACTCACACGTGATAAAATATAAATAAAAGCATGT
  5   1   2       chi Brn2                                CAAJ13249.5p                                                                                                                                                                                                                                                                                                                                                                                          GCCAAGTCCTTCAGCCCCATGGATTGTTCTCCCTACTGATATAAACACTGCAGCTCATACATTTCTCGGCTGGGCGCTATTTAACGATTGCATTACACTTATATTATCATTCTCTTTTGCTGGACATGCAAAGCGTGAGCTTCATTTCAATCTTTCCCTTTTGATTTTACAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGATTTGAGTG
  3   1   2       bld Spl2 5g3  in                         CBSS822.rev                                                                                                                                                                                                                                                                                                                                                                                          GCACTGCTGGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCCATCTTTCTGCCTCTGAAGCCAATGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCACTCACACGTGTATAAAATATGAAATAAAAGCATGTTGCCTTCTGGAGGCCTTCTCTCCTC
  5  -1   2       bld Fat1      in                         CABC4328.5p                                                                                                                                                                                                                                                                                                                                                                                                CTGGTGTATGACATTGACAAGCACTTGACCTATATGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTGTCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGTTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTCACTTGTCGTAA
  3   1   2       bld HeRe 5g3  in                     EC2CAA41DD02.b1                                                                                                                                                                                                                                                                                                                                                                                                  GGTGTATGACATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATG
  5   1   2       bld TpA                           TTpA049d16.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                            CTTGCCAAGCACTTGACCTATGAGAAGGCGGAACCATGGCTAAAAGAATTGATGGACCACGCGGACTATAAAATAGTTATGATGTTGGTGGGAAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCATCTGATAAAGCCCGTGCATTTGCAAAACAGAATGGGTTGTCCTTTATAGAAACCTCTGTACTGGATACGACGCTTGTGCAAGCTGCTTTCCAGACTATACTCACCGAGATCTACCGTATTGTGTCCCCAACGCAGATGT
  3   1   2       bld BrSp 5g3  in                     EC2BBA25DE02.b1                                                                                                                                                                                                                                                                                                                                                                                                            ATTGCCAAGCACTTGACCTATGAGAATGTGGAACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCCATCTTTCTGCCTCTGAAGCCAATGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCACTCACACGTTATAAAATAT
  3   1   2       bld HeRe 5g3  in                      EC2CAA4CA05.b1                                                                                                                                                                                                                                                                                                                                                                                                                  AAGCACTTGACCTATGAGAATGTGGAACGATGGGTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCACTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATG
  3   1   2       bld Tad5      in                          XZT6868.3p                                                                                                                                                                                                                                                                                                                                                                                                                                      CCACGCGTCCGGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCCATCTTTCTGCCTCTGAAGCCAATGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCACTCACACGGTGTATAAAATATGAAATAAAAGGCATGTTGCCTTCTGGAGGCCTTCTCTCCTCAAAAAAAAAAAAAAAAGGGC
  3   1   2       bld Spl2 5g3  in                        CBSS5927.rev                                                                                                                                                                                                                                                                                                                                                                                                                                            ACGATGGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCCATCTTTCTGCCTCTGAAGCCAATGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCACTCACACGTGTATAAAATATGAAATAAAAGCATGTTGCCTTCTGGAGGCCTTCTCTCCTC
  3   1   2       bld Gas8      in                          st34m16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTGTTAATATATATATATTTTTGTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCCATCTTTCTGCCTCTGAAGCCAATGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCACTCACACGTGTATAAAAT
  3   1   2       bld Thy1 5g3  in                       CBST10051.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGCTAAAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCCATCTTTCTGCCTCTGAAGCCAATGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCACTCACACGTGTATAAAATATGAAATAAAAGCCATGTTGCCTTCTGGAGGCCTTCTCTCCCC
  3   1   2       bld Neu       in                    TNeu089m18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCAAAAAAAAAAAAAAAAAA
  5   1   2       bld Neu       in                   TNeu089m18.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGGAATTAAGGGACCACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATG
  5   1   2       bld Tad5      in                          XZT6868.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACGCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCCATCTTTCTGCCTCTGAAGCCAATGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCACTCACACGTGTATAAAATATGAAATAAAAGCATGTTGCCTTCTGGAGGCCTTCTCTCCTCAAAAAAAAAAAAAAAAGG
  3   1   2       bld Int1      in                        CAAP12144.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCAGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCCATCTTTCTGCCTCTGAAGCCAATGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCACTCACACGTGTATAAAATATGAAATAAAACGCATGTTGCCTTCTGGAGGCCTTCTCTCCTC
  3   1   2       bld Hrt1      in                         CAAQ2495.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCCATCTTTCTGCCTCTGAAGCCAATGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCACTCACACGTGTATAAAATATGAAATAAAAGCCATGTTGCCTTCTGGAGGCCTTCTCTCCTC
  5   1   2       bld Hrt1      in                         CAAQ2495.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGACAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCCATCTTTCTGCCTCTGAAGCCAATGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCACTCACACGTGTATAAAATATGAAATAAAAGCATGTTGCCTTCTGGAGGCCTTCTCTCCTCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ski1      in                         CABJ2801.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCCATCTTTCTGCCTCTGAAGCCAATGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCACTCACACGTGTATAAAATATGAAATAAAAGCCATGTTGCCTTCTGGAGGCCTTCTCTCCTC
  5   1   2       bld Ski1      in                         CABJ2801.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAATAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCCATCTTTCTGCCTCTGAAGCCAATGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCACTCACACGTGTATAAAATATGAAATAAAAGCATGTTGCCTTCTGGAGGCCTTCTCTCCTCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  5g3  in                    TEgg028e08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCCATCTTTCTGCCTCTGAAGCCAATGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCACTCACACGTGTATAAAATATGAAATAAAAGCATGTTGCCTTCTGGAGGCCTTCTCTCCTCAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Tad5                                 XZT68904.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAATAGTTATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATT
  3   1   2       bld HeRe 5g3  in                     EC2CAA46BG06.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTATTCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGGATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTTCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTGTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCCATCTTTCTGCCTCTGAAGCCAATGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCACTCACCACGTGTATAAAATATGAAATAAAAG
  3   1   2       bld Spl2 5g3  in                        CBSS7504.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATCATGTTGGTGGGCAACAAGAGTGACCTGCGACACTTGAGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATTTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCCATCTTTTTGCCTTTGAAGCCAATGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCACTCACACGTGTATAAAATATGAAATAAAACGCATGTTGCCTTCTGGAGGCCTTCTCTCCT
  5   1   2       bld Gas                            TGas047d01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGACACTTGAGGGCTGTACCAACTGATGAAGGGCGTGCGTTTGCAGAAAAGATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTGACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTGTTTTTTTTGTGAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTGCTTAAATTCTTATGATTTTCTGGATTAAAGAAATGATCTCTTTCTC
  3   1   2       bld Egg       ?                     TEgg018p15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGGCTGTACCAACTGATGAAGCCCGTGCATTTGCAGAAAAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCCATCTTTCTGCCTCTGAAGCCAATGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCACTCACACGTGTATAAAATATGAAATAAAAGCATGTTGCCTTCTGGAGGCCTTCTCTCCTCATAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas8      in                          st35m16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAGCCCGGGCANTTGCAGAAAAGAATGGGNTGTCCTTTATAGAAACCTCTGCANTGGATTCAACAAATGNGGAAGNTGCTTTCCAGACNATACTCACAGAGATNTGCCGCATTGTGTCCCAGACGCAGATGTCAGACNGACGTGAGAATGNCATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATNTAATGGCTGCTGCCTGNGCTNTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTNTTTTTTTTTGTTTTTTTTTGTTAATATATATATATTTTTGTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATNTGGATTTTTACTTGTCTTAAATTCTTANGATTTTCTGTATTAAAGAAATGATNTCTTTCTCACCCTCTTTCANTGAGCCTGATTGTGCCCGGCCGCCTNTTCTATNTCTTACTCCCCCGCCCATCTTTCTGCCTCNGAAGCCAATGATTCCGTGATNGCCAAGCCTAGCCCTCCCANTCACTCACACGT
  3   1   2       bld HeRe                             EC2CAA35CE11.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTGCAGAATGGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCACAGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTA
  3   1   2       bld Gas0                                 dad34c10.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGTTGTCCTTTATAGAAACCTCTGCACTGGATTCAACAAATGTGGAAGCTGCTTTCCAGACTATACTCCCAGAGATCTACCGCATTGGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCCATTTTTCTGCCTCTGAAGCCAATGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCACTCACACGTGTATAAAATATGAAATAAAAGCATGTTGCCTTCTGGAGGCCTTTTCTCCTCCAAAAAAAAAAAAA
  5   1   2       bld Egg                            TEgg054e22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAGATCTACCGCATTGTGTCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCCATCTTTCTGCCTCTGAAGCCAATGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCACTCACACGTGTATAAAATATGAAATAAAAGCATGTTGCCTTCTGGAGGCCTTCTCTCCTC
  3   1   2       bld TpA                             TTpA002c05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCCAGACGCAGATGTCAGACAGACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTGGTTAATATATATATATTTTTGTTTGGGGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTGGTCTTAAATTCTT
  5   1   2       bld HdA       in                   THdA034b18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACGTGAGAATGACATGTCCCCAAGTAACCATTTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCCATCTTTCTGCCTCTGAAGCCAATGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCACTCAGACGTGTATAAAATATGAAATAAAAGCATGTTGCCTTCTGGAGGCCTTCTCTCCTCAAAAAAAAAAAAAAAAATTAAAAAAAAAAAAAAAAATT
  3   1   2       bld HdA       in                    THdA034b18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACGTGAGAATGACATGTCCCCAAGTAACAATGTGGTCCCCATCCACGTGCCCCCCACCACTGAAAATAAACCAAAGATGCAATGCTGTCAGAACATTTAATGGGTGCTGCCTGCGTTTTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTTTTTTGGAATTCTTTTTTTTTGTTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGGGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCGGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATTTCTTTTTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTTTATTTTTTATTCCCCCGCCCATCTTTTTGCCTTTGAAGCCAAGGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCATTCAGAGGGGTATAAAATATGAAATAAAAGCATGTTGCCTTTTGGAGGCCTTTTTTCCTCaaaaagaaaaaaaaaaattaaaaaaaaaaaaaaaattaaaaaaaaaaaaaaaaaG
  3   1   2       bld BrSp 5g3  in                     EC2BBA32DE04.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCTGTCAGAACATCTAATGGCTGCTGCATGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCCATCTTTCTGCCTCTGAAGCCAATGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCACTCACACGTGTATAAAATATGAAATAAAAG
  5  -1   2       chi TbA                            TTbA049k24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAAAAAATAATTCCAAAAGATTCCGGGGCAGGAGGTGGGAATATACAGAGGCCGGCAGAGCGCAGGCAGCAGCCATTAGATGTTCTGACAGCATGGCATCTTTGGTTTATTTTCAGTGGTGGGGGGCACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATCTCTTACTCCCCCGCCCATCTTTCTGCCTCTGAAGCCAATGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCACTCACACGTGTATAAAATATGAAATAAAAGGCATGTTGCCTTAAGGAGGCCTTCTCT
  3   1   2       bld HeRe                             EC2CAA44CD07.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCTAATGGCTGCTGCCTGCGCTCTGCCGGCCTCTGTATATTCCCACGTCCTGCCCTGGACTCTTTTGGAATTCTTTTTTTTGTTTTTTTTTTGTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATTTGGA
  5   1   2       bld Egg                            TEgg096h23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTAGTGTCGACGCGGCCGCTTTTTTTTTTTTTTTTTTTGGTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTC
  3  -1   2       bld TbA                             TTbA004b12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGTAAAAAAAAAAAATTTCTTGTTTTGGGGGGACCGTGTTTAAAAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAAAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGGCGCCTTTTCTATCTCTTACTCCCCCGCCCATCTTTCTGCCTCTGAAGCCAATGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCACTCAGACGTGTATAAAATATGAAATAAAAGCATGTTGCCTTCTGGAGGCCTTCTCTCCTCC
  5   1   2       add Egg                            TEgg144b19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTTTTTTGGTTTTTTTTTGGTAAAAATATATAAATTTTGGTTTGGGGGGAACGGGTTTAAAAACTTTATTTTTACTATTCCATCTGAATTTTTACTTGCCTTAAA
  3  -1   2       bld TpA       in                    TTpA060a24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTTTTTTTTTTTTTTTTGTTATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTC
  5  -1   2       bld TpA       in                   TTpA060a24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTAATATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATAGATCTCTTTCTCAAAAAAACCCCGGG
  3   1   2       bld Egg                             TEgg067n17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAATATATATATTTTTGTTTTGTGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTTCTTATGATTTTCTGTATTAAAGAAANNTGATCTCTTTCTCACCCTCAAAAAAAAAAAAAAAAA
  3   1   2       bld TpA                             TTpA028g13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATAAATATATATTTTTGTTTTGGGTGTACGTGTTTAAGAACTTTAATTTTACTATTCCATCTGGATTTTTACTTGTCTTAAATTCTTATGATTTTCTGTATTAAAGAAATGATCTCTTTCTCACCCTCTTTCACTGAGCCTGATTGTGCCCGGCCGCCTTTTCTATTTCTTACTCCCCCGCCCATCTTTCTGCCTCTGAAGCCAATGATTCCGTGATTCCAAGCCTAGCCCTCCCATTCACTCACACGTGTATAAAATATGAAATAAAAGCATGTTGCCTTCTGGAGGCCTTCTCTCCTCAAAAAAAAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)