Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 97%

 1012071101 Xt7.1-CABK7170.3.5 - 191 ESTs
                                                                       ........-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABK7170.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                             GATAATCAGACCTCACTCTTGCCTTCCACCTATAGGTGCACACCTATGTTGTATATATCTGTAGGTGGCTTACAGTTCATTTAAATAAAGGCTCTGTGCCAGCAGTGGTTGGACTTTTTTAGTTTAAGCCTCCCTTGGTGGTGCAACCTTCATTCAGGCCCCCTTTCATTTATGGTAAGGTTATAGATATAGGAAAATATTAGTGAGTCAGCCATGCATGCACATTTCCAAGAATATCAAATAAGTACTTTTCTTTTACATAGATTCAGTATAGAAATTCATATCATTGGAATATGTGCAAACACCTGTATTGGTAATTTTAGTATAAATATGTTTTGGGTGCGTAATGTTGAGTTTTTACTATAATTAGCATGTAAATTCCTGCGACTGTGGGGAAAAATACCTAGAAACCCTCGGATGAAGCACAAAAGAATTGTTGTTTTTTGTTAGTCTTCAAGTGCTGCTGGCGCCATCTCCTTGGTTTCGCGCGTTCCCGTGTGGGATGCAGTGTAGCTCTGTGGCATCGGCCGGCTTGACATTACAGTGTCGGGACTGTGGTGTGGCGCAAGGTACACACAGGAAAATGGTTCCCAACGGATCTTTAAATTTTGAAGATGAACAGTTTATTGAGTCGTCTGTGGCTAAATTAAATGCCTTACGCAAAAGCGGACAGTTTTGTGATGTAAAACTACAGGTCTGCGGCCATGAGATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTTAACAGTGACGGTGAATCTCATGGTATTTCCCTTGTCAGATTTGATGACTTAAATCCAGACGCTGTTGAAGTCTTATTAAATTATGCGTATACATCTCAGCTTAAAGCGGAGACAGACCTTGTTAAAGATGTATACTCTGCAGCAAAAAAGCTTAAGATTGATCGAGTAAAACAGGTGTGTGGAGATTACTTACTATCAAAAATAGATGTTCAGAGCTGCATTTCTTATCGTAATTTTGTAAATGCAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGAGGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTTTCACTTCCCAGCAACGGTAAACTGTATACAAAGGTAATCAACTGGGTTCAGCGGAGCATATGGGAGAATGGCGAAAATCTGGATGCCCTATTGGAAGAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCCGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGTTGGAGGATTTGATGGTACCCATGCTCTAAGTTGTGTCGAATCATATGACCCCGAAAGAAACGAGTGGAAGATGATGGGGAGTATGACCTCTGCAAGAAGCAATGCAGGAATGGTTGCTGTAGGGGATCAAATATATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAATTGAAGTTTATAACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTACAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTAAATAAAATTGACTGTAAATGAAAAAAAAA
                                                  Xt7.1-CHK-1008221939                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGACCTCACTCTTGCCTTCCACCTATAGGTGCACACCTATGTTGTATATATCTGTAGGTGGCTTACAGTTCATTTAAATAAAGGCTCTGTGCCAGCAGTGGTTGGACTTTTTTAGTTTAAGCCTCCCTTGGTGGTGCAACCTTCATTCAGGCCCCCTTTCATTTATGGTAAGGTTATAGATATAGGAAAATATTAGTGAGTCAGCCATGCATGCACATTTCCAAGAATATCAAATAAGTACTTTTCTTTTACATAGATTCAGTATAGAAATTCATATCATTGGAATATGTGCAAACACCTGTATTGGTAATTTTAGTATAAATATGTTTTGGGTGCGTAATGTTGAGTTTTTACTATAATTAGCATGTAAATTCCTGCGACTGTGGGGAAAAATACCTAGAAACCCTCGGATGAAGCACAAAAGAATTGTTGTTTTTTGTTAGxxTxCxAGTGCTGCTGGCGCCATCTCCTTGGTTTCGCGCGTTCCCGTGTGGGATGCAGTGTAGCTCTGTGGCATCGGCCGGCTTGACATTACAGTGTCGGGACTGTGGTGTGGCGCAAGGTACACACAGGAAAATGGTTCCCAACGGATCTTTAAATTTTGAAGATGAACAGTTTATTGAGTCGTCTGTGGCTAAATTAAATGCCTTACGCAAAAGCGGACAGTTTTGTGATGTAAAACTACAGGTCTGCGGCCATGAGATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTTAACAGTGACGGTGAATCTCATGGTATTTCCCTTGTCAGATTTGATGACTTAAATCCAGACGCTGTTGAAGTCTTATTAAATTATGCGTATACATCTCAGCTTAAAGCGGAGACAGACCTTGTTAAAGATGTATACTCTGCAGCAAAAAAGCTTAAGATTGATCGAGTAAAACAGGTGTGTGGAGATTACTTACTATCAAAAATAGATGTTCAGAGCTGCATTTCTTATCGTAATTTTGTAAATGCAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGAGGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTTTCACTTCCCAGCAACGGTAAACTGTATACAAAGGTAATCAACTGGGTTCAGCGGAGCATATGGGAGAATGGCGAAAATCTGGATGCCCTATTGGAAGAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCCGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGTTGGAGGATTTGATGGTACCCATGCTCTAAGTTGTGTCGAATCATATGACCCCGAAAGAAACGAGTGGAAGATGATGGGGAGTATGACCTCTGCAAGAAGCAATGCAGGAATGGTTGCTGTAGGGGATCAAATATATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAATTGAAGTTTATAACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGxxxxxxCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTAAATAAAATTGACTGTAAATGAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                  3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     4     2     4     2     4     2     4     2     5     2     5     3     6     3     7     4     9     8    13     8    13    11    17    13    18    12    18    14    19    17    20    18    20    18    20    18    20    18    20    18    20    18    20    18    20    18    20    19    21    19    20    19    21    19    22    18    22    18    23    18    23    18    23    19    24    19    24    19    24    19    24    19    24    19    23    19    23    19    23    19    23    19    23    19    23    19    24    19    25    19    26    18    25    18    25    18    25    18    25    18    25    19    26    20    27    20    26    18    24    20    26    19    27    19    28    17    26    17    27    14    26    15    26    14    25    15    27    15    25    17    27    16    27    15    27    15    27    16    28    14    26    21    28    20    28    21    29    21    30    21    29    22    31    21    32    21    33    19    31    19    31    21    32    21    32    22    33    22    33    22    34    22    34    22    34    21    33    21    34    21    34    22    36    22    36    23    37    22    37    22    38    22    37    21    36    21    36    21    37    21    37    21    37    20    36    21    38    21    38    21    39    21    39    20    40    19    40    20    41    21    43    21    43    21    44    21    44    21    45    21    45    21    44    18    41    19    41    20    41    19    41    19    41    19    40    20    41    19    41    18    42    20    44    20    44    19    42    18    41    21    42    21    42    19    39    18    39    18    39    18    40    19    40    19    38    20    38    20    38    20    38    21    40    21    40    20    41    21    41    19    39    17    37    17    35    16    35    16    33    16    33    15    32    15    32    15    32    15    32    15    32    14    31    14    30    15    31    15    33    14    33    13    33    14    32    14    31    15    32    15    33    15    33    15    33    15    33    16    34    15    35    17    32    17    31    17    31    18    34    19    38    22    42    24    43    23    44    24    45    30    51    29    50    29    53    30    56    32    59    32    59    35    64    36    64    36    63    36    63    36    63    37    64    39    65    50    65    49    64    50    64    49    62    52    64    53    65    53    66    52    66    52    66    55    67    55    68    53    71    55    72    57    76    56    77    56    79    55    79    55    80    55    83    56    85    55    85    55    84    55    86    56    86    55    85    55    84    55    84    55    84    54    83    53    85    55    85    55    86    52    85    52    86    52    86    51    85    52    85    52    85    52    85    51    84    51    84    51    84    50    84    48    82    49    82    47    81    49    81    48    81    45    83    45    83    42    83    38    81    27    50    27    38    27    33    27    32    27    31    27    31    27    31    27    31    27    31    27    31    27    29    27    29    27    29    27    29    27    29    27    29    27    29    27    29    27    29    27    29    27    29    27    29    27    29    27    29    28    29    26    29    25    28    22    27    21    25    18    22     4     5
  5   1   2  SIG                                      Xt7.1-CABK7170.3                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGTTTAGATGGATAATCAGACCTCACTCTTGCCTTCCACCTATAGGTGCACACCTATGTTGTATATATCTGTAGGTGGCTTACAGTTCATTTAAATAAAGGCTCTGTGCCAGCAGTGGTTGGACTTTTTTAGTTTAAGCCTCCCTTGGTGGTGCAACCTTCATTCAGGCCCCCTTTCATTTATGGTAAGGTTATAGATATAGGAAAATATTAGTGAGTCAGCCATGCATGCACATTTCCAAGAATATCAAATAAGTACTTTTCTTTTACATAGATTCAGTATAGAAATTCATATCATTGGAATATGTGCAAACACCTGTATTGGTAATTTTAGTATAAATATGTTTTGGGTGCGTAATGTTGAGTTTTTACTATAATTAGCATGTAAATTCCTGCGACTGTGGGGAAAAATACCTAGAAACCCTCGGATGAAGCACAAAAGAATTGTTGTTTTTTGTTAGTCTTCATAATGGCCTTTTATTGAAGACTTTTTTTGTTCTGTAGAGGTTTTCCAGGACATTTAAAAAAATGGTTTGATTTTGGGAGAAATGGTTTGTGGATTTTTTGATTATTTTAAACAGAAACTTTTTAACTCCCCCTTGATTTGTCATCTTTAGATTAATCATTCTGTTTAGGTGTTAGTTTTCCTTTGACATTTACATTTGAGTTGAGGCTATTTGTTTTGCATCTTGATTGGAGTGAGCATGATAAAAGGGCAACTTTTACTCCCCAATACATATTTAGTATGGTAACCGATTATGAATTTTAACAGTCTTTGCTAAGTAAGCATATTTTGATACTGCAGAACTGTATGTATAAACTTGTTTGCCCTCTTGCCCCCACTGTATTGTAGATACTGGTACTGAATGTGTTTCTTTTATGAAACTTTATTTTATACTAATGTATATTAAGAGTATCTTGTATGTGTCTTTGTATACATCTGTGCTTCTGTCATATCTCGTATCTCCTTTTTCTTTTATTTACTTTATTTTTTCCTGTTTCTCCTTTTTTTTTTTTTTTTCTTTTTTTTTTTTTGTGTTTAACACCCCCACTCCTACCTATTGGAAAATGAAGATTTCTTCAAGAAGATTTGAGTTATTAGAAGATTGACATCATGCAATATAATTTTTTTTGATTGAAAGTTTTCCAAGTGGAATCTTTACTCACAATGAAGATAACGTGGATTATAGGATCACAAATAATAATATTTTTAGAAGAAGTATCCATATGGCTTTCATTTCTATTTTGCAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCCGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGTTGGAGGATTTGATGGTACCCATGCTCTAAGTTGTGTCGAATCATATGACCCCGAAAGAAACGAGTGGAAGATGATGGGGAGTATGACCTCTGCAAGAAGCAATGCAGGAATGGTTGCTGTAGGGGATCAAATATATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAATTGAAGTTTATAACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATGAAAAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                    Xt7.1-THdA013a21.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGTTGCTAGGCAGGAAGCGTGCGAGTGCTGCTGGCGCCATCTCCTTGGTTTCGCGCGTTCCCGTGTGGGATGCAGTGTAGCTCTGTGGCATCGGCCGGCTTGACATTACAGTGTCGGGACTGTGGTGTGGCGCAAGGTACACACAGGAAAATGGTTCCCAACGGATCTTTAAATTTTGAAGATGAACAGTTTATTGAGTCGTCTGTGGCTAAATTAAATGCCTTACGCAAAAGCGGACAGTTTTGTGATGTAAAACTACAGGTCTGCGGCCATGAGATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTTAACAGTGACGGTGAATCTCATGGTATTTCCCTTGTCAGATTTGATGACTTAAATCCAGACGCTGTTGAAGTCTTATTAAATTATGCGTATACATCTCAGCTTAAAGCGGAGACAGACCTTGTTAAAGATGTATACTCTGCAGCAAAAAAGCTTAAGATTGATCGAGTAAAACAGGTGTGTGGAGATTACTTACTATCAAAAATAGATGTTCAGAGCTGCATTTCTTATCGTAATTTTGTAAATGCAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGAGGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTTTCACTTCCCAGCAACGGTAAACTGTATACAAAGGTAATCAACTGGGTTCAGCGGAGCATATGGGAGAATGGCGAAAATCTGGATGCCCTATTGGAAGAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCCGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAGTATGATCCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGGTAATGGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTTTGGTTGGAAGGTTCAAATCCATATGGGCCAGAAAGGCCTTAAAAACTGGTGACGTGTTTGACCCCATAACAAGGATGTGGGACATGTTGTGCCCAGCTAAACATTAGAAAGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATGAAAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                    Xt7.1-TGas125j18.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AATCCCCGGGGTGGGATGCAGTGTAGCTCTGTGGCATCGGCCGGCTTGACATTACAGTGTCGGGACTGTGGTGTGGCGCAAGGTACACACAGGAAAATGGTTCCCAACGGATCTTTAAATTTTGAAGATGAACAGTTTATTGAGTCGTCTGTGGCTAAATTAAATGCCTTACGCAAAAGCGGACAGTTTTGTGATGTAAAACTACAGGTCTGCGGCCATGAGATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTTAACAGTGACGGTGAATCTCATGGTATTTCCCTTGTCAGATTTGATGACTTAAATCCAGACGCTGTTGAAGTCTTATTAAATTATGCGTATACATCTCAGCTTAAAGCGGAGACAGACCTTGTTAAAGATGTATACTCTGCAGCAAAAAAGCTTAAGATTGATCGAGTAAAACAGGTGTGTGGAGATTACTTACTATCAAAAATAGATGTTCAGAGCTGCATTTCTTATCGTAATTTTGTAAATGCAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGAGGATTTTCTTAAACTCCCTTTTTTTACCAATAAAACTGGAGAAAGGGTGAAAAAAAAAAAAAAAAAAAAAAAA------------CCACGCGTCCGCTCTTGCCCCACTGTATTGTAGATACTGGTACTGAATGTGTTTCTTTTATGAAACTTTATTTTATACTAATGTATATTAAGAGTATCTTGTATGTGTCTTTGTATACATCTGTGCTTCTGTCATATCTCGTATCTCCTTTTTCTTTTATTTACTTTATTTTTTCCTGTTTCTCCTTTTTTTTTTTTTTCTTTTTTTTTTTTTGGGTTTAACACCCCCACTCCTACCTATTGGAAAATGAAGATTTCTTCAAGAAGATTTGAGTTATTAGAAGATTGACATCATGCAATATAATTTTTTTTGATTGAAAGTTTTCCAAGTGGAATCTTTACTCACAATGAAGATAACGTGGATTATAGGATCACAAATAATAATATTTTTAGAAGAAGTATCCATATGGCTTTCATTTCTATTTTGCAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCAGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGTTGGAGGATTTGATGGTACCCATGCTCTAAGTTGTGTCGAATCATATGACCCCGAAAGAAACGAGTGGAAGATGATGGGGAGTATGACCTCTGCAAGAAGCAATGCAGGAATGGTTGCTGTAGGGGATCAAATATATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAATTGAAGTTTATAACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTACTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTAAATAAAATTGACTGTAAATGAAAAAAAAAAAAAAAA
  5   1   2                                         Xt7.1-TTpA070d09.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCTGTGGCATCGGCCGGCTTGACATTACAGTGTCGGGACTGTGGTGTGGCGCAAGGTACACACAGGAAAATGGTTCCCAACGGATCTTTAAATTTTGAAGATGAACAGTTTATTGAGTCGTCTGTGGCTAAATTAAATGCCTTACGCAAAAGCGGACAGTTTTGTGATGTAAAACTACAGGTCTGCGGCCATGAGATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTTAACAGTGACGGTGAATCTCATGGTATTTCCCTTGTCAGATTTGATGACTTAAATCCAGACGCTGTTGAAGTCTTATTAAATTATGCGTATACATCTCAGCTTAAAGCGGAGACAGACCTTGTTAAAGATGTATACTCTGCAGCAAAAAAGCTTAAGATTGATCGAGTAAAACAGGTGTGTGGAGATTACTTACTATCAAAAATAGATGTTCAGAGCTGCATTTCTTATCGTAATTTTGTAAATGCAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGAGGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTTTCACTTCCCAGCAACGGTAAACTGTATACAAAGGTAATCAACTGGGTTCAGCGGAGCATATGGGAGAATGGCGAANATCTGGATGCCCTATT------------CATATGGGAGAATGGCGAAAATCTGGATGCCNTATTGGAAGAGGTTAGTCTGGCAAGGGAAACAACTGTAATACATGTAGGTTCCTAGGAAAGTCATTTTTTTACTACTAATTCAATTGTCCTTTTATGATAATCAGAGCCCAAAGTAAAGAAAGTATCTGTTTTCAGTTCAAAACTGGTAGGTTTGCAGGTGAGACTGAATCTTATTTTCCCAAAACAAATCTTATGCTCTTTTCCCATGGACCCCCCCCTTTCACTTTTTCACTGTTTTAAAGCTCTAACATTTTTTGATTGAAAATTACTATAGACCTTCAACATTTCCTTGCAGGTTTAATGCTTGAATTGGTCCGTTTCTTTAGAAAATTTCTAATAGTTTTTTCCTCCCCGTTGATTATATTTTCATAGGTTATTTAACAAAAGTAGGATACCCAAGATGGAAGATCAAAGAAGATACCTCAAGGTTAAACCGTATTGAAGCTCAAGTCTGCCCTATGCCTTCTAAGAACATCCACTCTGGGCAGAGAACCATGATGATGATTTAATGGTGTTTACTCCTTTTACAGGATTTGTGTGACATGTACAGTCTAAATTTTTCTAACTAAGAATTGCCTGCCTTTTTTCTTACTGATACAAAAGAAGGCATTTATAAGATTACCATTGTGTTGGTTAATTTATAATTTTTTTTTTTTTTTAGAAACCAACATAAGGGTGGTTTTATATTCATAACTTCTTACCAGGCATACAATTATAGTAAAGGTTGCATGCACCAGCAGTTTTAAGATTTGTATATTT
  5   1   2  SIG                                    Xt7.1-TTpA077m18.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCTGTGGCATCGGCCGGCTTGACATTCCATTGTCGGGACTGTGGTGTGGCGCAAGGTACACACAGGAAAATGGTTCCCAACGGATCTTTAAATTTTGAAGATGAACAGTTTATTGAGTCGTCTGTGGCTAAATTAAATGCCTTACGCAAAAGCGGACAGTTTTGTGATGTAAAACTACAGGTCTGCGGCCATGAGATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTTAACAGTGACGGTGAATCTCATGGTATTTCCCTTGTCAGATTTGATGACTTAAATCCAGACGCTGTTGAAGTCTTATTAAATTATGCGTATACATCTCAGCTTAAAGCGGAGACAGACCTTGTTAAAGATGTATACTCTGCAGCAAAAAAGCTTAAGATTGATCGAGTAAAACAGGTGTGTGGAGATTACTTACTATCAAAAATAGATGTTCAGAGCTGCATTTCTTATCGTAATTTTGTAAATGCAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGAGGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTTTCACTTCCCAGCAACGGTAAACTGTATACAAAGGTAATCAACTGGGTTCAGCGGAGCATATGGGAGAATGGCGAANATCTGGATGCCCTATTGGAAGAGGTTATTTAACAAAAGTAGGATACCCAAGATGGAAGATCAAAGAAGATACCTCAAGGTTAAACCGTATTGAAGCTCAAGTCTGCCCTATGCCTTCTAAGAACATCCACTCTGGGCAGAGAACCATGATGATGATTTAATGGTGTTTACTCCTTTTACAGGATTTGTGTGACATGTACAGTCTAAATTTTTCTAACTAAGAATTGCCTGCCTTTTTTCTTACTGATACAAAAGAAGGCATTTATAAGATTACCATTGTGTTGGTTAATTTATAATTTTTTTTTTTTTTAGAAACCAACATAAGGGTGGTTTTATATTCATAACTTCTTACCAGGCATACAATTATAGTAAAGGTTGCATGCACCAGCAGTTTTAAGATTTGTATATTTAAAGAAAAAAAAATATATGTATATTGAATTTTATTCAAGCACTAAAATTCAAAGGAATAAATGCATTTAGTACTGATGTCAATGATGACTTGCTATACTTTTTATTTGAATGCCCTACAATGTACACAAAGGTTAATCCATGTGTAGTGTGCACATTTATTATAATACTGATACCATTTTTTTAACCCACTTTCTGTACCACAGAGTACTTTAACCCAAAAGGCATTACAGTTATCTGTGATGGTATAAAATTTGGAAATAGTTACTTTTGGTAAAAACAAATTCCCACACACTCTTCACCTAAAAAAGCAACTGGCTAGAATATTGTAAAGGCTGAATATTAAGCATAACTTATTGGTACAGACACCTTACTAGAATTGTATTCCTTCAAGTTCATCTAAAATTATTTTAACCTGTAGAATTGTGTAAATGTTTAATTTAATGTGCATTTGTGCATGTACATTATACAAAAAAATCTAATTTGTTCTGGGCTTTTTATGACATTATGTAAAAAAACTGGCTTAATGCAGGCCCACCACCGTAAAAAATTTATATATATTCTAAAGGAAAACTAACACCTAGAATTGGAAAAGGCAATACTTAAGTGCTGCACTTATCTTCTATTTTCTATGTAGGGCAAAGAAGAATTAAAAATAGCCTCTGTCTGTGATGTGTTTGCTGTGGTAGCTGACCCTAGTTAGAGGCATAATTGAGAAGGAAAAGGGACCATAAACAATTTAGAGCTGTTGCAAAGCTGCTTAGAAATCTTTAGAGAATACAATCATACAAGTTGTTTTAAGTGAAATAGCGTAAAATAAA
  5   1   2  SIG                                      Xt7.1-CABC9222.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCGAGGTACATACCCCTGCAAAATGGACAGTTTTTGTTTAATTTAAAAAAAAAAACAACCCTGATAAATCCTTTCACAACCTTAGTGGTCAGGGAGGTCTACGGCAACAGAAAAGGGGCTGCAGGATTTCTTGGTATGTATTGGTTGTTCCCTACATGTGACAACAGTCAGTTGTATTCTTCATCATATCTGGGTTCTGGAGTAGGGTAGCAAGACCAAATCATTTACTCACAAAAAAAAAAAACATCCAAACAGGTATACCCAGTCTCCAACATGTATTATGTTTTATGGTCTGATGAGACCAAGGTTGAACTGTTTGGCCATAATTCCAAAATGTATGTTTGGCACAAAAATAACACAGAACGCCATCACAAGAACACCATACCCATAGTTAAGCATGGCGGAGGCATCATGCTATGGGCTGCATTTCATCAGCTGGAACTGGTGGTTTAGTCAAGATGGATGGAATCATGAATAGATCGGCCTATTTTGTAAGAACTTTCAATCGTCTGCTAGGAAGCTGAAGATGAAGAACTTCAACTTCAGCATAACAATAGCCCAAAGTGTACATCTAAATCAACAAAGCAATGGCTTCTTGGTAACTTTTGCAAGGAGTGGGCAAAAATTGCAGAGTCTATATGTCCCAAAAAGACTGAGTGCTGTAATAAAATCAAAAGGGGCTTCAACCAAGTATTAGTTTAAGGGGTGAGCACACAGGTTTTTGTATGGTCTATGTTTTCCTTCACTAAACTGTTTTCAGCTTCTTTGTATAGTTGTCAATAGCTGGCTTAAGTTCTGACAGGATTTATATCCAGTGTACTTATGTATGCAATGTGTAGGGTTTCCCACCAGCAATTACAGTCACATTACTGCTGGTGAGAGGGAAACTGTTTTGTTGCCACAGTAGCACAGTAGCCCATTGTCCTAAAGCTTTGTTTAGCTAGTTTAGTGATTATAGCTCCTTTATACAAAAAAATGCCTTAAAAACAAATGATTTCATGCAAACTGTAAACAATATAATGTGTGTGTAACCTTCCATGTGGATTAGATTTATTTGGAAGAACACATTTATTTTTTCAATTTACTTTGATGCACTAAATATTAATATTTAACGTTTTGTGTGCAGCACAATTTCTCAGTGCAACGTATTGGTTATTCTAGTGTTCAAGAGTTTATAGCCTGTGCATCTACCAAACTGTAAAGGTAATTATTTAAAGAGGTTTTATAATGTTTTTCTTAATCTATTCCTGAAGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGTTGGAGGATT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTGGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACCCCCACTCCTACCTATTGGAAAATGAAGATTTCTTCAAGAAGATTTGAGTTATTAGAAGATTGACATCATGCAATATAATTTTTTTTGATTGAAAGTTTTCCAAGTGGAATCTTTACTCACAATGAAGATAACGTGGATTATAGGATCACAAATAATAATATTTTTAGAAGAAGTATCCATATGGCTTTCATTTCTATTTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TACCCAAGATGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGTAACTTTTGC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTAAACCGTATTGAAGCTCAAGTCTGCCCTATGCCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAAAGACTGAGTGCTGTAATAAAATCAAAAGGGGCTTCAACCAAGTATTAGTTTAAGGGGTGAGCACACAGGTTTTTGTATGGTCTATGTTTTCCTTCACTAAACTGTTTTCAGCTTCTTTGTATAGTTGTCAATAGCTGGCTTAAGTTCTGACAGGATTTATATCCAGTGTACTTATGTATGCAATGTGTAGGGTTTCCCACCAGCAATTACAGTCACATTACTGCTGGTGAGAGGGAAACTGTTTTGTTGCCACAGTAGCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGTTCATCTAAAATTATTTTAACC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TATTGCAGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGTTGGAGGATTTGATGGTACCCATGCTCTAAGTTGTGTCGAATCATATGACCCCGAAAGAAACGAGTGGAAGATGATGGGGAGTATGACCTCTGCAAGAAGCAATGCAGGAATGGTTGCTGTAGGGGATCAAATATATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAATTGAAGTTTATAACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTACTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATGAAAAAAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GC----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----T-------
                                               BLH ATG     583    1399                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                               BLH MIN     577     226                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                               BLH MPR     397     226                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                               BLH OVR     502      81                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                               CDS MIN     502     226                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                               ORF LNG     502      34                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Ci ---- 1e-010     BAE06323.1 transcription factor protein [Ciona intestinalis] =========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Dm ---- 6e-070     NP_524989.2 diablo CG6224-PA [Drosophila melanogaster] ----------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ce ---- 6e-073     NP_510109.1 influenza virus NS1A binding protein like (90.9 kD) (XN244) [Caenorhabditiselegans] --------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Sp ---- 1e-091     XP_780296.2 PREDICTED: similar to Ivns1abp protein [Strongylocentrotus purpuratus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Xt ==== 1e-123     AAI35206.1 Unknown (protein for MGC:121898) [Xenopus tropicalis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Dr ==== 0          NP_958891.1 influenza virus NS1A binding protein b [Danio rerio] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Hs ==== 0          NP_006460.2 influenza virus NS1A binding protein; NS1-binding protein; likely ortholog ofmouse kelch family protein Nd1 [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Mm ==== 0          NP_473443.2 influenza virus NS1A binding protein isoform 2 [Mus musculus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED = Gg ==== 0          XP_424470.2 PREDICTED: similar to mKIAA0850 protein [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Xl ==== 0          AAH76641.1 Ivns1abp-prov protein [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === ?? ==== 0          NP_001086493.1 influenza virus NS1A binding protein [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABK7170.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAG---------------------TAA------------------------------------TAA------------------------------------------------TAA---------------------------------------ATG---------------------TAA---------------------------TAG---------------------------------------------------TAA------------------ATG------------------TAG------------------------------------------------TGA---------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG---------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATGATG------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------------------TAGTAA------------------------------TAA---------------------------------------------------------------TAA------------------------------------TAA------------TAA---------------------------------------------------------------------------------ATG---------------ATG---TGA---------------------------------------------------TGAATG------------------TAG---------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATGTAG---------------------------------------------------ATG---TGA---------------------------------------------------------TAG------TGA------TGA---------TAG------------------------------------------------------------------------------------------ATG---------------TAA---TGA---------------------------------TAA---------------------------TGATAG------------------------------------------------------------------TAA------------------ATG---------------------TAG---------------------------------------------------------------------------------------------------------------------------------TAA------------------TAA------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
  5   1   2  SIG                                      Xt7.1-CABK7170.3                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGTTTAGATGGATAATCAGACCTCACTCTTGCCTTCCACCTATAGGTGCACACCTATGTTGTATATATCTGTAGGTGGCTTACAGTTCATTTAAATAAAGGCTCTGTGCCAGCAGTGGTTGGACTTTTTTAGTTTAAGCCTCCCTTGGTGGTGCAACCTTCATTCAGGCCCCCTTTCATTTATGGTAAGGTTATAGATATAGGAAAATATTAGTGAGTCAGCCATGCATGCACATTTCCAAGAATATCAAATAAGTACTTTTCTTTTACATAGATTCAGTATAGAAATTCATATCATTGGAATATGTGCAAACACCTGTATTGGTAATTTTAGTATAAATATGTTTTGGGTGCGTAATGTTGAGTTTTTACTATAATTAGCATGTAAATTCCTGCGACTGTGGGGAAAAATACCTAGAAACCCTCGGATGAAGCACAAAAGAATTGTTGTTTTTTGTTAGTCTTCATAATGGCCTTTTATTGAAGACTTTTTTTGTTCTGTAGAGGTTTTCCAGGACATTTAAAAAAATGGTTTGATTTTGGGAGAAATGGTTTGTGGATTTTTTGATTATTTTAAACAGAAACTTTTTAACTCCCCCTTGATTTGTCATCTTTAGATTAATCATTCTGTTTAGGTGTTAGTTTTCCTTTGACATTTACATTTGAGTTGAGGCTATTTGTTTTGCATCTTGATTGGAGTGAGCATGATAAAAGGGCAACTTTTACTCCCCAATACATATTTAGTATGGTAACCGATTATGAATTTTAACAGTCTTTGCTAAGTAAGCATATTTTGATACTGCAGAACTGTATGTATAAACTTGTTTGCCCTCTTGCCCCCACTGTATTGTAGATACTGGTACTGAATGTGTTTCTTTTATGAAACTTTATTTTATACTAATGTATATTAAGAGTATCTTGTATGTGTCTTTGTATACATCTGTGCTTCTGTCATATCTCGTATCTCCTTTTTCTTTTATTTACTTTATTTTTTCCTGTTTCTCCTTTTTTTTTTTTTTTTCTTTTTTTTTTTTTGTGTTTAACACCCCCACTCCTACCTATTGGAAAATGAAGATTTCTTCAAGAAGATTTGAGTTATTAGAAGATTGACATCATGCAATATAATTTTTTTTGATTGAAAGTTTTCCAAGTGGAATCTTTACTCACAATGAAGATAACGTGGATTATAGGATCACAAATAATAATATTTTTAGAAGAAGTATCCATATGGCTTTCATTTCTATTTTGCAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCCGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGTTGGAGGATTTGATGGTACCCATGCTCTAAGTTGTGTCGAATCATATGACCCCGAAAGAAACGAGTGGAAGATGATGGGGAGTATGACCTCTGCAAGAAGCAATGCAGGAATGGTTGCTGTAGGGGATCAAATATATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAATTGAAGTTTATAACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATGAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008272724                                                                                                                                                                                                                                                                                                                                                                                                                                        AGATGGATAATCAGACCTCACTCTTGCCTTCCACCTATAGGTGCACACCTATGTTGTATATATCTGTAGGTGGCTTACAGTTCATTTAAATAAAGGCTCTGTGCCAGCAGTGGTTGGACTTTTTTAGTTTAAGCCTCCCTTGGTGGTGCAACCTTCATTCAGGCCCCCTTTCATTTATGGTAAGGTTATAGATATAGGAAAATATTAGTGAGTCAGCCATGCATGCACATTTCCAAGAATATCAAATAAGTACTTTTCTTTTACATAGATTCAGTATAGAAATTCATATCATTGGAATATGTGCAAACACCTGTATTGGTAATTTTAGTATAAATATGTTTTGGGTGCGTAATGTTGAGTTTTTACTATAATTAGCATGTAAATTCCTGCGACTGTGGGGAAAAATACCTAGAAACCCTCGGATGAAGCACAAAAGAATTGTTGTTTTTTGTTAGTCTTCATAATGGCCTTTTATTGAAGACTTTTTTTGTTCTGTAGAGGTTTTCCAGGACATTTAAAAAAATGGTTTGATTTTGGGAGAAATGGTTTGTGGATTTTTTGATTATTTTAAACAGAAACTTTTTAACTCCCCCTTGATTTGTCATCTTTAGATTAATCATTCTGTTTAGGTGTTAGTTTTCCTTTGACATTTACATTTGAGTTGAGGCTATTTGTTTTGCATCTTGATTGGAGTGAGCATGATAAAAGGGCAACTTTTACTCCCCAATACATATTTAGTATGGTAACCGATTATGAATTTTAACAGTCTTTGCTAAGTAAGCATATTTTGATACTGCAGAACTGTATGTATAAACTTGTTTGCCCTCTTGCCCCxxxxxxATTGTAGATACTGGTACTGAATGTGTTTCTTTTATGAAACTTTATTTTATACTAATGTATATTAAGAGTATCTTGTATGTGTCTTTGTATACATCTGTGCTTCTGTCATATCTCGTATCTCCTTTTTCTTTTxTTxxxTTxxTTTTTTCCTGTTTCTCCTTTTTTTTTTTTTTTTCTTTTTTTTTTTTTGTGTTTAACACCCCCACTCCTACCTATTGGAAAATGAAGATTTCTTCAAGAAGATTTGAGTTATTAGAAGATTGACATCATGCAATATAATTTTTTTTGATTGAAAGTTTTCCAAGTGGAATCTTTACTCACAATGAAGATAACGTGGATTATAGGATCACAAATAATAATATTTTTAGAAGAAGTATCCATATGGCTTTCATTTCTATTTTGCAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCCGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGTTGGAGGATTTGATGGTACCCATGCTCTAAGTTGTGTCGAATCATATGACCCCGAAAGAAACGAGTGGAAGATGATGGGGAGTATGACCTCTGCAAGAAGCAATGCAGGAATGGTTGCTGTAGGGGATCAAATATATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAATTGAAGTTTATAACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATGAAAAAAAAAAAAAAA
  5   1   2       ext Te1       in                         CBWN8001.b1 AGAATACAATCATACAAGTTGTTTTAAGTGAAATAGCCGTTAAAAAAAAAAAATCACTTTCGTATTTCAACAAATTCATGTTTTTAAGGCAACACGCTTCAAAGGGCAGGAATGTGTAGGAAACTTTTATAGAGAAGGAGAAAGGCAAAGGTACTTAGCTCAGAGCTGCTGTTCAGTGTATTGCATTTCGTGGATATTGTCTCATGACCTCCAATTCCCAAAAGATGTGTACAGGGATCACCTGTGTTAGGATTTATGCAAGGGTTGTATCCAGGAAGTACTTCTTGGCCTGTCCTTTTTCCCTGTGTCACAGAGGTCTATCTCTGTGTATTAGTTTTAGCATTAATCTGGTAATCTGTTGGCTTCATTTATGCATTTCAGATGATTTTCCATATTTGCTAACACTAACCAATTGAGATGTTTAGATGGATAATCAGACCTCACTCTTGCCTTCCACCTATAGGTGCACACCTATGTTGTATATATCTGTAGGTGGCTTACAGTTCATTTAAATAAAGGCTCTGTGCCAGCAGTGGTTGGACTTTTTTAGTTTAAGCCTCCCTTGGTGGTGCAACCTTCATTCAGGCCCCCTTTCATTTATGGTAAGGTTATAGATATAGGAAAATATTAGTGAGTCAGCCATGCATGCACATTTCCAAGAAT
  5   1   1       add Ovi1      in                         CABI5508.5p                                                                                                                                                                                                         CTCATGACTTCCAATTCCCAAAAGATGTGTACAGGGATCACCTGTGTTAGGATTTATGCAAGGGTTGTATCCAGGAAGTACTTCTTGGCCTGTCCTTTTTCCCTGTGTCACAGAGGTCTATCTCTGTGTATTAGTTTTAGCATTAATCTGGTAATCTGTTGGCTTCATTTATGCATTTCAGATGATTTTCCATATTTGCTAACACTAACCAATTGAGATGTTTAGATGGATAATCAGACCTCACTCTTGCCTTCCACCTATAGGTGCACACCTATGTTGTATATATCTGTAGGTGGCTTACAGTTCATTTAAATAAAGGCTCTGTGCCAGCAGTGGTTGGACTTTTTTAGTTTAAGCCTCCCTTGGTGGTGCAACCTTCATTCAGGCCCCCTTTCATTTATGGTAAGGTTATAGATATAGGAAAATATTAGTGAGTCAGCCATGCATGCACATTTCCAAGAATATCAAATAAGTACTTTTCTTTTACATAGATTCAGTATAGAAATTCATATCATTGGAATATGTGCAAACACCTGTATTGGTAATTTTAGTATAAATATGTTTTGGGTGCGTAATGTTGAGTTTTTACTATAATTAGCATGTAAATTCCTGCGACTGTGGGGAAAAATACCTAGAAACCCTCGGATGAAGCACAAAAGAATTGTTGTTTTTTGTTAGTCTTCATAATGGCCTTTTATTGAAGACTTTTTTTGTTCTGTAGAGGTTTTCCAGGACATTTAANAAAATGGTTTGTGATTTTGGGAGAAATGGTTTGTGGATTTTTTGATTATTTTAAACAGAAACTTTTTAACTCCCCCTTGATTTGTCATCTTTAGATTAATCATTCTGTTTAGGTGTTAGTTTTCCTTTGACATTTACATTTGAGTTGAGGCTATTTGTTTTGCATCTTGATG
  5   1   2       ext Gas7                                 XZG43791.5p                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGTTTAGATGGATAATCAGACCTCACTCTTGCCTTCCACCTATAGGTGCACACCTATGTTGTATATATCTGTAGGTGGCTTACAGTTCATTTAAATAAAGGCTCTGTGCCAGCAGTGGTTGGACTTTTTTAGTTTAAGCCTCCCTTGGTGGTGCAACCTTCATTCAGGCCCCCTTTCATTTATGGTAAGGTTATAGATATAGGAAAATATTAGTGAGTCAGCCATGCATGCACATTTCCAAGAATATCAAATAAGTACTTTTCTTTTACATAGATTCAGTATAGAAATTCATATCATTGGAATATGTGCAAACACCTGTATTGGTAATTTTAGTATAAATATGTTTTGGGTGCGTAATGTTGAGTTTTTACTATAATTAGCATGTAAATTCCTGCGACTGTGGGGAAAAATACCTAGAAACCCTCGGATGAAGCACAAAAGAATTGTTGTTTTTTGTTAGTCTTCATAATGGCCTTTTATTGAAGACTTTTTTTGTTCTGTAGAGGTTTTCCAGGACATTTAAAAAAATGGTTTGATTTTGGGAGAAATGGTTTGTGGATTTTTTGATTATTTTAAACAGAAACTTTTTAACTCCCCCTTGATTTGTCATCTTTAGATTAATCATTCTGTTTAGGTGTTAGTTTTCCTTTGACATTTACATTTGAGTTGAGGCTATTTGTTTTGCATCTTGATTGGAGTGAGCATGATAAAAGGGCAACTTTTACTCCCCAATACATATTTAGTATGGTAACCGATTATGAATTTTAACAGTCTTTGCTAAGTAAGCATATTTTGATACTGCAGAACTGTATGTATAAACTTGTTTGCCCTCTTGCCCCACTGTATT
  5   1   2   10  ext Ova1 5g3  in                        CABE13724.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TAAAAGGGCAACTTTTACTCCCCAATACATATTTAGTATGGTAACCGATTATGAATTTTAACAGTCTTTGCTAAGTAAGCATATTTTGATACTGCAGAACTGTATGTATAAACTTGTTTGCCCTCTTGCCCCACTGTATTGTAGATACTGGTACTGAATGTGTTTCTTTTATGAAACTTTATTTTATACTAATGTATATTAAGAGTATCTTGTATGTGTCTTTGTATACATCTGTGCTTCTGTCATATCTCGTATCTCCtttttcttttatttactttattttttcctgtttctccttttttttttttttttctttttttttttttGGGTTTAACACCCCCACTCCTACCTATTGGAAAATGAAGATTTCTTCAAGAAGATTTGAGTTATTAGAAGATTGACATCATGCAATATAATTTTTTTTGATTGAAAGTTTTCCAAGTGGAATCTTTACTCACAATGAAGATAACGTGGATTATAGGATCACAAATAATAATATTTTTAGAAGAAGTATCCATATGGCTTTCATTTCTATTTTGCAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCNGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTA
  5   1   4   10 seed Spl1 5g3  in                         CABK7170.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATTTAGTATGGTAACCGATTATGAATTTTAACAGTCTTTGCTAAGTAAGCATATTTTGATACTGCAGAACTGTATGTATAAACTTGTTTGCCCTCTTGCCCCACTGTATTGTAGATACTGGTACTGAATGTGTTTCTTTTATGAAACTTTATTTTATACTAATGTATATTAAGAGTATCTTGTATGTGTCTTTGTATACATCTGTGCTTCTGTCATATCTCGTATCTCCtttttcttttatttactttattttttcctgtttctcctttttttttttttttttctttttttttttttGTGTTTAACACCCCCACTCCTACCTATTGGAAAATGAAGATTTCTTCAAGAAGATTTGAGTTATTAGAAGATTGACATCATGCAATATAATTTTTTTTGATTGAAAGTTTTCCAAGTGGAATCTTTACTCACAATGAAGATAACGTGGATTATAGGATCACAAATAATAATATTTTTAGAAGAAGTATCCATATGGCTTTCATTTCTATTTTGCAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCT
  5   1   3   22   nb Tad5 5g                              XZT67567.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGACGCGTGGGCTGTGCTTCTGTCATATCTCGTATCTCCtttttcttttatttactttattttttcctgtttctccttttttttttttttcttttttttttttGTGTTTAACACCCCCACTCCTACCTATTGGAAAATGAAGATTTCTTCAAGAAGATTTGAGTTATTAGAAGATTGACATCATGCAATATAATTTTTTTTGATTGAAAGTTTTCCAAGTGGAATCTTTACTCACAATGAAGATAACGTGGATTATAGGATCACAAATAATAATATTTTTAGAAGAAGTATCCATATGGCTTTCATTTCTATTTTGCAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGC
  5   1   3   10   nb Int1 5g3  in                         CAAP7589.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCCACTCCTACCTATTGGAAAATGAAGATTTCTTCAAGAAGATTTGAGTTATTAGAAGATTGACATCATGCAATATAATTTTTTTTGATTGAAAGTTTTCCAAGTGGAATCTTTACTCACAATGAAGATAACGTGGATTATAGGATCACAAATAATAATATTTTTAGAAGAAGTATCCATATGGCTTTCATTTCTATTTTGCAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCAGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGAT
  5   1   3   10   nb Ski1 5g3  in                          CABJ551.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAAAATGAAGATTTCTTCAAGAAGATTTGAGTTATTAGAAGATTGACATCATGCAATATAATTTTTTTTGATTGAAAGTTTTCCAAGTGGAATCTTTACTCACAATGAAGATAACGTGGATTATAGGATCACAAATAATAATATTTTTAGAAGAAGTATCCATATGGCTTTCATTTCTATTTTGCAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCCGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAGTATGATCCCAAATCAACGTTTGGATATCTGTCCCTGAGCTAAGAAGC
  5   1   3   10   nb Ovi1 5g3  in                        CABI10973.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TATTAGAAGATTGACATCATGCAATATAATTTTTTTTGATTGAAAGTTTTCCAAGTGGAATCTTTACTCACAATGAAGATAACGTGGATTATAGGATCACAAATAATAATATTTTTAGAAGAAGTATCCATATGGCTTTCATTTCTATTTTGCAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCAGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAAGCACCG
  5   1   3   10   nb Thy1 PIPE in                        CBST4180.fwd ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TAGGATCACAAATAATAATATTTTTAGAAGAAGTATCCATATGGCTTTCATTTCTATTTTGCAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCAGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCANACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTCAAT
  3  -1   3        nb Spl1      in                         CABK2501.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTGCAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCCGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCNCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGA
  5   1   2       ext Spl1      in                         CABK9226.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCCGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAAACTAGGCAACAGATGTACATTATTGGAGGAGCTGAAATCTGGAATTGTCTAAATTCAGTAGAAATGTTACATCCTGAAAATGACA
  5   1   3        nb Gas7      in                         XZG41758.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAGATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCCGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCC
  5   1   2       ext Te1       in                         CBWN9009.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAATATACAATTGATTCAGAAAAAGTCCCCACNGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCCGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTT
  5   1   3        nb Eye       in                         CCAX2084.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCCGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGG
  5   1   3        nb Gas       in                   TGas051g18.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCCGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTT
  5   1   2       ext Egg       in                   TEgg038n08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCCGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGA
  5   1   3        nb Egg                            TEgg106g07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCCGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTT
  5   1   2       add Liv1      in                         CAAR4825.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGAACTCTCAAGGTGATAGCAAGGGCTTGTTGCCTGTGCAAGAGGTGATTTCCTCTAGATGAAAAAGCCTCCTATCTGCCATCACTCTGATCGATCCATGTGGTCCTCTTGGGTCCAAGAAAGATTGGAGATGCCTTCCTCTGGATCAACTAGCATTGATGCAAGTTTTATGTCCTGTTTTTTTTCAACCTCATGTTATTTAATAAGATTTAAATAACAATATAAATGTAGTTATAAATTAAAAATTACAAATACATAACCTACTGAAACCGAGAACAGAGAATAAAGTTGTTTTTATCTATTTTAGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGTTGGAGGATTTGATGGTACCCATGCTCTAAGTTGTGTCGAATCATATGACCCCCGAAAGAAACGAGTGG
  5   1   2       add Egg                            TEgg086a09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTCTTTTTGCGGATCCATCGATTCGAATTCCCCGGGTACGAACAGCAGAATTAAATGGCAAACTTATTGCCGCACGTGGCTATAACACAGAATAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCATGTCTGATGGACCATCTGTATGCTGTTGGACGGTCAAATGGTCACTCTCATGACCTCAACTGTGGACAAGAGTATGATCCCCCATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTACGGCAATGCTGGTGTCTGCGCTCTCAATGGGAAATTATATG
  5   1   3        nb Tad5                                 XZT10762.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCAGCAGGTGGCTATAGCAGAGAAGAATGTCTGAGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGTTGGAGGATTTGATGGTACCCATGCTCTAAGTTGTGTCGAATCATATGACCNCGANAGANACGAG
  3   1   3        nb Int1 5g3  in                         CAAP7589.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCAGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGTTGGAGGATTTGATGGTACCCATGCTCTAAGTTGTGTCGAATCATATGACCCCGAAAGAAACGAGTGGAAGATGATGGGGAGTATGACCTCTGCAAGAAGCAATGCAGGAATGGTTGCTGTAGGGGATCAAATATATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAATTGAAGTTTATAACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCC
  3  -1   3        nb Sto1      in                         CABG3087.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATAGGGCGAGAGGCCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGTTGGAGGATTTGATGGTACCCATGCTCTAAGTTGTGTCGAATCATATGACCCCGAAAGAAACGAGTGGAAGATGATGGGGAGTATGACCTCTGCAAGAAGCAATGCAGGAATGGTTGCTGTAGGGGATCAAATATATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAATTGAAGTTTATAACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCAT
  5   1   2       ext Gas7      in                         XZG34736.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCGATTCCAATGGCAGTTCTGATGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGTTGGAGGATTTGATGGTACCCATGCTCTAAGTTGTGTCGAATCATATGACCCCGAAAGAAACGAGTGGAAGATGATGGGGAGTATGACCTCTGCAAGAAGCAATGCAGGAATGGTTGCTGTAGGGGATCAAATATATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAATTGAAGTTTATAACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTC
  5   1   3        nb Egg                            TEgg121o14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGTTGGAGGATTTGATGGTACCCATGCTCTAAGTTGTGTCGAATCATATGACCCCGAAAGAAACGAGTGGAAGATGATGGGGAGTATGACCTCTGCAAGAAGCAATGCAGGAATGGTTGCTGTAGGGGATCAAATATATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAATACAATTGAAG
  5   1   3        nb Spl2      in                        CBSS7693.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGTTGGAGGATTTGATGGTACCCATGCTCTAAGTTGTGTCGAATCATATGACCCCGAAAGAAACGAGTGGAAGATGATGGGGAGTATGACCTCTGCAAGAAGCAATGCAGGAATGGTTGCTGTAGGGGATCAAATATATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAATTGAAGTTTATAACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGT
  5   1   3        nb Fat1      in                         CABC6407.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGTTGGAGGATTTGATGGTACCCATGCTCTAAGTTGTGTCGAATCATATGACCCCGAAAGAAACGAGTGGAAGATGATGGGGAGTATGACCTCTGCAAGAAGCAATGCAGGAATGGTTGCTGTAGGGGATCAAATATATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAATTGAAGTTTATAACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAA
  5   1   3        nb Gas7                                 XZG15665.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGGACGCGTGGGGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGTTGGAGGATTTGATGGTACCCATGCTCTAAGTTGTGTCGAATCATATGACCCCGAAAGAAACGAGTGGAAGATGATGGGGAGTATGACCTCTGCAAGAAGCAATGCAGGAATGGTTGCTGTAGGGGATCAAATATATGCTGCAGGTGGTTTTGATGCCAATGAATTCTTAAATACAATTGAAGTTTATAACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTA
  5   1   2       add Gas7      in                         XZG27679.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGGACGCGTGGGTCGCCCACGCGTCCGCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGTTGGAGGATTTGATGGTACCCATGCTCTAAGTTGTGTCGAATCATATGACCCCGAAAGAAACGAGTGGAAGATGATGGGGAGTATGACCTCTGCAAGAAGCAATGCAGGAATGGTTGCTGTAGGGGATCAAATATATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAATTGAAGTTTATAACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTT
  5   1   3        nb Spl2      out                       CBSS8595.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAAAGGCCTTAAAAACCGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGTTGGAGGATTTGATGGTACCCATGCTCTAAGTTGTGTCGAATCATATGACCCCGAAAGAAACGAGTGGAAGATGATGGGGAGTATGACCTCTGCAAGAAGCAATGCAGGAATGGTTGCTGTAGGGGATCAAATATATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAATTGAAGTTTATAACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTGT
  3  -1   3        nb Sto1      in                         CABG4526.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGAGGCAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGTTGGAGGATTTGATGGTACCCATGCTCTAAGTTGTGTCGAATCATATGACCCCGAAAGAAACGAGTGGAAGATGATGGGGAGTATGACCTCTGCAAGAAGCAATGCAGGAATGGTTGCTGTAGGGGATCAAATATATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAATTGAAGTTTATAACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAG
  5   1   3        nb Gas                            TGas028n12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTAGAAGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGTTGGAGGATTTGATGGTACCCATGCTCTAAGTTGTGTCGAATCATATGACCCCGAAAGAAACGAGTGGAAGATGATGGGGAGTATGACCTCTGCAAGAAGCAATGCAGGAATGGTTGCTGTAGGGGATCAAATATATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAATTGAAGTTTATAACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTT
  5   1   3        nb Egg                            TEgg051o22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGGATTTGATGGTACCCATGCTCTAAGTTGTGTCGAATCATATGACCCCGAAAGAAACGAGTGGAAGATGATGGGGAGTATGACCTCTGCAAGAAGCAATGCAGGAATGGTTGCTGTAGGGGATCAAATATATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAATTGAAGTTTATAACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAA
  5   1   3        nb Limb      in                        CBSU5439.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TACCCATGCTCTAAGTTGTGTCGAATCATATGACCCCGAAAGAAACGAGTGGAAGATGATGGGGAGTATGACCTCTGCAAGAAGCAATGCAGGAATGGTTGCTGTAGGGGATCAAATATATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAATTGAAGTTTATAACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTGTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTANAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCGGTGGCAGGCACAAGGAATTTGTCACACTTTATTAATGTATTTATC
  5   1   3        nb Gas7      in                         XZG29246.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGAGTGGAAGATGATGGGGAGTATGACCTCTGCAAGAAGCAATGCAGGAATGGTTGCTGTAGGGGATCAAATATATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAATTGAAGTTTATAACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATAT
  5   1   3        nb Egg                            TEgg100n11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACCTCTGCAAGAAGCAATGCAGGAATGGTTGCTGTAGGGGATCAAATATATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAATTGAAGTTTATAACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTA
  5   1   3        nb Egg                            TEgg086c15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGTTTTGATGGCAATGAATTCTTAAATACAATTGAAGTTTATAACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGC
  3   1   3        nb Ovi1 5g3  in                        CABI10973.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTTGATGGCAATGATTTCTTAAATACAATTGAAGTTTATAACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTACTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCG
  3   1   4      seed Spl1 5g3  in                         CABK7170.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATACAATGAAAGTTTATAACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATGAAAAAAAAA
  5  -1   3        nb Sto1      in                         CABG4526.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TACAATGAAAGTTTATAACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATGAAAAAAAAAAAAACCTCGG
  5  -1   3        nb Spl1      in                         CABK2501.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAAT
  5  -1   3        nb AbdN                               IMAGE:7022163                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGTCCCATTTACACCCCCTGGGGCAAATCCCAGGTAATCCCTCATTTCTCATCAGATCTGCTTGGGCTAAAGTCCCTTCATGTTTGTTGTACCCCGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATGAAAAAAAAAAAAAAAAAAAAAAAAAG
  5  -1   3        nb Sto1      in                         CABG3087.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGCTTAAGTCCCTCATGTTTGTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATGAAAAAAAA
  3   1   3        nb Ski1 5g3  in                          CABJ551.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTTCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGT
  3   1   2       ext Spl1      in                         CABK9226.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATG
  3   1   2       add Ovi1      in                         CABI5508.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTACTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTAAATAAAATTGACTGTAAATG
  3   1   2       ext Egg       in                    TEgg038n08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Ova1 5g3  in                        CABE13724.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATG
  3   1   3        nb Gas7      in                         XZG41758.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CATCAGATCTGCTTGGGCTAAGTCCCTCATGTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGT
  5   1   3        nb Gas                            TGas100e12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTCTTATATAC
  3   1   2       add Gas7      in                         XZG27679.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAAGTCCCTCATGTTTGTGTACCCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATG
  3   1   3        nb Fat1      in                         CABC6407.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACGTAAAAG
  3  -1   3        nb Ova1      in                        CABE13649.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACTAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATGAAAAAAAAA
  5  -1   3        nb Ova1      in                        CABE13649.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACTAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATGAAAAAAAAA
  3   1   3        nb Gas7      in                         XZG29246.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATG
  5   1   3        nb Egg                            TEgg018d06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAAGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAATATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAAGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAAGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTT
  5   1   3        nb Thy1      in                        CBST5228.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTCCCCCACTTCTAATGTACATTATTCTTAAATAAAAATGACTGT
  3   1   3        nb Thy1 PIPE in                        CBST4180.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATG
  3   1   3        nb Thy1      in                        CBST5228.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTCCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATG
  3   1   3        nb Tad5      in                         XZT38723.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CATATTTTCAAAAAGTTGTAAATACTTATTTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATG
  5   1   3        nb Tad5      in                         XZT38723.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATG
  5   1   2       add HdA       out                 THdA002m10.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGCTGGACCCAAGGGTGATCGTGGTGAGGGTGTAATTTGTCAGAAAGAAAGGTTAAAATCGCTTGTGCGAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACACCGATTTGATTTTTTTGATACTTTCTGCAAGCATTCTTGTGTATGTGCTCGCTCTGTTCCTACAGCACTGACCTGCAGAATTCCAGTTACTGAGTACATACGCAATCTTCCACCGTTTTAATTGAATGCAGGTGAGTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTACTGAATCGACATTTTTGAGTAAAGAAGTGCCGGTATGCCGAAACACGCACCTTTTGGATTGCCTTTTTATGACTGTTTTATATACTCGGTGGCAAGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCTAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTACGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAACCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTCCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAA
  5   1   3        nb Egg0      in                         dad76e10.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGGGGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGGGGTTGCAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTATAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCA
  3   1   3        nb Spl2      in                        CBSS7693.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTCCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATG
  3   1   2       ext Gas7      in                         XZG34736.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTTTATTTGTAGAAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATG
  3   1   2       add Liv1      in                         CAAR4825.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATG
  3   1   3        nb Eye       in                         CCAX2084.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGGAAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCCCCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATG
  3   1   3        nb Brn4                                CAAL22351.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCCCTCTGTAAAGG
  3   1   2       ext Te1       in                         CBWN8001.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATGAAAAAAAAAAAAAAA
  3   1   3        nb Gas       in                    TGas051g18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCCTCGAAACGAGGGAGAAAAAAAACGTTCAATAACTTTTTTTCCCCCCCTTCTAATGTACACTTTTTCTTAAATAAAATTGACTGTAAATAAAAAAAAAAAA
  3   1   2       ext Te1       in                         CBWN9009.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATGAAAAAAAAAAAAAAAAGAAAAAAAAAAAAAAA
  5   1   2       ext Brn4                                CAAL18888.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTCCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaanaaaa
  5   1   3        nb Egg       in                  TEgg049p19.p1kSP6w                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTTTTAAATAAAATTGACTGTAAATG
  3   1   3        nb Egg       in                    TEgg049p19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTTTTAAATAAAATTGACTGTAAAGAAAAAAAAAAAAAAAAA
  3   1   3        nb Egg       ?                     TEgg003a18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAATCATGCGCCTTGGGGATTGGCCTTTTTATTACTGTTTTATATACTCGGCGGCAGGCACAAGGAATTGTCAACACTCTATGAATGTATTTATCCTTAAAGCTGCGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAGATGCAATTTTTACTCTTTAAACAAAGGAATGTCGTGAAATGCAGAGCCCGAAGCCAGTTGTTTAGAAACAGATTTGTTTGCAAATACTCATTTGTAGAGTCTTTGACCAAACGGAATCATTTTGTAGGCAGTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAGACAAGGAAGAAAAAAAACATTCAATGAGTTTTTTTTCCCCACTTCTAATGTACATTATTCGTAAATAAAATTGTCTTTAAACGAAAAAAAGAAAAAAAAAA
  3   1   3        nb Limb      in                        CBSU5439.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATTGCTTTTTTATTACTGTTTTATATACTCGGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACCGCTGCAGTCTTTTCAAATGCATTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATG
  3   1   3        nb Egg0      in                         dad76e10.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAAAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAAT
  3   1   3        nb Gas       ?                     TGas137j18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTTCTTAAATAAAATTGACTGTAAATGAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                    Xt7.1-THdA013a21.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGTTGCTAGGCAGGAAGCGTGCGAGTGCTGCTGGCGCCATCTCCTTGGTTTCGCGCGTTCCCGTGTGGGATGCAGTGTAGCTCTGTGGCATCGGCCGGCTTGACATTACAGTGTCGGGACTGTGGTGTGGCGCAAGGTACACACAGGAAAATGGTTCCCAACGGATCTTTAAATTTTGAAGATGAACAGTTTATTGAGTCGTCTGTGGCTAAATTAAATGCCTTACGCAAAAGCGGACAGTTTTGTGATGTAAAACTACAGGTCTGCGGCCATGAGATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTTAACAGTGACGGTGAATCTCATGGTATTTCCCTTGTCAGATTTGATGACTTAAATCCAGACGCTGTTGAAGTCTTATTAAATTATGCGTATACATCTCAGCTTAAAGCGGAGACAGACCTTGTTAAAGATGTATACTCTGCAGCAAAAAAGCTTAAGATTGATCGAGTAAAACAGGTGTGTGGAGATTACTTACTATCAAAAATAGATGTTCAGAGCTGCATTTCTTATCGTAATTTTGTAAATGCAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGAGGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTTTCACTTCCCAGCAACGGTAAACTGTATACAAAGGTAATCAACTGGGTTCAGCGGAGCATATGGGAGAATGGCGAAAATCTGGATGCCCTATTGGAAGAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCCGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAGTATGATCCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGGTAATGGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTTTGGTTGGAAGGTTCAAATCCATATGGGCCAGAAAGGCCTTAAAAACTGGTGACGTGTTTGACCCCATAACAAGGATGTGGGACATGTTGTGCCCAGCTAAACATTAGAAAGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATGAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008272718                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTAGGCAGGAAGCGTGCGAGTGCTGCTGGCGCCATCTCCTTGGTTTCGCGCGTTCCCGTGTGGGATGCAGTGTAGCTCTGTGGCATCGGCCGGCTTGACATTACAGTGTCGGGACTGTGGTGTGGCGCAAGGTACACACAGGAAAATGGTTCCCAACGGATCTTTAAATTTTGAAGATGAACAGTTTATTGAGTCGTCTGTGGCTAAATTAAATGCCTTACGCAAAAGCGGACAGTTTTGTGATGTAAAACTACAGGTCTGCGGCCATGAGATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTTAACAGTGACGGTGAATCTCATGGTATTTCCCTTGTCAGATTTGATGACTTAAATCCAGACGCTGTTGAAGTCTTATTAAATTATGCGTATACATCTCAGCTTAAAGCGGAGACAGACCTTGTTAAAGATGTATACTCTGCAGCAAAAAAGCTTAAGATTGATCGAGTAAAACAGGTGTGTGGAGATTACTTACTATCAAAAATAGATGTTCAGAGCTGCATTTCTTATCGTAATTTTGTAAATGCAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGAGGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTTTCACTTCCCAGCAACGGTAAACTGTATACAAAGGTAATCAACTGGGTTCAGCGGAGCATATGGGAGAATGGCGAAAATCTGGATGCCCTATTGGAAGAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCCGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTxxGxxxAAAGTAxxxxxCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGGTAATGGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTTTGGTTGGAAGGTTCAAATCCATATGGGCCAGAAAGGCCTTAAAAACTGGTGACGTGTTTGACCCCATAACAAGGATGTGGGACATGTTGTGCCCAGCTAAACATTAGAAAGCACCAGTCTGCTGTTTGTGAACTAGGCAACA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATGAAAAAAAAAAAAAA
  5   1   2       ext Egg  5g                        TEgg067o23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGGACTCAATTCAGGGTGCCGAAGCCGCCCGCCTCCGCTCCTAAGGCGTGACGCCAGCTGTTGCTAGGCAGGAAGCGTGCGAGTGCTGCTGGCGCCATCTCCTTGGTTTCGCGCGTTCCCGTGTGGGATGCAGTGTAGCTCTGTGGCATCGGCCGGCTTGACATTACAGTGTCGGGACTGTGGTGTGGCGCAAGGTACACACAGGAAAATGGTTCCCAACGGATCTTTAAATTTTGAAGATGAACAGTTTATTGAGTCGTCTGTGGCTAAATTAAATGCCTTACGCAAAAGCGGACAGTTTTGTGATGTAAAACTACAGGTCTGCGGCCATGAGATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTTAACAGTGACGGTGAATCTCATGGTATTTCCCTTGTCAGATTTGATGACTTAAATCCAGACGCTGTTGAAGTCTTATTAAATTATGCGTATACATCTCAGCTTAAAGCGGAGACAGACCTTGTTAAAGATGTATACTCTGCAGCAAAAAAGCTTAAGATTGATCGAGTAAAACAGGTGTGTGGAGATTACTTACTATCAAAAATAGATGTTCAGAGCTGCATTTCTTATCGTAATTTTGTAAATGCAATGGGAGATTGGCGCCTTTTA
  5   1   2       ext Egg  5g                        TEgg124a05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGTTGCTAGGCAGGAAGCGTGCGAGTGCTGCTGGCGCCATCTCCTTGGTTTCGCGCGTTCCCGTGTGGGATGCAGTGTAGCTCTGTGGCATCGGCCGGCTTGACATTACAGTGTCGGGACTGTGGTGTGGCGCAAGGTACACACAGGAAAATGGTTCCCAACGGATCTTTAAATTTTGAAGATGAACAGTTTATTGAGTCGTCTGTGGCTAAATTAAATGCCTTACGCAAAAGCGGACAGTTTTGTGATGTAAAACTACAGGTCTGCGGCCATGAGATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTTAACAGTGACGGTGAATCTCATGGTATTTCCCTTGTCAGATTTGATGACTTAAATCCAGACGCTGTTGAAGTCTTATTAAATTATGCGTATACATCGCAGCTTAAAGCGGAGACAGACCTTGTTAAAGATGTATACTCTGCAGCAAAAAAGCTTAAGATTGATCGAGTAAAACAGGTGTGTGGAGATTACTTACTATCAAAAATAGATGTTCAGAGCTGCATTTCTTATCGTAATTTTGTAAATGCAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGC
  5   1   2   12  ext Gas7 5g3  in                         XZG40373.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAGAGTGCGAGTGCTGCTGGCGCCATCTCCTTGGTTTCGCGCGTTCCCGTGTGGGATGCAGTGTAGCTCTGTGGCATCGGCCGGCTTGACATTACAGTGTCGGGACTGTGGTGTGGCGCAAGGTACACACAGGAAAATGGTTCCCAACGGATCTTTAAATTTTGAAGATGAACAGTTTATTGAGTCGTCTGTGGCTAAATTAAATGCCTTACGCAAAAGCGGACAGTTTTGTGATGTAAAACTACAGGTCTGCGGCCATGAGATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTTAACAGTGACGGTGAATCTCATGGTATTTCCCTTGTCAGATTTGATGACTTAAATCCAGACGCTGTTGAAGTCTTATTAAATTATGCGTATACATCTCAGCTTAAAGCGGAGACAGACCTTGTTAAAGATGTATACTCTGCAGCAAAAAAGCTTAAGATTGATCGAGTAAAACAGGTGTGTGGAGATTACTTACTATCAAAAATAGATGTTCAGAGCTGCATTTCTTATCGTAATTTTGTAAATGCAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGAGGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAG
  5   1   2       add Gas8      in                          st81o15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGTTTGTAGTGAGTTAGTGGAGGAGGGCAGCCTTCCGCTGCTGAAGTGAGGACGTGAGAGAATGATACACTAGGAGATGGCGTCATGTGCTTGAGTGCATGGCAAGGTACACACAGGAAAATGGTTCCCAACGGATCTTTAAATTTTGAAGATGAACAGTTTATTGAGTCGTCTGTGGCTAAATTAAATGCCTTACGCAAAAGCGGACAGTTTTGTGATGTAAAACTACAGGTCTGCGGCCATGAGATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTTAACAGTGACGGTGAATCTCATGGTATTTCCCTTGTCAGATTTGATGACTTAAATCCAGACGCTGTTGAAGTCTTATTAAATTATGCGTATACATCTCAGCTTAAAGCGGAGACAGACCTTGTTAAAGATGTATACTCTGCAGCAAAAAAGCTTAAGATTGATCGAGTAAAACAGGTGTGTGGAGATTACTTACTATCAAAAATAGATGTTCAGAGCTGCATTTCTTATCGTAATTTTGTAAATGCAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGAGGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTTTCACTTCCCAGCAACGGTAAACTGTATACNAAGGTAATCAACTGGG
  5   1   0       chi Egg       in                   TEgg052e06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCGGGCTTGGTTTCGCGCGTTCCCGTGTGGGATGCAGTGTAGCTCTGTGGCATCGGCCGGCTTGACATTACAGTGTCGGGACTGTGGTGTGGCGCAAGGTACACACAGGAAAATGGTTCCCAACGGATCTTTAAATTTTGAAGATGAACAGTTTATTGAGTCGTCTGTGGCTAAATTAAATGCCTTACGCAAAAGCGGACAGTTTTGTGATGTAAAACTACAGGTCTGCGGCCATGAGATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTTAACAGTGACGGTGAATCTCATGGTATTTCCCTTGTCAGATTTGATGACTTAAATCCAGACGCTGTTGAAGTCTTATTAAATTATGCGTATACATCTCAGCTTAAAGCGGAGACAGACCTTGTTAAAGATGTATACTCTGCAGCAAAAAAGCTTAAGATTGATCGAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGAGGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTTTCACTTCCCAGCAACGGTAAACTGTATACAAAGGTAATCAACTGGGTT
  5   1   2       add Gas8                                  st83h07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGTGAGTTAGTGGAGGAGGGCAGCCTTCCGCTGCTGAAGTGAGGACGTGAGAGAATGATACACTANGAGATGGCGTCATGTGCTTGAGTGCATGGCAAGGTACACACAGGAAAATGGTTCCCANCGGATCTTTAAATTTTGAAGATGAACAGTTTATTGAGTCGTCTGTGGCTAAATTAAATGCCTTACGCAAAAGCGGACAGTTTTGTGATGTAAAACTACAGGTCTGCGGCCATGAGATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTTAACAGTGACGGTGAATCTCATGGTATTTCCCTTGTCAGATTTGATGACTTAAATCCAGACGCTGTTGAAGTCTTATTAAATTATGCGTATACATCTCAGCTTAAAGCGGAGACAGACCTTGTTAAAGATGTATACTCTGCAGCAAAAAAGCTTAAGATTGATCGAGTAAAACAGGTGTGTGGAGATTACTTACTATCAAAAATAGATGTTCAGAGCTGCATTTCTTATCGTAATTTTGTAAATGCAATGGGAGATTGNCGCCTTTT
  5   1   3   24   nb Brn2 5g                             CAAJ22667.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGCGCGTTCCCGTGTGGGATGCAGTGTAGCTCTGTGGCATCGGCCGGCTTGACATTACAGAGTCGGGACTGTGGTGTGGCGCAAGGTACACACAGGAAAATGGTTCCCAACGGATCTTTAAATTTTGAAGATGAACAGTTTATTGAGTCGTCTGTGGCTAAATTAAATGCCTTACGCAAAAGCGGACAGTTTTGTGATGTAAAACTACAGGTCTGCGGCCATGAGATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTTAACAGTGACGGTGAATCTCATGGTATTTCCCTTGTCAGATTTGATGACTTAAATCCAGACGCTGTTGAAGTCTTATTAAATTATGCGTATACATCTCAGCTTAAAGCGGAGACAGACCTTGTTAAAGATGTATACTCTGCAGCAAAAAAGCTTAAGATTGATCGAGTAAAACAGGTGTGTGGAGATTACTTACTATCAAAAATAGATGTTCAGAGCTGCATTTCTTATCGTAATTTTGTAAATGCAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGAGGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTTTCACTTCCCAGCAACGGTAAACTGTATACAAAGGTAAATCACTGGGTTCAGCGGAGCATATGGGAGAATGGCGAAAATCTGGATGCCCTATT
  5   1   2   10  ext Thy1 5g3  in                        CBST4337.fwd ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGCGCGTTCCCGTGTGGGATGCAGTGTAGCTCTGTGGCATCGGCCGGCTTGACATTACAGTGTCGGGACTGTGGTGTGGCGCAAGGTACACACAGGAAAATGGTTCCCAACGGATCTTTAAATTTTGAAGATGAACAGTTTATTGAGTCGTCTGTGGCTAAATTAAATGCCTTACGCAAAAGCGGACAGTTTTGTGATGTAAAACTACAGGTCTGCGGCCATGAGATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTTAACAGTGACGGTGAATCTCATGGTATTTCCCTTGTCAGATTTGATGACTTAAATCCAGACGCTGTTGAAGTCTTATTAAATTATGCGTATACATCTCAGCTTAAAGCGGAGACAGACCTTGTTAAAGATGTATACTCTGCAGCAAAAAAGCTTAAGATTGATCGAGTAAAACAGGTGTGTGGAGATTACTTACTATCAAAAATAGATGCTCAGAGCTGCATTTCTTATCGTAATTTTGTAAATGCAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGAGGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTTTCACTTCCCAGCAACGGTAAACTGTATACAAAGGTAATCAACTGGGTTCAGCGGAGCATATGGGAGAATGGCGAANATCTGGATGCCCTATTGGAAGAGGTACAAACATTGT
  5   1   2       ext Egg       in                   TEgg052e14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTAGCTCTGTGGCATCGGCCGGCTTGACATTACAGTGTCGGGACTGTGGTGTGGCGCAAGGTACACACAGGAAAATGGTTCCCAACGGATCTTTAAATTTTGAAGATGAACAGTTTATTGAGTCGTCTGTGGCTAAATTAAATGCCTTACGCAAAAGCGGACAGTTTTGTGATGTAAAACTACAGGTCTGCGGCCATGAGATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTTAACAGTGACGGTGAATCTCATGGTATTTCCCTTGTCAGATTTGATGACTTAAATCCAGACGCTGTTGAAGTCTTATTAAATTATGCGTATACATCTCAGCTTAAAGCGGAGACAGATCTTGTTAAAGATGTATACTCTGCAGCAAAAAAAGCTTAAGATTGATCGAGTAAAACAGGTGTGTGGAGATTACTTACTATCAAAAATAGATGTTCAGAGCTGCATTTCTTATCGTAATTTTGTAAATGCAATGGGAGATTGGCGCCTTTTAAGTAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGA
  5   1   3        nb Limb      in                        CBSU5387.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTGGCANNTCGGCCGGCTTGACATTACAGTGTCGGGACTGTGGTGTGGCGCAAGGTACACACAGGAAAATGGTTCCCAACGGATCTTTAAATTTTGAAGATGAACAGTTTATTGAGTCGTCTGTGGCTAAATTAAATGCCTTACGCAAAAGCGGACAGTTTTGTGATGTAAAACTACAGGTCTGCGGCCATGAGATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTTAACAGTGACGGTGAATCTCATGGTATTTCCCTTGTCAGATTTGATGACTTAAATCCTGACGCTGTTGAAGTCTTATTAAATTATGCGTATACATCTCAGCTTAAAGCGGAGACAGACCTTGTTAAAGATGTATACTCTGCAGCAAAAAAGCTTAAGATTGATCGAGTAAAACAGGTGTGTGGAGATTACTTACTATCAAAAATAGATGTTCAGAGCTGCATTTCTTATCGTAATTTTGTAAATGCAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGAGGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTTTCACTTCCCAGCAACGGTAAACTGTATACAAAGGTAATCAACTGGGTTCAGCGGAGCATATGGGAGAATGGCGAANATCTGGATGCCCTATTGGAAGAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAAGACAATATANCATTG
  5   1   2       ext Egg       in                   TEgg002c08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCGGCCGGCTTGACATTACAGTGTCGGGACTGTGGTGTGGCGCAAGGTACACACAGGAAAATGGTTCCCAACGGATCTTTAAATTTTGAAGATGAACAGTTTATTGAGTCGTCTGTGGCTAAATTAAATGCCTTACGCAAAAGCGGACAGTTTTGTGATGTAAAACTACAGGTCTGCGGCCATGAGATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTTAACAGTGACGGTGAATCTCATGGTATTTCCCTTGTCAGATTTGATGACTTAAATCCAGACGCTGTTGAAGTCTTATTAAATTATGCGTATACATCTCAGCTTAAAGCGGAGACAGACCTTGTTAAAGATGTATACTCTGCAGCAAAAAAGCTTAAGATTGATCGAGTAAAACAGGTGTGTGGAGATTACTTACTATCAAAAATAGATGTTCAGAGCTGCATTTCTTATCGTAATTTTGTAAATGCAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGAGGATTTTCTTAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTTTCACTTCCCAGCAACGGTAAACTGTATACAAAGGTAATCAAC
  5   1   4      seed Ova1 5g3  in                         CABE4396.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTGGCGCAGGTACACACAGGAAAATGGTTCCCAACGGATCTTTAAATTTTGAAGATGAACAGTTTATTGAGTCGTCTGTGGCTAAATTAAATGCCTTACGCAAAAGCGGACAGTTTTGTGATGTAAAACTACAGGTCTGCGGCCATGAGATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTTAACAGTGACGGTGAATCTCATGGTATTTCCCTTGTCAGATTTGATGACTTAAATCCAGACGCTGTTGAAGTCTTATTAAATTATGCGTATACATCTCAGCTTAAAGCGGAGACAGACCTTGTTAAAGATGTATACTCTGCAGCAAAAAAGCTTAAGATTGATCGAGTAAAACAGGTGTGTGGAGATTACTTACTATCAAAAATAGATGTTCAGAGCTGCATTTCTTATCGTAATTTTGTAAATGCAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGAGGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTTTCACTTCCCAGCAACGGTAAACTGTATACAAAGGTAATCAACTGGGTTCAGCGGAGCATATGGGAGAATGGCGAANATCTGGATGCCCTATTGGAAGAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGC
  5   1   3        nb Gas                            TGas045g21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCCGGGTTGTGATGTAAAACTACAGGTCTGCGGCCATGAGATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTTAACAGTGACGGTGAATCTCATGGTATTTCCCTTGTCAGATTTGATGACTTAAATCCAGACGCTGTTGAAGTCTTATTAAATTATGCGTATACATCTCAGCTTAAAGCGGAGACAGACCTTGTTAAAGATGTATACTCTGCAGCAAAAAAGCTTAAGATTGATCGAGTAAAACAGGTGTGTGGAGATTACTTACTATCAAAAATAGATGTTCAGAGCTGCATTTCTTATCGTAATTTTGTAAATGCAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGAGGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTTTCACTTCCCAGCAACGGTAAACTGTATACAAAGGTAATCAACTGGGTTCAGCGGAGCATATGGGAGAATGGCGAAAATCTGGATGCCCTATTGGAAGAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATG
  5   1   0       chi Gas7                                 XZG12040.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGAATTTTTACAGTGACGGTGAATCTCATGGTATTTCCCTTGTCAGATTTGATGACTTAAATCCAGACGCTGTTGAAGTCTTATTAAATTATGCGTATACATCTCAGCTTAAAGCGGAGACAGACCTTGTTAAAGATGTATACTCTGCAGCAAAAAAGCTTAAGATTGATCGAGTAAAACAGGTGTGTGGAGATTACTTACTATCAAAAATAGATGTTCAGAGCTGCATTTCTTATCGTAATTTTGTAAATGCAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGAGGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTTTCACTTCCCAGCATATGGGAGAATGGCGAAAATCTGGATGCCCTATTGGAAGAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGNACGAAACAGCCCCGTAAACTCTCCATCCAGTACCCCTCGACTA
  5   1   0       add Egg                            TEgg123b10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTATTAAATTATGCGTATACATCTCAGCTTAAAGCGGAGACAGCAAAAAAGCTTAAGATTGATCGAGTAAAACAGGTGTGTGGAGATTACTTACTATCAAAAATAGATGTTCAGAGCTGCATTTCTTATCGTAATTTTGTAAATGCAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGAGGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTTTCACTTCCCAGCAACGGTAAACTGTATACAAAGGTAATCAACTGGGTTCAGCGGAGCATATGGGAGAATGGCGAAAATCTGGATGCCCTATTGGAAGAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATT
  3   1   2       add Gas8      in                          st81o15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGTAATTTTGTAAATGCAATGGGNGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGNGCATTTTNTTGNGATTTTTGNGCNGGNGGNTTTTTTTAAACTCCCNAGNCTGAACCNGGAAATAATGCTAGAAGAAAATGTTTCNCTTCCCNGCAACGGTAAACNGTATACAAAGGTAATCAACTGGGTTCAGCGGNGCNTNTGGGNGAATGGNGAAAATCTGGATGCCCTNTTGGAAGNGGTTNTTTAACAAAAGTNGGNTNCCCNAGNTGGAAGNTCAAAGAAGNTACCNCAAGGTTAAACCGTNTTGAAGCTCAAGTNTGCCCTNTGCCTTNTAAGAACNTCCCCTNTGGGCNGNGAACCCTGNTGNTGATTTAATGGNGTTTACTCCTTTTNCCGGATTTGTGNGACNTGTNCCGTNTAAATTTTTNTAACTAAGAATTGCCNGCCTTTTTTNTTACTGATACAAAAGAAGGCNTTTNTAAGNTTACCCTTGNGTTGGNTAATTTATAATTTTTTTTTTTTTTAGAAACCAACATAAGGGTGGTTTTATATTCATAACTTCTTACCAGGCATACAATATAGAAAGGTG
  5   1   3        nb Gas7      in                         XZG58973.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGTAAATGCAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGAGGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTTTCACTTCCCAGCAACGGTAAACTGTATACAAAGGTAATCAACTGGGTTCAGCGGAGCATATGGGAGAATGGCGAAAATCTGGATGCCCTATTGGAAGAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCANACTTATTGCCGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCAT
  3  -1   2       add Ovi1      in                         CABI5268.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGAGGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTTTCACTTCCCAGCAACGGTAAACTGTATACAAAGGTAATCAACTGGGTTCAGCGGAGCATATGGGAGAATGGCGAAAATCTGGATGCCCTATTGGAAGAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATT
  5   1   2       ext Egg       in                   TEgg026m09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAAAATGTTTCACTTCCCAGCAACGGTAAACTGTATACAAAGGTAATCAACTGGGTTCAGCGGAGCATATGGGAGAATGGCGAAAATCTGGATGCCCTATTGGAAGAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAATGGCAAACTTATTGCCGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAA
  5   1   2       ext Brn3      in                         CAAK7025.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAATGTTTCACTTCCCAGCAACGGTAAACTGTATACAAAGGTAATCAACTGGGTTCAGCGGAGCATATGGGAGAATGGCGAAAATCTGGATGCCCTATTGGAAGAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCAGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTNCATGNGAAATTATATG
  5   1   3        nb Egg                            TEgg113k03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAAACTGTATACAAAGGTAATCAACTGGGTTCAGCGGAGCATATGGGAGAATGGCGAAAATCTGGATGCCCTATTGGAAGAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCCGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGAT
  5   1   3        nb Egg                            TEgg123d12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAAACTGTATACAAAGGTAATCAACTGGGTTCAGCGGAGCATATGGGAGAATGGCGAAAATCTGGATGCCCTATTGGAAGAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCCGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGA
  5   1   2       ext Gas       in                   TGas124m10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGAAAATCTGGATGCCCTATTGGAAGAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCCGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGAT
  5   1   2       ext HdA       in                  THdA013a21.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTCTATTTTGCAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCCGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAANAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGGTAATGGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTTTGGTTGGAAGGTTCAAATCCATATGGGCCAGAAAGGCCTTAAAAACTGGTGACGTGTTTGACCCCATAACAAGGATGTGGGACATGTTGTGCCCAGCTAAACATTAGAAAGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTA
  3   1   2       ext HdA       in                    THdA013a21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTCCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATGAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       ext Brn3      in                         CAAK7025.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATG
  3   1   4      seed Ova1 5g3  in                         CABE4396.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAAT
  3   1   3        nb Limb      in                        CBSU5387.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTAAGTCCCTCATGTTTGTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTGTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCGGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACCGCTGCAGTCTTTTCAAATGCATTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATG
  3   1   2       ext Gas       in                    TGas124m10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTTTGCAAGCATTCTTGGGTAAAAGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTTTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCCCCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTTTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCCCCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTCCCCCACTTCTAATGTACATTATTTTTAAATAAAATTGGCTGTAAATGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Egg       in                    TEgg026m09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTCCCTCATGTTTGTTGTACCAGCAACGTANCGTTTTTNGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATGAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Thy1 5g3  in                        CBST4337.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTCCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATG
  3   1   2       add Egg       in                    TEgg052e06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTTCATTTATTTGTAGAAGGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACGTAAATGAAAAAAAAAAAAAAAAA
  3   1   2       ext Gas7 5g3  in                         XZG40373.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTTGTAAGAAGGAAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATG
  3   1   2       ext Egg       in                    TEgg002c08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCGCCCACTTCTAGATGTACATTATTCTTAAATAAAATTGACTGTAAATGAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas7      in                         XZG58973.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCCCCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCCCCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATG
  3   1   2       ext Egg       in                    TEgg052e14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTTTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCCCCAACAATATTTTTTCATTGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTTTAATGTACATTATTTTTAAATAAAATTGACTGTAAATGAAAAAAAAAAAAAAAAAAgcggccgcttttttttttttttttttacgtacgtttcttttatttgaaactttttatacgaagagtcaaaaattcttccccaaaaaaacgtttccaaaaaagtaaaaaaaaaaaaaaaa
  5   1   2  SIG                                    Xt7.1-TGas125j18.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AATCCCCGGGGTGGGATGCAGTGTAGCTCTGTGGCATCGGCCGGCTTGACATTACAGTGTCGGGACTGTGGTGTGGCGCAAGGTACACACAGGAAAATGGTTCCCAACGGATCTTTAAATTTTGAAGATGAACAGTTTATTGAGTCGTCTGTGGCTAAATTAAATGCCTTACGCAAAAGCGGACAGTTTTGTGATGTAAAACTACAGGTCTGCGGCCATGAGATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTTAACAGTGACGGTGAATCTCATGGTATTTCCCTTGTCAGATTTGATGACTTAAATCCAGACGCTGTTGAAGTCTTATTAAATTATGCGTATACATCTCAGCTTAAAGCGGAGACAGACCTTGTTAAAGATGTATACTCTGCAGCAAAAAAGCTTAAGATTGATCGAGTAAAACAGGTGTGTGGAGATTACTTACTATCAAAAATAGATGTTCAGAGCTGCATTTCTTATCGTAATTTTGTAAATGCAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGAGGATTTTCTTAAACTCCCTTTTTTTACCAATAAAACTGGAGAAAGGGTGAAAAAAAAAAAAAAAAAAAAAAAA------------CCACGCGTCCGCTCTTGCCCCACTGTATTGTAGATACTGGTACTGAATGTGTTTCTTTTATGAAACTTTATTTTATACTAATGTATATTAAGAGTATCTTGTATGTGTCTTTGTATACATCTGTGCTTCTGTCATATCTCGTATCTCCTTTTTCTTTTATTTACTTTATTTTTTCCTGTTTCTCCTTTTTTTTTTTTTTCTTTTTTTTTTTTTGGGTTTAACACCCCCACTCCTACCTATTGGAAAATGAAGATTTCTTCAAGAAGATTTGAGTTATTAGAAGATTGACATCATGCAATATAATTTTTTTTGATTGAAAGTTTTCCAAGTGGAATCTTTACTCACAATGAAGATAACGTGGATTATAGGATCACAAATAATAATATTTTTAGAAGAAGTATCCATATGGCTTTCATTTCTATTTTGCAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCAGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGTTGGAGGATTTGATGGTACCCATGCTCTAAGTTGTGTCGAATCATATGACCCCGAAAGAAACGAGTGGAAGATGATGGGGAGTATGACCTCTGCAAGAAGCAATGCAGGAATGGTTGCTGTAGGGGATCAAATATATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAATTGAAGTTTATAACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTACTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTAAATAAAATTGACTGTAAATGAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008272708                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGGGGTGGGATGCAGTGTAGCTCTGTGGCATCGGCCGGCTTGACATTACAGTGTCGGGACTGTGGTGTGGCGCAAGGTACACACAGGAAAATGGTTCCCAACGGATCTTTAAATTTTGAAGATGAACAGTTTATTGAGTCGTCTGTGGCTAAATTAAATGCCTTACGCAAAAGCGGACAGTTTTGTGATGTAAAACTACAGGTCTGCGGCCATGAGATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTTAACAGTGACGGTGAATCTCATGGTATTTCCCTTGTCAGATTTGATGACTTAAATCCAGACGCTGTTGAAGTCTTATTAAATTATGCGTATACATCTCAGCTTAAAGCGGAGACAGACCTTGTTAAAGATGTATACTCTGCAGCAAAAAAGCTTAAGATTGATCGAGTAAAACAGGTGTGTGGAGATTACTTACTATCAAAAATAGATGTTCAGAGCTGCATTTCTTATCGTAATTTTGTAAATGCAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGAGGATTTTCTTAAACTCCCTTTTTTTACCAATAAAACTGGAGAAAGGGTGAAAAAAAAAAAAAAAAAA------------------------GTCCGCTCTTGCCCCACTGTATTGTAGATACTGGTACTGAATGTGTTTCTTTTATGAAACTTTATTTTATACTAATGTATATTAAGAGTATCTTGTATGTGTCTTTGTATACATCTGTGCTTCTGTCATATCTCGTATCTCCTTTTTCTTTTATTTACTTTATTTTTTCCTGTTTCTCCTTTTTTTTTTTTTTCTTTTTTTTTTTTTGGGTTTAACACCCCCACTCCTACCTATTGGAAAATGAAGATTTCTTCAAGAAGATTTGAGTTATTAGAAGATTGACATCATGCAATATAATTTTTTTTGATTGAAAGTTTTCCAAGTGGAATCTTTACTCACAATGAAGATAACGTGGATTATAGGATCACAAATAATAATATTTTTAGAAGAAGTATCCATATGGCTTTCATTTCTATTTTGCAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCAGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGTTGGAGGATTTGATGGTACCCATGCTCTAAGTTGTGTCGAATCATATGACCCCGAAAGAAACGAGTGGAAGATGATGGGGAGTATGACCTCTGCAAGAAGCAATGCAGGAATGGTTGCTGTAGGGGATCAAATATATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAATTGAAGTTTATAACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTACTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTAAATAAAATTGACTGTAAATGAAAAAAAAAAAAAAAAAAAAAA
  5   1   4      seed Gas  5x   in                   TGas125j18.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCGCCCGCCTCCGCTTCCTAAGGCGTGAAGCCAGCCTGTTGCTAGGCAGGAAGCGTGCGTGTTCTGGAAGATGCGAGTGCCGCTGGCGCCATCTCCTTTGGTTTCGCGCCGTTCCCGTGTGGGAAGCAGTGTAGCTCTGTGGCATCGGCCGGCTTGACATTTACAGTGTCGGGACCTGTGGTGGTGGCGCCAAGGTACACACAGGAAAATGGTTCCCAACGGATCTTTAAATTTTGAAGATGAACAGTTTATTGAGTCGTCTGTGGCTAAATTAAATGCCTTACGCAAAAGCGGACAGTTTTGTGATGTAAAACTACAGGTCTGCGGCCATGAGATGCTGGCACACAGGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTTAACAGTGACGGTGAATCTCATGGTATTTCCCTTGTCAGATTTGATGACTTAAATCCAGACGCTGTTTGAAGTCTTATTAAATTATGCGTATACATCTCAGCTTAAAGCGGAGACAGACCTTGTTAAAGATGTATACTCTGCAGCAAAAAAGCTTAAGATTGATCGAGTAAACAGGGTGTGTGGAGATTACTTACTATCAAAAATAGATGTTCAGAGCTGCATTTCTTATCGTAATTTTGTAAATGCAATGGGGAGATTGGCGCC
  5   1   2       ext Neu       in                   TNeu126j03.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AATCCCCGGGGTGGGATGCAGTGTAGCTCTGTGGCATCGGCCGGCTTGACATTACAGTGTCGGGACTGTGGTGTGGCGCAAGGTACACACAGGAAAATGGTTCCCAACGGATCTTTAAATTTTGAAGATGAACAGTTTATTGAGTCGTCTGTGGCTAAATTAAATGCCTTACGCAAAAGCGGACAGTTTTGTGATGTAAAACTACAGGTCTGCGGCCATGAGATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTTAACAGTGACGGTGAATCTCATGGTATTTCCCTTGTCAGATTTGATGACTTAAATCCAGACGCTGTTGAAGTCTTATTAAATTATGCGTATACATCTCAGCTTAAAGCGGAGACAGACCTTGTTAAAGATGTATACTCTGCAGCAAAAAAGCTTAAGATTGATCGAGTAAAACAGGTGTGTGGAGATTACTTACTATCAAAAATAGATGTTCAGAGCTGCATTTCTTATCGTAATTTTGTAAATGCAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGAGGATTTTCTTAAACTCCCTTTTTTT
  3   1   2       ext Neu       in                    TNeu126j03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AATCCCCGGGGTGGGATGCAGTGTAGCTCTGTGGCATCGGCCGGCTTGACATTACAGTGTCGGGACTGTGGTGTGGCGCAAGGTACACACAGGAAAATGGTTCCCAACGGATCTTTAAATTTTGAAGATGAACAGTTTATTGAGTCGTCTGTGGCTAAATTAAATGCCTTACGCAAAAGCGGACAGTTTTGTGATGTAAAACTACAGGTTTGCGGCCATGAGATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTTAACAGTGACGGTGAATCTCATGGTATTTCCCTTGTCAGATTTGATGACTTAAATCCAGACGCTGTTGAAGTCTTATTAAATTATGCGTATACATCTCAGCTTAAAGCGGAGACAGACCTTGTTAAAGATGTATACTCTGCAGCAAAAAAGCTTAAGATTGATCGAGTAAAACAGGTGTGTGGAGATTACTTACTATCAAAAATAGATGTTCAGAGCTGCATTTCTTATCGTAATTTTGTAAATGCAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGAGGATTTTCTTAAACTCCCTTTTTTTACCAATAAAACTGGAGAAAGGGTGAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       ext Gas7      in                         XZG56400.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCACGCGTCCGCTCTTGCCCCACTGTATTGTAGATACTGGTACTGAATGTGTTTCTTTTATGAAACTTTATTTTATACTAATGTATATTAAGAGTATCTTGTATGTGTCTTTGTATACATCTGTGCTTCTGTCATATCTCGTATCTCCtttttcttttatttactttattttttcctgtttctccttttttttttttttctttttttttttttGGGTTTAACACCCCCACTCCTACCTATTGGAAAATGAAGATTTCTTCAAGAAGATTTGAGTTATTAGAAGATTGACATCATGCAATATAATTTTTTTTGATTGAAAGTTTTCCAAGTGGAATCTTTACTCACAATGAAGATAACGTGGATTATAGGATCACAAATAATAATATTTTTAGAAGAAGTATCCATATGGCTTTCATTTCTATTTTGCAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAA
  5   1   2       ext Liv1 5g3  in                         CAAR8270.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAATTCGGCACGAGGTTTTTTTTGTGTTTAACACCCCCACTCCTACCTATTGGAAAATGAAGATTTCTTCAAGAAGATTTGAGTTATTAGAAGATTGACATCATGCAATATAATTTTTTTTGATTGAAAGTTTTCCAAGTGGAATCTTTACTCACAATGAAGATAACGTGGATTATAGGATCACAAATAATAATATTTTTAGAAGAAGTATCCATATGGCTTTCATTTCTATTTTGCAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCAGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTC
  5   1   3        nb Int1 5g3  in                        CAAP13513.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCACTCCTACCTATTGGAAAATGAAGATTTCTTCAAGAAGATTTGAGTTATTAGAAGATTGACATCATGCAATATAATTTTTTTTGATTGAAAGTTTTCCAAGTGGAATCTTTACTCACAATGAAGATAACGTGGATTATAGGATCACAAATAATAATATTTTTAGAAGAAGTATCCATATGGCTTTCATTTCTATTTTGCAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCAGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCT
  5   1   2       ext Ovi1 5g3  in                        CABI13098.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGATAACGTGGATTATAGGATCACAAATAATAATATTTTTAGAAGAAGTATCCATATGGCTTTCATTTCTATTTTGCAGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCAGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTCAATGNGAAATTATATGTTGTT
  5   1   3        nb Liv1      in                        CAAR12459.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGAACCATGATGATGATTTAATGGTACAAACATTGTATTACTCAGCTGACCACAAGTTGCTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCAGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTC
  5   1   3        nb Ovi1      in                         CABI1035.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTGATGCTAGTCTTCTTGGTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCAGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTCAATGNGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCTCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTA
  5   1   3        nb Ski1      in                         CABJ1337.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTGAACATACTGATGCATATGAGGACAATATACAATTGATTCAGAAAAAGTCCCCACGTGAAAACAACCATAAGAATCTAAGCAGCAGCTCATCCGGATCTCTGTCTCCTACTGCCCTGACTCAGAGTCCTAAGCATGAATGGAAAATTATTGCATCAGAAAAGAAAACAAATAATACCTACCTGTGTTTAGCTGTGCTGAATAGCATGCTATGTGTTATATTCCTGCATGGACGAAACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCAGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTANNGCAACAGATGTACATTTATTGGAGAGCTGAATCTGGGAATGTCTAAAT
  5   1   2       add Ova1      in                         CABE4531.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGTACATATTTTTTTTTAATAAACACCATATTTATGAAGTAATATTTAGTGTGCATAGACTGAAATGAACTCTCAAGGTGATAGCAAGGGCTTGTTGCCTGTGCAAGAGGTGATTTCCTCTAGATGAAAAAGCCTCCTATCTGCCATCACTCTGATCGATCCATGTGGTCCTCTTGGGTCCAAGAAAGATTGGAGATTCCTTCCTCTGGATCAACTAGCATTGATGCAAGTTTTATGTCCTGTTTTTTTTCAACCTCATGTTATTTAATAAGATTTAAATAACAATATAAATGTAGTTATAAATTAAAAATTACAAATACATAACCTACTGAAACCAAGAACAGAGAATAAAGTTGTTTTTATCTATTTTAGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGA
  5   1   3        nb Gas7      in                         XZG43154.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTGCATGGACGACACAGCCCGGTAAACTCTCCATCCAGTACCCCTCGACTAACAAAAAGTTTAAGTCTTGAAATACAGCCCGATGACTCTCTGGAAAGGGTCATGTCTCCCATGCATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCAGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGGTGGGAGGATTTGATGG
  5   1   3        nb Gas8      in                          st27h09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTATGCTCGGTCTGGGCTAGGAACAGCAGAATTAAATGGCAAACTTATTGCAGCAGGTGGCTATAACAGAGAAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGTTGGAGGATTTGATGGTACCCATGCTCTAAGTTGTGTCGAATCATATGACCCCGAAAGAAACGAGTGGAA
  5   1   3        nb Ovi1      in                         CABI6318.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGAATGTCTGCGTACGGTTGAGTGCTATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCATGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGTTGGAGGATTTGATGGTACCCATGCTCTAAGTTGTGTCGAATCATATGACCCCGAAAGAAACGAGTGGAAGATGATGGGGAGTATGACCTCTGCAAGAAGCAATGCAGGAATGGTTGCTGTAGGGGATCAAATATATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAATTGAAGTTTATAACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCC
  5   1   2       ext Egg       in                   TEgg038j09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TATGATCCAGAGACGGACATTTGGACCTTTATAGCACCCACTGAAAACACCAAGAGCCCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGTTGGAGGATTTGATGGTACCCATGCTCTAAGTTGTGTCGAATCATATGACCCCGAAAGAAACGAGTGGAAGATGATGGGGAGTATGACCTCTGCAAGAAACAATGCAGGAATGGTTGCTG
  5   1   3        nb Ovi1      in                         CABI8906.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATAGCACCCATGAAAACACCAAGAGTTCGATTCCAAATGGCAGTTCTGATGGACCATCTGTATGTTGTTGGAGGGTCAAATGGTCACTCTGATGACCTCAGTTGTGGAGAAAAGTATGATCCCAAATCAAACGTTTGGATATCTGTTCCTGAGCTAAGAAGCAACCGTTGTAATGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGTTGGAGGATTTGATGGTACCCATGCTCTAAGTTGTGTCGAATCATATGACCCCGAAAGAAACGAGTGGAAGATGATGGGGAGTATGACCTCTGCAAGAAGCAATGCAGGAATGGTTGCTGTAGGGGATCAAATATATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAATTGAAGTTTATAACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGT
  5   1   2       ext Tad5      in                         XZT69500.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGACGCGTGGGTGCTGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGTTGGAGGATTTGATGGTACCCATGCTCTAAGTTGTGTCGAATCATATGACCCCGAAAGAAACGAGTGGAAGATGATGGGGAGTATGACCCCTGCAAGAAGCAATGCAGGAATGGTTGCTGTAGGGGATCAAATATATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAATTGAAGTTTATAACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTTGTTCCTTTCTGCAAGCATT
  5   1   3        nb Egg       in                   TEgg024p03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTAATGCTGGTGTCTGTGCTCTCATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGTTGGAGGATTTGATGGTACCCATGCTCTAAGTTGTGTCGAATCATATGACCCCGAAAGAAACGAGTGGAAGATGATGGGGAGTATGACCTCTGCAAGAAGCAATGCAGGAATGGTTGCTGTAGGGGATCAAATATATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAATTGAAGTTTATAACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAA
  5   1   3        nb Ovi1      in                         CABI9216.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCATGGGAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGTTGGAGGATTTGATGGTACCCATGCTCTAAGTTGTGTCGAATCATATGACCCCGAAAGAAACGAGTGGAAGATGATGGGGAGTATGACCTCTGCAAGAAGCAATGCAGGAATGGTTGCTGTAGGGGATCAAATATATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAATTGAAGTTTATAACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACG
  5   1   3        nb Gas7      in                         XZG24372.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGTTGGAGGATTTGATGGTACCCATGCTCTAAGTTGTGTCGAATCATATGACCCCGAAAGAAACGAGTGGAAGATGATGGGGAGTATGACCTCTGCAAGAAGCAATGCAGGAATGGTTGCTGTAGGGGATCAAATATATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAATTGAAGTTTATAACCCTCAGACAGAGGAGTGGAGT
  5   1   3        nb Mus1      in                        CABH11447.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGTTGGAGGATTTGATGGTACCCATGCTCTAAGTTGTGTCGAATCATATGACCCCGAAAGAAACGAGTGGAAGATGATGGGGAGTATGACCTCTGCAAGAAGCAATGCAGGAATGGTTGCTGTAGGGGATCAAATATATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAATTGAAGTTTATAACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTT
  5   1   3        nb Gas7      in                         XZG31990.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGTTGGAGGATTTGATGGTACCCATGCTCTAAGTTGTGTCGAATCATATGACCCCGAAAGAAACGAGTGGAAGATGATGGGGAGTATGACCTCTGCAAGAAGCAATGCAGGAATGGTTGCTGTAGGGGATCAAATATATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAATTGAAGTTTATAACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTACTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAG
  5   1   2       ext Ovi1      in                        CABI10863.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAAAGCTATTTGTGGTTGGAGGATTTGATGGTACCCATGCTCTAAGTTGTGTCGAATCATATGACCCCGAAAGAAACGAGTGGAAGATGATGGGGAGTATGACCTCTGCAAGAAGCAATGCAGGAATGGTTGCTGTAGGGGATCAAATATATGCTGCAGGTGGTTTTGATGGCAATGAATTCTTAAATACAATTGAAGTTTATAACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTACTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTANGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTT
  3   1   4      seed Gas  5x   in                    TGas125j18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTGATGGCAATGAATTCTTAAATACAATGAAGTTTTATAACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTACTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAAGGTACATTATTAAATAAAATTGACTGTAAATGAAAAAAAAAAAAAAAAAA
  3   1   2       ext Ovi1 5g3  in                        CABI13098.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACCCTCAGACAGAGGAGTGGAGTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTACTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTAAATAAAATTGACTGTAAATG
  3   1   3        nb Ovi1      in                         CABI8906.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTACTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTAAATAAAATTGACTGTAAATG
  3   1   3        nb Mus1      in                        CABH11447.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTACTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTAAATAAAATTGACTGTAAATG
  3   1   2       ext Liv1 5g3  in                         CAAR8270.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTGGGGCTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTACTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTAAATAAAATTGACTGTAAATGAAAAAAA
  3   1   2       ext Ovi1      in                        CABI10863.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCCATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTACTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTAAATAAAATTGACTGTAAAT
  3   1   3        nb Liv1      in                        CAAR12459.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTACACACCTGTGCAAATCTAGTAAATCCTCATTTCTCATCAGATCTGCTGGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTACTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTAAATAAAATTGACTGTAAATGAAAAAAAAA
  3   1   3        nb Int1 5g3  in                        CAAP13513.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTACTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTAAATAAAATTGACTGTA
  3   1   3        nb Hrt1      out                        CAAQ9921.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAATNCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTACTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTAAATAAAATTGACTGTAAATG
  3   1   2       ext Egg       in                    TEgg038j09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTACTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTAAATAAAATTGACTGTAAATGAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       add Ova1      in                         CABE4531.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTACTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTAAATAAAATTGACTGTAAATG
  3   1   3        nb Ovi1      in                         CABI6318.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTACTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTAAATAAAATTGACTGT
  3   1   2       ext Tad5      in                         XZT69500.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGATCTGCTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTACTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTAAATAAAATTGACTGTAAATG
  3   1   3        nb Ovi1      in                         CABI1035.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTACTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTAAATAAAATTGACTGTAAATG
  3   1   3        nb Gas7      in                         XZG43154.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTCCCTCATGTTTGTGGTACCAGCAACGTACGTTTTTGCTATTTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTACTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTAAATAAAATTGACTGT
  3   1   2       ext Gas7      in                         XZG56400.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTACTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTAAATAAAATTGACTGTAAATGG
  3   1   3        nb Ovi1      in                         CABI9216.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTACTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCC
  3   1   3        nb Ski1      in                         CABJ1337.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTACTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTAAATAAAATTGACTGTAAATG
  5   1   3        nb Kid1      in                         CABA9283.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCAACGTACGCTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTACTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTA
  3   1   3        nb Kid1      in                         CABA9283.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTACTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTA
  3   1   3        nb Gas7      in                         XZG31990.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTACTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTAAATAAAATTGACTGT
  5   1   3        nb Tad5                                 XZT33813.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGACGCGTGGGATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTACTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTAAATAAAATTGACTGTAAATGAAAA
  3   1   3        nb Gas8      in                          st27h09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAATTTTTGNAACCCCGGGTTTTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTACTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTCCCCACT
  3   1   3        nb Egg                             TEgg008i19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTACTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTAAATAAAATTGACTGTAAATGAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Egg       in                    TEgg024p03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTACTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCCACTTCTAATGTACCATTATTAAATAAAATTGACTGTAAAG
  3   1   3        nb Gas7      in                         XZG24372.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTACTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTAAATAAAATTGACTGTAAATG
  5   1   2       ext HdA       in                  THdA031a17.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTAAATAAAATTGACTGTAAATG
  3   1   2       ext HdA       in                    THdA031a17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTTTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTTTGCAAATACTCATTTTTAGAGTTTTTGATCAAGCTGAATTTTTTTGTAGGCACTCTGTAAAGGAAAACCCCCAACAATATTTTTTCATTGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTTTAATGTACATTATTAAATAAAATTGACTGTAAATGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCG
  5  -1   2       add Ovi1      in                         CABI5268.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTAAATAAAATTGACTGTAAATGAAAA
  5   1   2                                         Xt7.1-TTpA070d09.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCTGTGGCATCGGCCGGCTTGACATTACAGTGTCGGGACTGTGGTGTGGCGCAAGGTACACACAGGAAAATGGTTCCCAACGGATCTTTAAATTTTGAAGATGAACAGTTTATTGAGTCGTCTGTGGCTAAATTAAATGCCTTACGCAAAAGCGGACAGTTTTGTGATGTAAAACTACAGGTCTGCGGCCATGAGATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTTAACAGTGACGGTGAATCTCATGGTATTTCCCTTGTCAGATTTGATGACTTAAATCCAGACGCTGTTGAAGTCTTATTAAATTATGCGTATACATCTCAGCTTAAAGCGGAGACAGACCTTGTTAAAGATGTATACTCTGCAGCAAAAAAGCTTAAGATTGATCGAGTAAAACAGGTGTGTGGAGATTACTTACTATCAAAAATAGATGTTCAGAGCTGCATTTCTTATCGTAATTTTGTAAATGCAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGAGGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTTTCACTTCCCAGCAACGGTAAACTGTATACAAAGGTAATCAACTGGGTTCAGCGGAGCATATGGGAGAATGGCGAANATCTGGATGCCCTATT------------CATATGGGAGAATGGCGAAAATCTGGATGCCNTATTGGAAGAGGTTAGTCTGGCAAGGGAAACAACTGTAATACATGTAGGTTCCTAGGAAAGTCATTTTTTTACTACTAATTCAATTGTCCTTTTATGATAATCAGAGCCCAAAGTAAAGAAAGTATCTGTTTTCAGTTCAAAACTGGTAGGTTTGCAGGTGAGACTGAATCTTATTTTCCCAAAACAAATCTTATGCTCTTTTCCCATGGACCCCCCCCTTTCACTTTTTCACTGTTTTAAAGCTCTAACATTTTTTGATTGAAAATTACTATAGACCTTCAACATTTCCTTGCAGGTTTAATGCTTGAATTGGTCCGTTTCTTTAGAAAATTTCTAATAGTTTTTTCCTCCCCGTTGATTATATTTTCATAGGTTATTTAACAAAAGTAGGATACCCAAGATGGAAGATCAAAGAAGATACCTCAAGGTTAAACCGTATTGAAGCTCAAGTCTGCCCTATGCCTTCTAAGAACATCCACTCTGGGCAGAGAACCATGATGATGATTTAATGGTGTTTACTCCTTTTACAGGATTTGTGTGACATGTACAGTCTAAATTTTTCTAACTAAGAATTGCCTGCCTTTTTTCTTACTGATACAAAAGAAGGCATTTATAAGATTACCATTGTGTTGGTTAATTTATAATTTTTTTTTTTTTTTAGAAACCAACATAAGGGTGGTTTTATATTCATAACTTCTTACCAGGCATACAATTATAGTAAAGGTTGCATGCACCAGCAGTTTTAAGATTTGTATATTT
                                                  Xt7.1-CHK-1008272712                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGCATCGGCCGGCTTGACATTACAGTGTCGGGACTGTGGTGTGGCGCAAGGTACACACAGGAAAATGGTTCCCAACGGATCTTTAAATTTTGAAGATGAACAGTTTATTGAGTCGTCTGTGGCTAAATTAAATGCCTTACGCAAAAGCGGACAGTTTTGTGATGTAAAACTACAGGTCTGCGGCCATGAGATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTTAACAGTGACGGTGAATCTCATGGTATTTCCCTTGTCAGATTTGATGACTTAAATCCAGACGCTGTTGAAGTCTTATTAAATTATGCGTATACATCTCAGCTTAAAGCGGAGACAGACCTTGTTAAAGATGTATACTCTGCAGCAAAAAAGCTTAAGATTGATCGAGTAAAACAGGTGTGTGGAGATTACTTACTATCAAAAATAGATGTTCAGAGCTGCATTTCTTATCGTAATTTTGTAAATGCAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGAGGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTTTCACTTCCCAGCAACGGTAAACTGTATACAAAGGTAATCAACTGGGTTCAGCGGAGCATATGGGAGAATGGCGAANATCTGGATGC------------------------GGAGAATGGCGAAAATCTGGATGCCNTATTGGAAGAGGTTAGTCTGGCxAxGGxAACAACTGTAATACATGTAGGTTCCTAGGAAAGTCATTTTTTTACTACTAATTCAATTGTCCTTTTATGATAATCAGAGCCCAAAGTAAAGAAAGTATCTGTTTTCAGTTCAAAACTGGTAGGTTTGCAGGTGAGACTGAATCTTATTTTCCCAAAACAAATCTTATGCTCTTTTCCCATGGACCCCCCCCTTTCACTTTTTCACTGTTTTAAAGCTCTAACATTTTTTGATTGAAAATTACTATAGACCTTCAACATTTCCTTGCAGGTTTAATGCTTGAATTGGTCCGTTTCTTTAGAAAATTTCTAATAGTTTTTTCCTCCCCGTTGATTATATTTTCATAGGTTATTTAACAAAAGTAGGATACCCAAGATGGAAGATCAAAGAAGATACCTCAAGGTTAAACCGTATTGAAGCTCAAGTCTGCCCTATGCCTTCTAAGAACATCCACTCTGGGCAGAGAACCATGATGATGATTTAATGGTGTTTACTCCTTTTACAGGATTTGTGTGACATGTACAGTCTAAATTTTTCTAACTAAGAATTGCCTGCCTTTTTTCTTACTGATACAAAAGAAGGCATTTATAAGATTACCATTGTGTTGGTTAATTTATAATTTTTTTTTTTTTTTAGAAACCAACATAAGGGTGGTTTTATATTCATAACTTCTTACCAGGCATACAATTATAGTAAAGGTTGCATGCACCAGCAGTTTTAAGATTTGT
  5   1   4      seed TpA       in                   TTpA070d09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCTGTGGCATCGGCCGGCTTGACATTACAGTGTCGGGACTGTGGTGTGGCGCAAGGTACACACAGGAAAATGGTTCCCAACGGATCTTTAAATTTTGAAGATGAACAGTTTATTGAGTCGTCTGTGGCTAAATTAAATGCCTTACGCAAAAGCGGACAGTTTTGTGATGTAAAACTACAGGTCTGCGGCCATGAGATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTTAACAGTGACGGTGAATCTCATGGTATTTCCCTTGTCAGATTTGATGACTTAAATCCAGACGCTGTTGAAGTCTTATTAAATTATGCGTATACATCTCAGCTTAAAGCGGAGACAGACCTTGTTAAAGATGTATACTCTGCAGCAAAAAAGCTTAAGATTGATCGAGTAAAACAGGTGTGTGGAGATTACTTACTATCAAAAATAGATGTTCAGAGCTGCATTTCTTATCGTAATTTTGTAAATGCAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGAGGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTTTCACTTCCCAGCAACGGTAAACTGTATACAAAGGTAATCAACTGGGTTCAGCGGAGCATATGGGAGAATGGCGAANATCTGGATGCCCTATT
  3   1   4      seed TpA       in                   TTpA070d09.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCATATGGGAGAATGGCGAAAATCTGGATGCCNTATTGGAAGAGGTTAGTCTGGCAAGGGAACAACTGTAATACATGTAGGTTCCTAGGAAAGTCATTTTTTTACTACTAATTCAATTGTCCTTTTATGATAATCAGAGCCCAAAGTAAAGAAAGTATCTGTTTTCAGTTCAAAACTGGTAGGTTTGCAGGTGAGACTGAATCTTATTTTCCCAAAACAAATCTTATGCTCTTTTCCCATGGACCCCCCCCCTTTCACTTTTTCACTGTTTTAAAGCTCTAACATTTTTTGATTGAAAATTACTATAGACCTTCAACATTTCCTTGCAGGTTTAATGCTTGAATTGGTCCGTTTCTTTAGAAAATTTCTAATAGTTTTTTCCTCCCCGTTGATTATATTTTCATAGGTTATTTAACAAAAGTAGGATACCCAAGATGGAAGATCAAAGAAGATACCTCAAGGTTAAACCGTATTGAAGCTCAAGTCTGCCCTATGCCTTCTAAGAACATCCACTCTGGGCAGAGAACCATGATGATGATTTAATGGTGTTTACTCCTTTTACAGGATTTGTGTGACATGTACAGTCTAAATTTTTCTAACTAAGAATTGCCTGCCTTTTTTCTTACTGATACAAAAGAAGGCATTTATAAGATTACCATTGTGTTGGTTAATTTATAATTTTTTTTTTTTTTAGAAACCAACATAAGGGTGGTTTTATATTCATAACTTCTTACCAGGCATACAATTATAGTAAAGGTTGCATGCACCAGCAGTTTTAAGATTGTATATTAAGAAAAAAAAAAAA
  5   1   3        nb Bone      in                        CBTC1269.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCAAGGGAACAACTGTAATACATGTAGGTTCCTAGGAAAGTCATTTTTTTACTACTAATTCAATTGTCCTTTTATGATAATCAGAGCCCAAAGTAAAGAAAGTATCTGTTTTCAGTTCAAAACTGGTAGGTTTGCAGGTGAGACTGAATCTTATTTTCCCAAAACAAATCTTATGCTCTTTTCCCATGGACCCCCCCCTTTCACTTTTTCACTGTTTTAAAGCTCTAACATTTTTTGATTGAAAATTACTATAGACCTTCAACATTTCCTTGCAGGTTTAATGCTTGAATTGGTCCGTTTCTTTAGAAAATTTCTAATAGTTTTTTCCTCCCCGTTGATTATATTTTCATAGGTTATTTAACAAAAGTAGGATACCCAAGATGGAAGATCAAAGAAGATACCTCAAGGTTAAACCGTATTGAAGCTCAAGTCTGCCCTATGCCTTCTAAGAACATCCACTCTGGGCAGAGAACCATGATGATGATTTAATGGTGTTTACTCCTTTTACAGGATTTGTGTGACATGTACAGTCTAAATTTTTCTAACTAAGAATTGCCTGCCTTTTTTCTTACTGATACAAAAGAAGGCATTTATAAGATTACCATTGTGTTGGTTAATTTATAATTTTTTTTTTTTTTTAGAAACCAACATAAGGGTGGTTTTATATTCATAACTTCTTACCAGGCATACAATTATAGTAAAGGTTGCATGCACCAGCAGTTTTAAGATTTGTATATTTA
  3   1   3        nb Bone      in                        CBTC1269.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCAAGGGAACAACTGTAATACATGTAGGTTCCTAGGAAAGTCATTTTTTTACTACTAATTCAATTGTCCTTTTATGATAATCAGAGCCCAAAGTAAAGAAAGTATCTGTTTTCAGTTCAAAACTGGTAGGTTTGCAGGTGAGACTGAATCTTATTTTCCCAAAACAAATCTTATGCTCTTTTCCCATGGACCCCCCCCTTTCACTTTTTCACTGTTTTAAAGCTCTAACATTTTTTGATTGAAAATTACTATAGACCTTCAACATTTCCTTGCAGGTTTAATGCTTGAATTGGTCCGTTTCTTTAGAAAATTTCTAATAGTTTTTTCCTCCCCGTTGATTATATTTTCATAGGTTATTTAACAAAAGTAGGATACCCAAGATGGAAGATCAAAGAAGATACCTCAAGGTTAAACCGTATTGAAGCTCAAGTCTGCCCTATGCCTTCTAAGAACATCCACTCTGGGCAGAGAACCATGATGATGATTTAATGGTGTTTACTCCTTTTACAGGATTTGTGTGACATGTACAGTCTAAATTTTTCTAACTAAGAATTGCCTGCCTTTTTTCTTACTGATACAAAAGAAGGCATTTATAAGATTACCATTGTGTTGGTTAATTTATAATTTTTTTTTTTTTTTAGAAACCAACATAAGGGTGGTTTTATATTCATAACTTCTTACCAGGCATACAATTATAGTAAAGGTTGCATGCACCAGCAGTTTTAAGATTTGTATATTTAAAG
  5   1   2  SIG                                    Xt7.1-TTpA077m18.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCTGTGGCATCGGCCGGCTTGACATTCCATTGTCGGGACTGTGGTGTGGCGCAAGGTACACACAGGAAAATGGTTCCCAACGGATCTTTAAATTTTGAAGATGAACAGTTTATTGAGTCGTCTGTGGCTAAATTAAATGCCTTACGCAAAAGCGGACAGTTTTGTGATGTAAAACTACAGGTCTGCGGCCATGAGATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTTAACAGTGACGGTGAATCTCATGGTATTTCCCTTGTCAGATTTGATGACTTAAATCCAGACGCTGTTGAAGTCTTATTAAATTATGCGTATACATCTCAGCTTAAAGCGGAGACAGACCTTGTTAAAGATGTATACTCTGCAGCAAAAAAGCTTAAGATTGATCGAGTAAAACAGGTGTGTGGAGATTACTTACTATCAAAAATAGATGTTCAGAGCTGCATTTCTTATCGTAATTTTGTAAATGCAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGAGGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTTTCACTTCCCAGCAACGGTAAACTGTATACAAAGGTAATCAACTGGGTTCAGCGGAGCATATGGGAGAATGGCGAANATCTGGATGCCCTATTGGAAGAGGTTATTTAACAAAAGTAGGATACCCAAGATGGAAGATCAAAGAAGATACCTCAAGGTTAAACCGTATTGAAGCTCAAGTCTGCCCTATGCCTTCTAAGAACATCCACTCTGGGCAGAGAACCATGATGATGATTTAATGGTGTTTACTCCTTTTACAGGATTTGTGTGACATGTACAGTCTAAATTTTTCTAACTAAGAATTGCCTGCCTTTTTTCTTACTGATACAAAAGAAGGCATTTATAAGATTACCATTGTGTTGGTTAATTTATAATTTTTTTTTTTTTTAGAAACCAACATAAGGGTGGTTTTATATTCATAACTTCTTACCAGGCATACAATTATAGTAAAGGTTGCATGCACCAGCAGTTTTAAGATTTGTATATTTAAAGAAAAAAAAATATATGTATATTGAATTTTATTCAAGCACTAAAATTCAAAGGAATAAATGCATTTAGTACTGATGTCAATGATGACTTGCTATACTTTTTATTTGAATGCCCTACAATGTACACAAAGGTTAATCCATGTGTAGTGTGCACATTTATTATAATACTGATACCATTTTTTTAACCCACTTTCTGTACCACAGAGTACTTTAACCCAAAAGGCATTACAGTTATCTGTGATGGTATAAAATTTGGAAATAGTTACTTTTGGTAAAAACAAATTCCCACACACTCTTCACCTAAAAAAGCAACTGGCTAGAATATTGTAAAGGCTGAATATTAAGCATAACTTATTGGTACAGACACCTTACTAGAATTGTATTCCTTCAAGTTCATCTAAAATTATTTTAACCTGTAGAATTGTGTAAATGTTTAATTTAATGTGCATTTGTGCATGTACATTATACAAAAAAATCTAATTTGTTCTGGGCTTTTTATGACATTATGTAAAAAAACTGGCTTAATGCAGGCCCACCACCGTAAAAAATTTATATATATTCTAAAGGAAAACTAACACCTAGAATTGGAAAAGGCAATACTTAAGTGCTGCACTTATCTTCTATTTTCTATGTAGGGCAAAGAAGAATTAAAAATAGCCTCTGTCTGTGATGTGTTTGCTGTGGTAGCTGACCCTAGTTAGAGGCATAATTGAGAAGGAAAAGGGACCATAAACAATTTAGAGCTGTTGCAAAGCTGCTTAGAAATCTTTAGAGAATACAATCATACAAGTTGTTTTAAGTGAAATAGCGTAAAATAAA
                                                  Xt7.1-CHK-1008272726                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGCATCGGCCGGCTTGACATTCCATTGTCGGGACTGTGGTGTGGCGCAAGGTACACACAGGAAAATGGTTCCCAACGGATCTTTAAATTTTGAAGATGAACAGTTTATTGAGTCGTCTGTGGCTAAATTAAATGCCTTACGCAAAAGCGGACAGTTTTGTGATGTAAAACTACAGGTCTGCGGCCATGAGATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTTAACAGTGACGGTGAATCTCATGGTATTTCCCTTGTCAGATTTGATGACTTAAATCCAGACGCTGTTGAAGTCTTATTAAATTATGCGTATACATCTCAGCTTAAAGCGGAGACAGACCTTGTTAAAGATGTATACTCTGCAGCAAAAAAGCTTAAGATTGATCGAGTAAAACAGGTGTGTGGAGATTACTTACTATCAAAAATAGATGTTCAGAGCTGCATTTCTTATCGTAATTTTGTAAATGCAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGAGGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTTTCACTTCCCAGCAACGGTAAACTGTATACAAAGGTAATCAACTGGGTTCAGCGGAGCATATGGGAGAATGGCGAANATCTGGATGCCCTATTGGAAGAGGTTATTTAACAAAAGTAGGATACCCAAGATGGAAGATCAAAGAAGATACCTCAAGGTTAAACCGTATTGAAGCTCAAGTCTGCCCTATGCCTTCTAAGAACATCCACTCTGGGCAGAGAACCATGATGATGATTTAATGGTGTTTACTCCTTTTACAGGATTTGTGTGACATGTACAGTCTAAATTTTTCTAACTAAGAATTGCCTGCCTTTTTTCTTACTGATACAAAAGAAGGCATTTATAAGATTACCATTGTGTTGGTTAATTTATAATTTTTTTTTTTTTTAGAAACCAACATAAGGGTGGTTTTATATTCATAACTTCTTACCAGGCATACAATTATAGTAAAGGTTGCATGCACCAGCAGTTTTAAGATTTGTATATTTAAAGAAAAAAAAATATATGTATATTGAATTTTATTCAAGCACTAAAATTCAAAGGAATAAATGCATTTAGTACTGATGTCAATGATGACTTGCTATACTTTTTATTTGAATGCCCTACAATGTACACAAAGGTTAATCCATGTGTAGTGTGCACATTTATTATAATACTGATACCATTTTTTTAACCCACTTTCTGTACCACAGAGTACTTTAACCCAAAAGGCATTACAGTTATCTGTGATGGTATAAAATTTGGAAATAGTTACTTTTGGTAAAAACAAATTCCCACACACTCTTCACCTAAAAAAGCAACTGGCTAGAATATTGTAAAGGCTGAATATTAAGCATAACTTATTGGTACAGACACCTTACTAGAATTGTATTCCTTCAAGTTCATCTAAAATTATTTTAACCTGTAGAATTGTGTAAATGTTTAATTTAATGTGCATTTGTGCATGTACATTATACAAAAAAATCTAATTTGTTCTGGGCTTTTTATGACATTATGTAAAAAAACTGGCTTAATGCAGGCCCACCACCGTAAAAAATTTATATATATTCTAAAGGAAAACTAACACCTAGAATTGGAAAAGGCAATACTTAAGTGCTGCACTTATCTTCTATTTTCTATGTAGGGCAAAGAAGAATTAAAAATAGCCTCTGTCTGTGATGTGTTTGCTGTGGTAGCTGACCCTAGTTAGAGGCATAATTGAGAAGGAAAAGGGACCATAAACAATTTAGAGCTGTTGCAAAGCTGCTTAGAAATCTTTAGAGAATACAATCATACAAGTTGTTTTAAGTGAAATAGCGTAAAATAAAAAAAAA
  0   1   1           Tad5 FL                          XZT10226.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGACATTACAGTGTCGGGACTGTGGTGTGGCGCAAGGTACACACAGGAAAATGGTTCCCAACGGATCTTTAAATTTTGAAGATGAACAGTTTATTGAGTCGTCTGTGGCTAAATTAAATGCCTTACGCAAAAGCGGACAGTTTTGTGATGTAAAACTACAGGTCTGCGGCCATGAGATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTTAACAGTGACGGTGAATCTCATGGTATTTCCCTTGTCAGATTTGATGACTTAAATCCAGACGCTGTTGAAGTCTTATTAAATTATGCGTATACATCTCAGCTTAAAGCGGAGACAGACCTTGTTAAAGATGTATACTCTGCAGCAAAAAAGCTTAAGATTGATCGAGTAAAACAGGTGTGTGGAGATTACTTACTATCAAAAATAGATGTTCAGAGCTGCATTTCTTATCGTAATTTTGTAAATGCAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGAGGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTTTCACTTCCCAGCAACGGTAAACTGTATACAAAGGTAATCAACTGGGTTCAGCGGAGCATATGGGAGAATGGCGAAAATCTGGATGCCCTATTGGAAGAGGTTATTTAACAAAAGTAGGATACCCAAGATGGAAGATCAAAGAAGATACCTCAAGGTTAAACCGTATTGAAGCTCAAGTCTGCCCTATGCCTTCTAAGAACATCCACTCTGGGCAGAGAACCATGATGATGATTTAATGGTGTTTACTCCTTTTACAGGATTTGTGTGACATGTACAGTCTAAATTTTTCTAACTAAGAATTGCCTGCCTTTTTTCTTACTGATACAAAAGAAGGCATTTATAAGATTACCATTGTGTTGGTTAATTTATAATTTTTTTTTTTTTTAGAAACCAACATAAGGGTGGTTTTATATTCATAACTTCTTACCAGGCATACAATTATAGTAAAGGTTGCATGCACCAGCAGTTTTAAGATTTGTATATTTAAAGAAAAAAAAATATATGTATATTGAATTTTATTCAAGCACTAAAATTCAAAGGAATAAATGCATTTAGTACTGATGTCAATGATGACTTGCTATACTTTTTATTTGAATGCCCTACAATGTACACAAAGGTTAATCCATGTGTAGTGTGCACATTTATTATAATACTGATACCATTTTTTTAACCCACTTTCTGTACCACAGAGTACTTTAACCCAAAAGGCATTACAGTTATCTGTGATGGTATAAAATTTGGAAATAGTTACTTTTGGTAAAAACAAATTCCCACACACTCTTCACCTAAAAAAGCAACTGACTAGAATATTGTAAAGGCTGAATATTAAGCATAACTTATTGGTACAGACACCTTACTAGAATTGTATTCCTTCAAGTTCATCTAAAATTATTTTAACCTGTAGAATTGTGTAAATGTTTAATTTAATGTGCATTTGTGCATGTACATTATACAAAAAAATCTAATTTGTTCTGGGCTTTTTATGACATTATGTAAAAAAACTGGCTTAATGCAGGCCCACCACCGTAAAAAATTTATATATATTCTAAAGGAAAACTAACACCTAGAATTGGAAAAGGCAATACTTAAGTGCTGCACTTATCTTCTATTTTCTATGTAGGGCAAAGAAGAATTAAAAATAGCCTCTGTCTGTGATGTGTTTGCTGTGGTAGCTGACCCTAGTTAGAGGCATAATTGAGAAGGAAAAGGGACCATAAACAATTTAGAGCTGTTGCAAAGCTGCTTAGAAATCTTTAGAGAATACAATCATACAAGTTGTTTTAAGTGAAATAGCGTTAAAAAAAAAAAAAAA
  5   1   2       ext TpA  5g3  in                   TTpA077m18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCTGTGGCATCGGCCGGCTTGACATTCCATTGTCGGGACTGTGGTGTGGCGCAAGGTACACACAGGAAAATGGTTCCCAACGGATCTTTAAATTTTGAAGATGAACAGTTTATTGAGTCGTCTGTGGCTAAATTAAATGCCTTACGCAAAAGCGGACAGTTTTGTGATGTAAAACTACAGGTCTGCGGCCATGAGATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTTAACAGTGACGGTGAATCTCATGGTATTTCCCTTGTCAGATTTGATGACTTAAATCCAGACGCTGTTGAAGTCTTATTAAATTATGCGTATACATCTCAGCTTAAAGCGGAGACAGACCTTGTTAAAGATGTATACTCTGCAGCAAAAAAGCTTAAGATTGATCGAGTAAAACAGGTGTGTGGAGATTACTTACTATCAAAAATAGATGTTCAGAGCTGCATTTCTTATCGTAATTTTGTAAATGCAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGAGGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTTTCACTTCCCAGCAACGGTAAACTGTATACAAAGGTAATCAACTGGGTTCAGCGGAGCATATGGGAGAATGGCGAANATCTGGATGCCCTATTGGAAGAGGTTATTTAACAAAAGTAGGATACCCAAGATGGAAGATCAAAGAAGATACCTCAAGGTTAAACCGTATTGAAGCTCAAGTCTGCCCTATGCCTTCTAAGAACATCCACTCTGGGCAGAGAACCATGATGATGATTTA
  5   1   4      seed Tad5 FL   in                         XZT10226.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTGTCGGGACTGTGGTGTGGCGCAAGGTACACACAGGAAAATGGTTCCCAACGGATCTTTAAATTTTGAAGATGAACAGTTTATTGAGTCGTCTGTGGCTAAATTAAATGCCTTACGCAAAAGCGGACAGTTTTGTGATGTAAAACTACAGGTCTGCGGCCATGAGATGCTGGCACACAGAGCAGTTCTTGCCTGTTGCAGCCCCTTCTTATTTGAAATTTTTAACAGTGACGGTGAATCTCATGGTATTTCCCTTGTCAGATTTGATGACTTAAATCCAGACGCTGTTGAAGTCTTATTAAATTATGCGTATACATCTCAGCTTAAAGCGGAGACAGACCTTGTTAAAGATGTATACTCTGCAGCAAAAAAGCTTAAGATTGATCGAGTAAAACAGGTGTGTGGAGATTACTTACTATCAAAAATAGATGTTCAGAGCTGCATTTCTTATCGTAATTTTGTAAATGCAATGGGAGATTGGCGCCTTTTAAGTAAAATTGACAATTACATTCAGGAGCATCTTCTTGAGATTTCTGAGCAGGAGGATTTTCTTAAACTCCCAAGACTGAACCTGGAAATAATGCTAGAAGAAAATGTTTCACTTCCCAGCAACGGTAAACTGTATACAAAGGTAATCAACTGGGTTCAGCGGAGCATATGGGAGAATGGCGAANATCTGGATGCCCTATTGNAAGAGGTTATTTAACANAAGTAGGATACCCAAGATGGAAGATCANAGAAGATACCTCA
  5   1   2       add TbA       in                   TTbA016p15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAGGGAACAACTGTAATACATGTAGGTCCCTAGGAAAGTCATTTTTTTACTACTAATTCAATTGTCCTTTTATGATAATCAGAGCCCAAAGTAAAGAAAGTATCTGTTTTCAGTTCAAAACTGGTAGGTTTGCAGGTGAGACTGAATCTTATTTTCCCAAAACAAATCTTATGCTCTTTTCCCATGGACCCCCCCCTTTCACTTTTTCACTGTTTTAAAGCTCTAACATTTTTTGATTGAAAATTACTATAGACCTTCAACATTTCCTTGCAGGTTTAATGCTTGAATTGGTCCGTTTCTTTAGAAAATTTCTAATAGTTTTTTCCTCCCCGTTGATTATATTTTCATAGGTTATTTAACAAAAGTAGGATACCCAAGATGGAAGATCAAAGAAGATACCTCAAGGTTAAACCGTATTGAAGCTCAAGTCTGCCCTATGCCTTCTAAGAACATCCACTCTGGGCAGAGAACCATGATGATGATTTAATGGTGTTTACTCCTTTTACAGGATTTGTGTGACATGTACAGTCTAAATTTTTCTAACTAAGAATTGCCTGCCTTTTTTCTTACTGATACAAAAGAAGGCATTTATAAGATTACCATTGTGTTGGTTAATTTATAATTTTTTTTTTTTTTAGAAACCAACATAAGGGTGGTTTTATATTCATAACTTCTTACCAGGCATACAATTATAGTAAAGGTTGCATGCACCAGCAGTTTTAAGATTTGTATATTTAAAGAAAAAAAAATATATGTATATTGAATTTTATTCAAGCACTAAAATTCAAAGGAATAAATGCATTTAGTACTGATGTCAATGATGACTTGCTATACTTTTTATTTGAATGCCCTANCATGTACACAAAGGTTAATCCATGTGTAGTGTGCACATTTATTATAATACTGATACCATTTTTT
  5   1   2       ext Tad5                                 XZT67228.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAAGGTTAAACCGTATTGAAGCTCAAGTCTGCCCTATGCCTTCTAAGAACATCCACTCTGGGCAGAGAACCATGATGATGATTTAATGGTGTTTACTCCTTTTACAGGATTTGTGTGACATGTACAGTCTAAATTTTTCTAACTAAGAATTGCCTGCCTTTTTTCTTACTGATACAAAAGAAGGCATTTATAAGATTACCATTGTGTTGGTTAATTTATAATTTTTTTTTTTTTTAGAAACCAACATAAGGGTGGTTTTATATTCATAACTTCTTACCAGGCATACAATTATAGTAAAGGTTGCATGCACCAGCAGTTTTAAGATTTGTATATTTAAAGAAAAAAAAATATATGTATATTGAATTTTATTCAAGCACTAAAATTCAAAGGAATAAATGCATTTAGTACTGATGTCAATGATGACTTGCTATACTTTTTATTTGAATGCCCTACAATGTACACAAAGGTTAATCCATGTGTAGTGTGCACATTTATTATAATACTGATACCATTTTTTTAACCCACTTTCTGTACCACAGAGTACTTTAACCCAAAAGGCATTACAGTTATCTGTGATGGTATAAAATTTGGAAATAGTTACTTTTGGTAAAAACAAATTCCCACACACTCTTCACCTAAAAAAGCAACTGACTAGAATATTGTAAAGGCTGAATATTAAGCATAACTTATTGGTACAGACACCTTACTAGAATTGTATTCCTTCAAGTTCATCTAAAATTATTTTAACCTGTAGAATTGTGTAAATGTTTAATTTAATGTGCATTTGTGCATGTACATTATANCAAAAAATCTAATTTGTTCTGGGCTTTTTATGACATTATGTAAAAAAACTGGCTTAATGCAGGCC
  3   1   2       ext TpA  5g3  in                   TTpA077m18.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCATACAATTATAGTAAAGGTTGCATGCACCAGCAGTTTTAAGATTTGTATATTTAAAGAAAAAAAAATATATGTATATTGAATTTTATTCAAGCACTAAAATTCAAAGGAATAAATGCATTTAGTACTGATGTCAATGATGACTTGCTATACTTTTTATTTGAATGCCCTACAATGTACACAAAGGTTAATCCATGTGTAGTGTGCACATTTATTATAATACTGATACCATTTTTTTAACCCACTTTCTGTACCACAGAGTACTTTAACCCAAAAGGCATTACAGTTATCTGTGATGGTATAAAATTTGGAAATAGTTACTTTTGGTAAAAACAAATTCCCACACACTCTTCACCTAAAAAAGCAACTGGCTAGAATATTGTAAAGGCTGAATATTAAGCATAACTTATTGGTACAGACACCTTACTAGAATTGTATTCCTTCAAGTTCATCTAAAATTATTTTAACCTGTAGAATTGTGTAAATGTTTAATTTAATGTGCATTTGTGCATGTACATTATACAAAAAAATCTAATTTGTTCTGGGCTTTTTATGACATTATGTAAAAAAACTGGCTTAATGCAGGCCCACCACCGTAAAAAATTTATATATATTCTAAAGGAAAACTAACACCTAGAATTGGAAAAGGCAATACTTAAGTGCTGCACTTATCTTCTATTTTCTATGTAGGGCAAAGAAGAATTAAAAATAGCCTCTGTCTGTGATGTGTTTGCTGTGGTAGCTGACCCTAGTTAGAGGCATAATTGAGAAGGAAAAGGGACCATAAACAATTTAGAGCTGTTGCAAAGCTGCTTAGAAATCTTTAGAGAATACAATCATACAAGTTGTTTTAAGTGAAATAGCGTTAAAAAAAAAAAAAAAA
  3   1   2       add TbA       in                    TTbA016p15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAAAATTCAAAGGAATAAATGCATTTAGTACTGATGTCAATGATGACTTGCTATACTTTTTATTTGAATGCCCTACAATGTACACAAAGGTTAATCCATGTGTAGTGTGCACATTTATTATAATACTGATACCATTTTTTTAACCCACTTTCTGTACCACAGAGTACTTTAACCCAAAAGGCATTACAGTTATCTGTGATGGTATAAAATTTGGAAATAGTTACTTTTGGTAAAAACAAATTCCCACACACTCTTCACCTAAAAAAGCAACTGACTAGAATATTGTAAAGGCTGAATATTAAGCATAACTTATTGGTACAGACACCTTACTAGAATTGTATTCCTTCAAGTTCATCTAAAATTATTTTAACCTGTAGAATTGTGTAAATGTTTAATTTAATGTGCATTTGTGCATGTACATTATACAAAAAAATCTAATTTGTTCTGGGCTTTTTATGACATTATGTAAAAAAACTGGCTTAATGCAGGCCCACCACCGTAAAAAATTTATATATATTCTAAAGGAAAACTAACACCTAGAATTGGAAAAGGCAATACTTAAGTGCTGCACTTATCTTCTATTTTCTATGTAGGGCAAAGAAGAATTAAAAATAGCCTCTGTCTGTGATGTGTTTGCTGTGGTAGCTGACCCTAGTTAGAGGCATAATTGAGAAGGAAAAGGGACCATAAACAATTTAGAGCTGTTGCAAAGCTGCTTAGAAATCTTTAGAGAATACAATCATACAAGTTGTTTTAAGTGAAATAGCGTTAAAAAAAAAAAAAAAAAG
  3   1   4      seed Tad5 FL   in                         XZT10226.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGTCCTGATGTCAATGATGACTTGCTATACTTTTTATTTGAATGCCCTACAATGTACACAAAGGTTAATCCATGTGTAGTGTGCACATTTATTATAATACTGATACCATTTTTTTAACCCACTTTCTGTACCACAGAGTACTTTAACCCAAAAGGCATTACAGTTATCTGTGATGGTATAAAATTTGGAAATAGTTACTTTTGGTAAAAACAAATTCCCACACACTCTTCCCCTAAAAAAGCAACTGACTAGAATATTGTAAAGGCTGAATATTAAGCATAACTTATTGGTACAGACACCTTACTAGAATTGTATTCCTTCAAGTTCATCTAAAATTATTTTAACCTGTAGAATTGTGTAAATGTTTAATTTAATGTGCATTTGTGCATGTACATTATACAAAAAAATCTAATTTGTTCTGGGCTTTTTATGACATTATGTAAAAAAACTGGCTTAATGCAGGCCCACCACCGTAAAAAATTTATATATATTCTAAAGGAAAACTAACACCTAGAATTGGAAAAGGCAATACTTAAGTGCTGCACTTATCTTCTATTTTCTATGTAGGGCAAAGAAGAATTAAAAATAGCCTCTGTCTGTGATGTGTTTGCTGTGGTAGCTGACCCTAGTTAGAGGCATAATTGAGAAGGAAAAGGGACCATAAACAATTTAGAGCTGTTGCAAAGCTGCTTAGAAATCTTTAGAGAATACAATCATACAAGTTGTTTTAAGTGAAATAGCGTAAAATAAAAAAAAA
  5   1   3        nb Spl2      in                        CBSS1752.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCTGATGTCAATGATGACTTGCTATACTTTTTATTTGAATGCCCTACAATGTACACAAAGGTTAATCCATGTGTAGTGTGCACATTTATTATAATACTGATACCATTTTTTTAACCCACTTTCTGTACCACAGAGTACTTTAACCCAAAAGGCATTACAGTTATCTGTGATGGTATAAAATTTGGAAATAGTTACTTTTGGTAAAAACAAATTCCCACACACTCTTCACCTAAAAAAGCAACTGGCTAGAATATTGTAAAGGCTGAATATTAAGCATAACTTATTGGTACAGACACCTTACTAGAATTGTATTCCTTCAAGTTCATCTAAAATTATTTTAACCTGTAGAATTGTGTAAATGTTTAATTTAATGTGCATTTGTGCATGTACATTATACAAAAAAATCTAATTTGTTCTGGGCTTTTTATGACATTATGTAAAAAAACTGGCTTAATGCAGGCCCACCACCGTAAAAAATTTATATATATTCTAAAGGAAAACTAACACCTAGAATTGGAAAAGGCAATACTTAAGTGCTGCACTTATCTTCTATTTTCTATGTAGGGCAAAGAAGAATTAAAAATAGCCTCTGTCTGTGATGTGTTTGCTGTGGTAGCTGACCCTAGTTAGAGGCATAATTGAGAAGGAAAAGGGACCATAAACAATTTAGAGCTGTTGCAAAGCTGCTTAGAAATCTTTAGAGAATACAATCATACAAGTTGT
  3   1   3        nb Spl2      in                        CBSS1752.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTTAATCCATGTGTAGTGTGCACATTTATTATAATACTGATACCATTTTTTTAACCCACTTTCTGTACCACAGAGTACTTTAACCCAAAAGGCATTACAGTTATCTGTGATGGTATAAAATTTGGAAATAGTTACTTTTGGTAAAAACAAATTCCCACACACTCTTCACCTAAAAAAGCAACTGGCTAGAATATTGTAAAGGCTGAATATTAAGCATAACTTATTGGTACAGACACCTTACTAGAATTGTATTCCTTCAAGTTCATCTAAAATTATTTTAACCTGTAGAATTGTGTAAATGTTTAATTTAATGTGCATTTGTGCATGTACATTATACAAAAAAATCTAATTTGTTCTGGGCTTTTTATGACATTATGTAAAAAAACTGGCTTAATGCAGGCCCACCACCGTAAAAAATTTATATATATTCTAAAGGAAAACTAACACCTAGAATTGGAAAAGGCAATACTTAAGTGCTGCACTTATCTTCTATTTTCTATGTAGGGCAAAGAAGAATTAAAAATAGCCTCTGTCTGTGATGTGTTTGCTGTGGTAGCTGACCCTAGTTAGAGGCATAATTGAGAAGGAAAAGGGACCATAAACAATTTAGAGCTGTTGCAAAGCTGCTTAGAAATCTTTAGAGAATACAATCATACAAGTTGTTTTAAGTGAAATAGCGT
  3   1   3        nb Gas0                                 dad42h11.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGTTACTTTTGGTAAAAACAAATTCCCACACACTCTTCACCTAAAAAAGCAACTGGCTAGAATATTGTAAAGGCTGAATATTAAGCATAACTTATTGGTACAGACACCTTACTAGAATTGTATTCCTTCAAGTTCATCTAAAATTATTTTAACCTGTAGAATTGTGTAAATGTTTAATTTAATGTGCATTTGTGCATGTACATTATACAAAAAAATCTAATTTGTTCTGGGCTTTTTATGACATTATGTAAAAAAACTGGCTTAATGCAGGCCCACCACCGTAAAAAATTTATATATATTCTAAAGGAAAACTAACACCTAGAATTGGAAAAGAACAACATTAAGTGCTGCACTTATCTTCTATTTTCTATGTAGGGCAAAGAAGAATTAAAAATAGCCTCTGTCTGTGATGTGTTTGCTGTGGTAGCTGACCCTAGTTAGAGGCATAATTGAGAAGGAAAAGGGACCATAAACAATTTAGAGCTGTTGCAAAGCTGCTTAGAAATCTTTAGAGTAATACAATCATACAAGTTGTTAAAAGTGAAATAGCGTTAAAAAAA
  3   1   3        nb TbA                             TTbA016n15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAAAGGCGGAATAGCCAAGCATAACTTATTGGTACAGACACCTTACTAGCAATCGTATTCCTTCAAGTTCATCTAAAATTATTTTAACCTGTCGAATTGTGTACACGTTTAATATAATGTGCATTTGTGCATGGACATTTTGCAAAAAAATATAATTGGGTCTGGGGTCAATACGACATTATGTAAAAAAACTGGCTTAAAGCAGGCACAACACCGTCAAAAATT
  5   1   2  SIG                                      Xt7.1-CABC9222.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCGAGGTACATACCCCTGCAAAATGGACAGTTTTTGTTTAATTTAAAAAAAAAAACAACCCTGATAAATCCTTTCACAACCTTAGTGGTCAGGGAGGTCTACGGCAACAGAAAAGGGGCTGCAGGATTTCTTGGTATGTATTGGTTGTTCCCTACATGTGACAACAGTCAGTTGTATTCTTCATCATATCTGGGTTCTGGAGTAGGGTAGCAAGACCAAATCATTTACTCACAAAAAAAAAAAACATCCAAACAGGTATACCCAGTCTCCAACATGTATTATGTTTTATGGTCTGATGAGACCAAGGTTGAACTGTTTGGCCATAATTCCAAAATGTATGTTTGGCACAAAAATAACACAGAACGCCATCACAAGAACACCATACCCATAGTTAAGCATGGCGGAGGCATCATGCTATGGGCTGCATTTCATCAGCTGGAACTGGTGGTTTAGTCAAGATGGATGGAATCATGAATAGATCGGCCTATTTTGTAAGAACTTTCAATCGTCTGCTAGGAAGCTGAAGATGAAGAACTTCAACTTCAGCATAACAATAGCCCAAAGTGTACATCTAAATCAACAAAGCAATGGCTTCTTGGTAACTTTTGCAAGGAGTGGGCAAAAATTGCAGAGTCTATATGTCCCAAAAAGACTGAGTGCTGTAATAAAATCAAAAGGGGCTTCAACCAAGTATTAGTTTAAGGGGTGAGCACACAGGTTTTTGTATGGTCTATGTTTTCCTTCACTAAACTGTTTTCAGCTTCTTTGTATAGTTGTCAATAGCTGGCTTAAGTTCTGACAGGATTTATATCCAGTGTACTTATGTATGCAATGTGTAGGGTTTCCCACCAGCAATTACAGTCACATTACTGCTGGTGAGAGGGAAACTGTTTTGTTGCCACAGTAGCACAGTAGCCCATTGTCCTAAAGCTTTGTTTAGCTAGTTTAGTGATTATAGCTCCTTTATACAAAAAAATGCCTTAAAAACAAATGATTTCATGCAAACTGTAAACAATATAATGTGTGTGTAACCTTCCATGTGGATTAGATTTATTTGGAAGAACACATTTATTTTTTCAATTTACTTTGATGCACTAAATATTAATATTTAACGTTTTGTGTGCAGCACAATTTCTCAGTGCAACGTATTGGTTATTCTAGTGTTCAAGAGTTTATAGCCTGTGCATCTACCAAACTGTAAAGGTAATTATTTAAAGAGGTTTTATAATGTTTTTCTTAATCTATTCCTGAAGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGTTGGAGGATT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTGGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAAT
                                                  Xt7.1-CHK-1008272722                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TACATACCCCTGCAAAATGGACAGTTTTTGTTTAATTTAAAAAAAAAAACAACCCTGATAAATCCTTTCACAACCTTAGTGGTCAGGGAGGTCTACGGCAACAGAAAAGGGGCTGCAGGATTTCTTGGTATGTATTGGTTGTTCCCTACATGTGACAACAGTCAGTTGTATTCTTCATCATATCTGGGTTCTGGAGTAGGGTAGCAAGACCAAATCATTTACTCACAAAAAAAAAAAACATCCAAACAGGTATACCCAGTCTCCAACATGTATTATGTTTTATGGTCTGATGAGACCAAGGTTGAACTGTTTGGCCATAATTCCAAAATGTATGTTTGGCACAAAAATAACACAGAACGCCATCACAAGAACACCATACCCATAGTTAAGCATGGCGGAGGCATCATGCTATGGGCTGCATTTCATCAGCTGGAACTGGTGGTTTAGTCAAGATGGATGGAATCATGAATAGATCGGCCTATTTTGTAAGAACTTTCAATCGTCTGCTAGGAAGCTGAAGATGAAGAACTTCAACTTCAGCATAACAATAGCCCAAAGTGTACATCTAAATCAACAAAGCAATGGCTTCTTGGTAACTTTTGCAAGGAGTGGGCAAAAATTGCAGAGTCTATATGTCCCAAAAAGACTGAGTGCTGTAATAAAATCAAAAGGGGCTTCAACCAAGTATTAGTTTAAGGGGTGAGCACACAGGTTTTTGTATGGTCTATGTTTTCCTTCACTAAACTGTTTTCAGCTTCTTTGTATAGTTGTCAATAGCTGGCTTAAGTTCTGACAGGATTTATATCCAGTGTACTTATGTATGCAATGTGTAGGGTTTCCCACCAGCAATTACAGTCACATTACTGCTGGTGAGAGGGAAACTGTTTTGTTGCCACAGTAGCACAGTAGCCCATTGTCCTAAAGCTTTGTTTAGCTAGTTTAGTGATTATAGCTCCTTTATACAAAAAAATGCCTTAAAAACAAATGATTTCATGCAAACTGTAAACAATATAATGTGTGTGTAACCTTCCATGTGGATTAGATTTATTTGGAAGAACACATTTATTTTTTCAATTTACTTTGATGCACTAAATATTAATATTTAACGTTTTGTGTGCAGCACAATTTCTCAGTGCAACGTATTGGTTATTCTAGTGTTCAAGAGTTTATAGCCTGTGCATCTACCAAACTGTAAAGGTAATTATTTAAAGAGGTTTTATAATGTTTTTCTTAATCTATTCCTGAAGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGTTGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTGGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACT
  5   1   4      seed Ovi1      in                         CABI4662.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCGAGGTACATACCCCTGCAAAATGGACAGTTTTTGTTTAATTTAAAAAAAAAAACAACCCTGATAAATCCTTTCACAACCTTAGTGGTCAGGgaggtctacggcaacagaaaaggggctgcaggatttcttggtatgtattggttgttccctacatgtgacaacagtcagttgtattcttcatcatatctgggttctggagtagggtagcaagaccaaaTCATTTACTCACAAAAAAAAAAAACATCCAAACAGGTATACCCAGTCTCCAACATGTATTATGTTttatggtctgatgagaccaaggttgaactgtttggccataattccaaaatgtatgtttggcacaaaaataacacagaacgccatcacaagaacaccatacccatagttaagcatggcggaggcatcatgctatgggctgcatttcatcagctggaactggtggtttagtcaagatggatggaatcatgaatagatcggcctattttgtaagaactttcaatcgtctgctaggaagctgaagatgaagaacttcaacttcagcataacaatagcccaaagtgtacatctaaatcaacaaagcaatggcttcttggtaacttttgcaaggagtgggcaaaaattgcagagtctatatgtcccaaaaagactgagtgctgtaataaaatcaaaaggggcttcaaccaagtattagtttaagggGTGAGCACACAGGTTTTTGTATGGTCTATGTTTTCCTTCACTAAACTGTTTTCAGCTTCTTTGTATAGTTGTCAATAGCTGGCTTAAGTTCTGACAGGATTTATATCCAGTGTACTTATGTATGCAATGTGTAGGTTTTCCCACCAGCATTACAG
  3  -1   3        nb Spl1      in                         CABK1361.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CaagaacaccatacccatagttaagcatggcggaggcatcatgctatgggctgcatttcatcagctggaactggtggtttagtcaagatggatggaatcatgaatagatcggcctattttgtaagaactttcaatcgtctgctaggaagctgaagatgaagaacttcaacttcagcataacaatagcccaaagtgtacatctaaatcaacaaagcaatggcttcttggtaacttttgcaaggagtgggcaaaaattgcagagtctatatgtcccaaaaagactgagtgctgtaataaaatcaaaaggggcttcaaccaagtattagtttaagggGTGAGCACACAGGTTTTTGTATGGTCTATGTTTTCCTTCACTAAACTGTTTTCAGCTTCTTTGTATAGTTGTCAATAGCTGGCTTAAGTTCTGACAGGATTTATATCCAGTGTACTTATGTATGCAATGTGTAGGGTTTCCCACCAGCAATTACAGTCACATTACTGCTGGTGAGAGGGAAACTGTTTTGTTGCCACAGTAGCACAGTAGCCCATTGTCCTAAAGCTTTGTTTAGCTAGTTTAGTGATTATAGCTCCTTTATACAAAAAAATGCCTTAAAAACAAATGATTTCATGCAAACTGTAAACAATATAATGTGTGTGTAACCTTCCATGTGGATTAGATTTATTTGGAAGAACACATTTATTTTTTCAATTTACTTTGATGCACNTAATATTAATATTTAACGTTTTGTGTGCAGCACAATTTCTCAGTGCAACGTATTGGTTATTCTAGTGTTCA
  5   1   2       ext Fat1      in                         CABC9222.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCGAGGGGCTTCTTGGTAACTTTTGCAAGGAGTGGGCAAAAATTGCAGAGTCTATATGTcccaaaaagactgagtgctgtaataaaatcaaaaggggcttcaaccaagtattagtttaagggGTGAGCACACAGGTTTTTGTATGGTCTATGTTTTCCTTCACTAAACTGTTTTCAGCTTCTTTGTATAGTTGTCAATAGCTGGCTTAAGTTCTGACAGGATTTATATCCAGTGTACTTATGTATGCAATGTGTAGGGTTTCCCACCAGCAATTACAGTCACATTACTGCTGGTGAGAGGGAAACTGTTTTGTTGCCACAGTAGCACAGTAGCCCATTGTCCTAAAGCTTTGTTTAGCTAGTTTAGTGATTATAGCTCCTTTATACAAAAAAATGCCTTAAAAACAAATGATTTCATGCAAACTGTAAACAATATAATGTGTGTGTAACCTTCCATGTGGATTAGATTTATTTGGAAGAACACATTTATTTTTTCAATTTACTTTGATGCACTAAATATTAATATTTAACGTTTTGTGTGCAGCACAATTTCTCAGTGCAACGTATTGGTTATTCTAGTGTTCAAGAGTTTATAGCCTGTGCATCTACCAAACTGTAAAGGTAATTATTTAAAGAGGTTTTATAATGTTTTTCTTAATCTATTCCTGAAGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAANATGACACCTGGACATGGGT
  5   1   2   14  ext Brn4 5g3  in                        CAAL19260.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTCTTTGTATAGTTGTCAATAGCTGGCTTAAGTTCTGACAGGATTTATATCCAGTGTACTTATGTATGCAATGTGTAGGGTTTCCCACCAGCAATTACAGTCACATTACTGCTGGTGAGAGGGAAACTGTTTTGTTGCCACAGTAGCACAGTAGCCCATTGTCCTAAAGCTTTGTTTAGCTAGTTTAGTGATTATAGCTCCTTTATACAAAAAAATGCCTTAAAAACAAATGATTTCATGCAAACTATAAACAATATAATGTGTGTGTAACCTTCCATGTGGATTAGATTTATTTGGAAGAACACATTTATTTTTTCAATTTACTTTGATGCACTAAATATTAATATTTAACGTTTTGTGTGCAGCACAATTTCTCAGTGCAACGTATTGGTTATTCTAGTGTTCAAGAGTTTATAGCCTGTGCATCTACCAAACTGTAAAGGTAATTATTTAAAGAGGTTTTATAATGTTTTTCTTAATCTATTCCTGAAGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGGTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGGTTGGAGGATTTG
  5   1   2   12  ext Tad5 5g3  in                         XZT65522.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTTAAGTTCTGACAGGATTTATATCCAGTGTACTTATGTATGCAATGTGTAGGGTTTCCCACCAGCAATTACAGTCACATTACTGCTGGTGAGAGGGAAACTGTTTTGTTGCCACAGTAGCACAGTAGCCCATTGTCCTAAAGCTTTGTTTAGCTAGTTTAGTGATTATAGCTCCTTTATACAAAAAAATGCCTTAAAAACAAATGATTTCATGCAAACTGTAAACAATATAATGTGTGTGTAACCTTCCATGTGGATTAGATTTATTTGGAAGAACACATTTATTTTTTCAATTTACTTTGATGCACTAAATATTAATATTTAACGTTTTGTGTGCAGCACAATTTCTCAGTGCAACGTATTGGTTATTCTAGTGTTCAAGAGTTTATAGCCTGTGCATCTACCAAACTGTAAAGGTAATTATTTAAAGAGGTTTTATAATGTTTTTCTTAATCTATTCCTGAAGGTGTCTGTGCTCTCAATGGGAAATTATATGTTGTTGGAGGTTCAGATCCATATGGCCAGAAAGGCCTTAAAAACTGTGACGTGTTTGACCCCATAACAAGGATGTGGACATGTTGTGCCCAGCTAAACATTAGAAGGCACCAGTCTGCTGTTTGTGAACTAGGCAACAAGATGTACATTATTGGAGGAGCTGAATCTTGGAATTGTCTAAATTCAGTAGAATGTTACAATCCTGAAAATGACACCTGGACATTGGTGGCGCCTATGAATGTGGCTCGACGTGNTGCTGGAGTTGCTGTTTATGAGGGAAAGCTATTTGTGG
  3   1   2       ext Fat1      in                         CABC9222.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTTACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTGNGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATG
  5  -1   3        nb Spl1      in                         CABK1361.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACACACCTGTGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTTGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAAT
  3   1   4      seed Ovi1      in                         CABI4662.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGCAAATCCTAGTAATCCTCATTTCTCATCAGATCTGCTGGGGCTTAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATG
  3   1   2       ext Brn4 5g3  in                        CAAL19260.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAAGTCCCTCATGTTTGTTGTACCAGCAACGTACGTTTTTGCATATTGCATATTTTCAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATCTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCACAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCACTCTGTAAAGGAAAACCACCAACAATATTTTATCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTCCCCCACTTCTAATGTACATTATTCTTAAATAAAATTGACTGTAAATG
  3   1   2       ext Tad5 5g3  in                         XZT65522.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAAAAAGTTGTAAATACTTATTTTTCATTTATTTGTAAGAAGGAAAGGTTAAAATAACTTGTGCTAACTTTGTAATTACTCTACTGTGGAATTCTATGAAACACAGGATTTTTTTTTTTTGTTCCTTTCTGCAAGCATTCTTGTGTATATGTTCGCTCTGTTCCTAATGCACTGACGTGTAGAGTTCCAGTTACTGAGTAGTTACAAAATTTTACACGGTTTTAATTGAATGCAAGTGATTTATTTTCTTTAGTATAAAATAATGTGCTTTAAAAGCCTTATTGAATCAAGATTTTTGAGTAAAGAAGTGCAGGTATGCCAAAACACGCACCTTTTGGATTGCCTTTTTATTACTGTTTTATATACTCAGTGGCAGGCCCAAGGAATTGTCAACACTTTATTAATGTATTTATCCTTCAAGCTGTGTATTTTGATAGACAGCATCATTTTTGCTTTCATGTAGGAAGACAGCTGCAGTCTTTTCAAATGCATTTTTTACTCTTTAAACAAAGGAATGTCTTGAAATGCAGAGACCGAAGCCAGTTGTTTAGAAACAGATTTGTCTGCAAATACTCATTTTTAGAGTCTTTGATCAAGCTGAATCTTTTTGTAGGCCCTCTGTAAAGGAAAACCCCCAACAATATTTTTTCATCGAAACAAGGAAGAAAAAAAACATTCAATAACTTTTTTTTCCCCACTTCTAATGTACATTATTTTTAAATAAAATTGGCTGTAAATGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)