Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 97%

 1012071148 Xt7.1-TGas064h04.3 - 133 ESTs
                                                                       .......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TGas064h04.3                                                                                                  AAATCAGCCGCGTCGAGGTTAAGGAAGTGATGTCATGGAGTGGGCAGGCTGAGGCAGAGAGTGCAGGAGCTTTCCAGAAGCTTGCGAGGGGGCCTGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCAAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTCAATGATGAACTGGAATCCTTCAAGGGCCGAGTGAGGGAGCGAGCCAAGGTTCGAATAGACAAGGCAATGAAGGAGTACGAGGAGGAGGAAAGGAAAAAGAGAATCGGTCCAGGCGGTTTGGATCCCGTGGAGGTGTATGAATCTCTCCCATCTGAGCTTCAGAAATGTTTTGATTCTAAAGATATTCAGATGTTACAGGACACCATCAGCAAAATGGACCCAACTGAAGCAAGATTTTTTATGAAGCAGTGCATTGACTCAGGACTTTGGGTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTC
                                                  Xt7.1-CHK-1008222547                                                                                                        GCCGCGTCGAGGTTAAGGAAGTGATGTCATGGAGTGGGCAGGCTGAGGCAGAGAGTGCAGGAGCTTTCCAGAAGCTTGCGAGGGGGCCTGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCAAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTCAATGATGAACTGGAATCCTTCAAGGGCCGAGTGAGGGAGCGAGCCAAGGTTCGAATAGACAAGGCAATGAAGGAGTACGAGGAGGAGGAAAGGAAAAAGAGAATCGGTCCAGGCGGTTTGGATCCCGTGGAGGTGTATGAATCTCTCCCATCTGAGCTTCAGAAATGTTTTGATTCTAAAGATATTCAGATGTTACAGGACACCATCAGCAAAATGGACCCAACTGAAGCAAGATTTTTTATGAAGCAGTGCATTGACTCAGGACTTTGGGTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCCACAAA
                                                      consensus depths                                                                                                       3     3     3     3     5     5     7     7    11    12    21    23    32    34    34    35    37    38    37    39    40    42    47    49    48    49    50    51    50    52    53    54    53    54    52    54    54    55    56    57    56    57    56    57    56    57    54    56    56    56    56    56    55    55    54    55    55    55    54    55    54    57    56    57    57    57    56    57    52    54    51    54    54    54    52    52    50    53    51    53    51    52    51    52    49    51    48    51    49    51    48    49    45    48    47    48    47    50    46    50    48    50    48    50    47    50    48    50    48    49    47    49    47    49    46    49    46    48    45    47    45    47    42    44    41    44    41    44    40    44    40    45    40    45    38    45    38    45    37    43    37    43    32    39    34    41    33    37    32    36    31    36    28    32    15    26    16    24    15    23    15    22    14    19    15    19    16    20    15    17    15    17    14    18    14    18    12    16    14    17    14    18    16    20    16    20    19    27    24    31    28    33    30    35    27    36    31    38    33    41    35    43    36    46    38    49    38    49    40    51    40    51    41    52    41    52    42    53    42    53    42    53    43    54    43    54    43    55    42    53    41    53    40    55    56    58    53    58    57    59    58    59    58    59    58    59    57    59    58    62    59    62    59    62    58    61    59    62    59    62    60    62    60    62    61    62    57    61    56    60    57    60    58    61    61    61    57    64    63    64    61    65    61    63    61    63    60    62    59    62    59    60    59    60    60    60    58    59    58    59    56    58    57    58    56    57    54    57    57    57    57    57    57    57    56    57    54    56    53    56    51    55    48    52    49    51    41    45
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CACTTGTCTACTTTACAGTTATCATAGTTATTCATAGTATTTTATTTTTGTTTTTAATCAACATATTTATTCACTTGCATTGCA
                                                                   SNP                                                                                                                                                                                                                                      -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                  ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                              ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                              ------C-G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----------C
                                               BLH ATG     151    2156                                                                                                  
                                               BLH MIN     148     193                                                                                                  
                                               BLH MPR     145     193                                                                                                  
                                               BLH OVR     151      49                                                                                                  
                                               CDS MIN     151      25                                                                                                  
                                               EST CLI      54      25                                                                                                  
                                               ORF LNG     151       4                                                                                                  
                                                                                                                                                                                                                                                                                                                            PROTEIN === Ce ==== 2e-075     NP_001040820.1 Cell Division Cycle related family member (cdc-37) [Caenorhabditis elegans] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                               PROTEIN === Dm ==== 5e-111     NP_477006.1 Cdc37 CG12019-PA [Drosophila melanogaster] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                           PREDICTED - Sp ---= 6e-117     XP_790817.2 PREDICTED: similar to Cell division cycle 37 homolog (S. cerevisiae) [Strongylocentrotus purpuratus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                         PROTEIN === Dr ==== 8e-155     NP_957332.1 similar to cell division cycle 37 homolog [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                               PROTEIN === Mm ==== 2e-163     NP_058022.1 cell division cycle 37 homolog (S. cerevisiae); cell division cycle 37 [Musmusculus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                               PROTEIN === Hs ==== 4e-166     NP_008996.1 CDC37 homolog [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                               PROTEIN === Gg ==== 5e-173     NP_990025.1 CDC37 protein [Gallus gallus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                               PREDICTED = Xl ==== 0          AAH41715.1 Similar to CDC37 cell division cycle 37 homolog (S. cerevisiae) [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                               PROTEIN === ?? ==== 0          NP_001080276.1 CDC37 cell division cycle 37 homolog [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                               PROTEIN === Xt ==== 0          CAJ83379.1 cdc37 cell division cycle 37 homolog (S. cerevisiae) [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TGas064h04.3                                                                                                                     TAA------------ATG------------TGA------------------------------------------------------------------TGA------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------------TAGATG---------TGA------------------------------------------TAG---TAG---------------------------------------------------TAA---------------------------ATGTGA------TAA------------TAG------------TGA------------TAG------------ATG---------------------------------TAA---------------TAAATG---------------------------------TGA------ATG---------------------------------------------------------------------------TGA---------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------TAG------TAG------------------------TAA------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                         [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
  0   1   1           Tad5 FL                          XZT59008.FL-MGC                                                                                                                                                                            CAGAAGCTTGCGAGGGGGCCTGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATTTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCAAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTCAATGATGAACTGGAATCCTTCAAGGGCCGAGTGAGGGAGCGAGCCAAGGTTCGAATAGACAAGGCAATGAAGGAGTACGAGGAGGAGGAAAGGAAAAAGAGAATCGGTCCAGGCGGTTTGGATCCCGTGGAGGTGTATGAATCTCTCCCATCTGAGCTTCAGAAATGTTTTGATTCTAAAGATATTCAGATGTTACAGGACACCATCAGCAAAATGGACCCAACTGAAGCAAGATTTTTTATGAAGCAGTGCATTGACTCAGGACTTTGGGTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCCACAAAAAAAAAAAAAAAA
  0   1   1           Gas  FL                     TGas127m02.FL-Sanger                                                                                                                                                                                                  CAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCAAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTCAATGATGAACTGGAATCCTTCAAGGGCCGAGTGAGGGAGCGAGCCAAGGTTCGAATAGACAAGGCAATGAAGGAGTACGAGGAGGAGGAAAGGAAAAAGAGAATCGGTCCAGGCGGTTTGGATCCCGTGGAGGTGTATGAATCTCTCCCATCTGAGCTTCAGAAATGTTTTGATTCTAAAGATATTCAGATGTTACAGGACACCATCAGCAAAATGGACCCAACTGAAGCAAGATTTTTTATGAAGCAGTGCATTGACTCAGGACTTTGGGTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCCAC
  3   1   1         - Gas       in                    TGas118i08.q1kT7 CAAGAACAAACCTGCCTGTCTAGCAAAGGCGGAAGTGACGCAAGGAGAATGGAATAGGCAAAAAAGGAAGTCGGCCCGAAGACTCTAGCGTAAGGGCAAATCAGCCGCGTCGAGGTTAAGGAAGTGATGTCATGGAGTGGGCAGGCTGAGGCAGAGAGTGCAGGAGCTTTCCAGAAGCTTGCGAGGGGGCCTGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTTATTTAACGTAAAATCTGAAAAAAAAAAAAAAAAAA
  5   1   1         - Gas       in                   TGas118i08.p1kSP6  AAGAACAAACCTGCCTGTCTAGCAAAGGCGGAAGTGACGCAAGGAGAATGGAATAGGCAAAAAAGGAAGTCGGCCCGAAGACTCTAGCGTAAGGGCAAATCAGCCGCGTCGAGGTTAAGGAAGTGATGTCATGGAGTGGGCAGGCTGAGGCAGAGAGTGCAGGAGCTTTCCAGAAGCTTGCGAGGGGGCCTGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGC
  5   1   1       chi Egg  5x                        TEgg117l02.p1kSP6                                                                                                GCAAATCAGCCGCGTCGAGGTTAAGGAAGTGATGTCATGGAGTGGGCAGGCTGAGGCAGAGAGTGCAGGAGCTTTCCAGAAGCTTGCGAGGGGGCCTGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAAAAAAAAAAAAAAAAAAGGCAGCTTGTTGCTATTATTCTTGGTCGTTCTCTCACTTACATGCATGATATTGTAATAACATGGCAGCCGAGTGTCGGAGTTTAATGGAGAGGATCTGTGCAAGGGGCGGCTGGAGCGGAAAGGCGGCGGACGGGCAGCAAGCTAAAAAGTTTCTTAGTAACTCCCATGTACGAGATGTGATGAGCCCA
  3   1   1         - BrSp      in                      EC2BBA7CG05.b1                                                                                                                  GGGGAAGGAAGTGATGTCATGGAGTGGGCAGGCTGAGGCAGAGAGTGCAGGAGCTTTCCAGAAGCTTGCGAGGGGGCCTGCAGCTGCACCCTGGCGTGCCAGTGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGAAGGGCTTTAGCAAG
  5   1   1         - BrSp      in                      EC2BBA7CG05.g1                                                                                                                   GGGAAGGAAGTGATGTCATGGAGTGGGCAGGCTGAGGCAGAGAGTGCAGGAGCTTTCCAGAAGCTTGCGAGGGGGCCTGCAGCTGCACCCTGGCGTGCCAGTGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAAAAAAAAAAAAAAAAAA
  5   1   1   12    - Gas7 5g3  in                         XZG49030.5p ................................................................................................................................GTCATGGAGTGGGCAGGCTGAGGCAGAGAGTGCAGGAGCTTTCCAGAAGCTTGCGAGGGGGCCTGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGAT
  5   1   1         - BrSp 5g3  in                     EC2BBA24BG03.g1                                                                                                                                      GGGGTGGGCAGGCTGAGGCAGAGAGTGCAGGAGCTTTCCAGAAGCTTGCGAGGGGGCCTGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTT
  5   1   1   20    - Ovi1 5g                              CABI4771.5p .........................................................................................................................................TGGGCAGGCTGAGGCAGAGAGTGCAGGAGCTTTCCAGAAGCTTGCGAGGGGGCCTGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCAAGATTAAGACTGCAGAC
  5   1   1   12    - Gas7 5g3  in                         XZG43067.5p ...........................................................................................................................................GGCAGGCTGAGGCAGAGAGTGCAGGAGCTTTCCAGAAGCTTGCGAGGGGGCCTGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGAT
  5   1   1   10    - Ovi1 5g3  in                          CABI741.5p .............................................................................................................................................CAGGCTGAGGCAGAGAGTGCAGGAGCTTTCCAGAAGCTTGCGAGGGGGCCTGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCATCAAGATTAAGACTGCAGACCAGCAGTACATGGA
  5   1   1   10    - Ova1 5g3  in                         CABE3434.5p ................................................................................................................................................CTCGATTCAATTCGGCACGAGGCTTTCCAGAAGCTTGCGAGGGGGCCTGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCAAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTCAATGATGAACTGGAATCCTTCAGGG
  5   1   1   14    - Te4  5g3  in                         CAAN3160.5p .................................................................................................................................................CTGAGGCAGAGAGTGCAGGAGCTTTCCAGAAGCTTGCGAGGGGGCCTGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGNAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGGCTGCTTCCGACAGT
  5   1   1         - In63 5g                         IMAGE:8960670.5p                                                                                                                                                   AACGGTTGAGAGTGCAGGAGCTTTCCAGAAGCTTGCGAGGGGGCCTGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATTTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGAACTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGACAGTCGCCCATCAGACCATTGTTATGCAGTTATCTGAGCTGACAGAGCTGAAGGTGGATCCAGGCTGCTTCGACAGTTCTTCCCCAGATTAGAACTGCAGAACCAGCAGTACATG
  3   1   1         - BrSp      in                     EC2BBA23DC03.b1                                                                                                                                                     GGGGAGGGAGTGCAGGAGCTTTCCAGAAGCTTGCGAGGGGGCCTGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACC
  5   1   1         - BrSp      in                     EC2BBA23DC03.g1                                                                                                                                                      GGGAGGGAGTGCAGGAGCTTTCCAGAAGCTTGCGAGGGGGCCTGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAAAAAAAAAAAAAAAAAAAA
  3   1   1         - HeRe      in                     EC2CAA45DF03.b1                                                                                                                                                       GGAGAGAGTGCAGGAGCTTTCCAGAAGCTTGCGAGGGGGCCTGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGATGAGTTAAGTAAAGGGGCCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTCAGTGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGA
  5   1   1         - HeRe 5g                          EC2CAA42CC01.g1                                                                                                                                                        GAGAGAGTGCAGGAGCTTTCCAGAAGCTTGCGAGGGGGCCTGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGATGAGTTAAGTAAAGGGGCCAGCGATTGTAATAAGAAGCTGGCAGAGTGTCAGAAGAAGCTCAGTGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAAGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAGCTGATGAAGAAAGAGAAGAACATGCCGTGGAATGTACACACTCTGAGCAAGGAGGGCTTCATCAAGAGTGTATTTAATGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAGCACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAAATATTTATCCGATAACCCTCATCTGGTGGGTGAAAAAGA
  5   1   1         - HeRe      in                     EC2CAA45DF03.g1                                                                                                                                                        GAGAGAGTGCAGGAGCTTTCCAGAAGCTTGCGAGGGGGCCTGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGATGAGTTAAGTAAAGGGGCCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTCAGTGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAAGAGCAGAAGGACTGGGAGAAGTAAAAAAAAAAAAAAAAAAAA
  5   1   1   12    - Tad5 5g3  in                         XZT18864.5p .......................................................................................................................................................GTGAGAGTGCAGGAGCTTTCCAGAAGCTTGCGAGGGGGCCTGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATTTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAG
  5   1   1         - TbA  5g                        TTbA022o03.p1kSP6                                                                                                                                                            CCCGGGGGGTGCTTTCCAGAAGCTTGCGAGGGGGCCTGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACCTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAAAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTTGAANGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCNACAAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTTCATGATGAACTGGA
  5   1   1   22    - Tad5 5g                              XZT55154.5p ...........................................................................................................................................................GAGTGCAGGAGCTTTCCAGAAGCTTGCGAGGGGGCCTGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATTTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCAAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTCAATGATGAACTGAAATCCTTCAA
  5   1   1         - TpA  5g3  in                  TTpA046h03.p1kaSP6                                                                                                                                                             AGTGCAGGAGCTTTCCAGAAGCTTGCGAGGGGGCCTGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACTCAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTCAATGATGAACTGGAATCCTT
  5   1   1   12    - Gas7 5g3  in                         XZG51410.5p .............................................................................................................................................................GTGCAGGAGCTTTCCAGAAGCTTGCGAGGGGGCCTGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCCAGATAAAGACTGCAGACCAGCAGTACATGGACGCGTTCAATGATGAACTGGAATCCTTCAGGGCCGAGTGAGGGAGCGAGCCAG
  5   1   1   10    - Ski1 5g3  in                         CABJ9228.5p ...............................................................................................................................................................ATTCAATTCGGCACGAGGCTTGCGAGGGGGCCTGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCAAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTTCATGATGAACTGGAATCCTTCAGGGCCGAGTGAGGGAGCGAGCCAAGGTTCGAATAGACAAGGCAATGA
  5   1   1   10    - Spl2 5g3  in                        CBSS2366.fwd ...............................................................................................................................................................GCAGGAGCTTTCCAGAAGCTTGCGAGGGGGCCTGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTAT
  5   1   1   20    - Tbd1 5g                             CBXT14876.b1 ..................................................................................................................................................................GGAGCTTTCCAGAAGCTTGCGAGGGGGCCTGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGG
  5   1   1   24    - Brn3 5g                              CAAK8386.5p ...................................................................................................................................................................GAGCTTTCCAGAAGCTTGCGAGGGGGCCTGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCAAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTCAATGATGAACTGGAATCCTC
  5   1   1   14    - Brn4 5g3  in                        CAAL11065.5p ...................................................................................................................................................................GAGCTTTCCAGAAGCTTGCGAGGGGGCCTGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCCAGATTAAGACTG
  5   1   1         - Gas  5g                        TGas031n22.p1kSP6                                                                                                                                                                       CTTTCCANAAGCTTGCGAGGGGGCCTGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACCTGGTCATCTGGTGCATTGA
  5   1   1   10    - Ova1 5g3  in                         CABE6448.5p ......................................................................................................................................................................CTTTCCAGAAGCTTGCGAGGCGGCCTGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTCGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCAAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTCAATGATGAACTGGAATCCTTCAGGGCCGAGTGAGGGAGCGAGCCAGGTTCGAATAA
  5   1   1   12    - Gas7 5g3  in                         XZG33048.5p ......................................................................................................................................................................CTTTCCAGAAGCTTGCGAGGGGGCCTGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTTCACCAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTCAATGATGAACTGGAATCCTTTCAGGGCCGAGTGAGGGAGCGAGCCAAGGTTCGAATAGACAAGCAATGAAGG
  5   1   1         - Egg  5g                        TEgg084f10.p1kSP6                                                                                                                                                                        TTTCCAGAAGCTTGCGAGGGGGCCTGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAAGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTATGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAACAACGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAATAAAGAGAAGAACATGCCGTGGAATGTACACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAGAACAAGGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACGAAGCCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTATGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACT
  5   1   1         - Gas  5g                        TGas112m08.p1kSP6                                                                                                                                                                         TTCCAGAAGCTTGCGAGGGGGCCTGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGT
  5   1   1         - Neu  5x                        TNeu128p05.p1cSP6                                                                                                                                                                          CGGAGCTTTCCTAACTTGCAGGGGCCTGGGGGTGGGGGCTGTGTGCCAATGAATCTCTTGTTTGTCTGATTTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCATGGCGTCACCAGGGGGTCGTTGGGAGGATGGAGCATTCACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTGAGAAGAAGCTGGGAGAGTGTCAAAAAAAGCTGAATGAGCTATGCCTTAAGGAGGGAGGAGAAAGTGACGTACACAAGCTACAGTCACACCTGTGTCAGCTGAAAAAAGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAGCTGAGGAAGAAAGAGAAGAACAT
  5   1   1         - Tad5 FL   in                         XZT59008.5p                                                                                                                                                                            CAGAAGCTTGCGAGGGGGCCTGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATTTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCAAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTCAATGATGAACTGGAATCCTTCAAGGGCCGAGTG
  5   1   1         - BrSp 5g3  in                     EC2BBA27AC12.g1                                                                                                                                                                                           GGGCCTGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATTTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGAT
  5   1   1   10    - Liv1 5g3  in                         CAAR3786.5p ...............................................................................................................................................................................................TGCAGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCAAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTNCATGATGAACTGGAATCCTTCA
  5   1   1         - HdA  5g3  in                   THdA021n24.p1kSP6                                                                                                                                                                                                 CCTGCTGCACCCTGGTGTGCCAGTGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCAAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTCAATGATGAACTGGA
  5   1   1         - Gas  FL   in                   TGas127m02.p1kSP6                                                                                                                                                                                                     GCTGCACCCTGGTGTGCCAGTGAATCTCCGTTAGAGTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTC
  5   1   1   10    - Liv1 5g3  in                        CAAR12744.5p ..................................................................................................................................................................................................................GCCAGTGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCAAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTCAATGATGAACTGGAATCCCTTCAGGGCCGAGTGAGGGAGCGAGCCAAGGTTTCGATAGACAAGGCAATGAAGGAGTACGAGGAGG
  5   1   1   10    - Liv1 5g3  in                         CAAR3134.5p ..................................................................................................................................................................................................................GCCAGTGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCAAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTCAATGATGAACTGGAATCCTTCAGGGCCGAGTGAGGGAGCGAGCCAAGGTTCGAATAGACAAGGCAAT
  5   1   1   10    - Hrt1 5g3  in                        CAAQ10372.5p .......................................................................................................................................................................................................................TGAATCTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCAAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTCAATGATGAACTGGAATCCTTCAAGGGCCGAGTGAGGGAGCGAGCCAAGGTTCGAATAGACAAGGCAATGAAGGAGTACGAGGAGGAGGAAAGGAAAAAGAGAAATCGGT
  5   1   1         - TpA  5g3  in                   TTpA027d03.p1kSP6                                                                                                                                                                                                                             CTCTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCAAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTCAATGATGAACTGGAATCCTTNCAGGGCCGAGTGAGGGAGCGAGCNCAGGTTCGAATAGACAAAGGCATGAAGGAGTAC
  5   1   1   12    - Gas7 5g3  in                         XZG22186.5p ..............................................................................................................................................................................................................................CTTGTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCCAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCAAGATTAAGACTGCAGA
  5   1   1       chi Tbd0 5g                            IMAGE:6980405                                                                                                                                                                                                                                  GTTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGNCAGAGTGTATTTAACGTAAAATCTGAAAAACAAAGAGTTACAGAGGAGGAGAAAGAAACAAAGCCCAAAACCTTTGTCGAGAAGAACGTCAAGCAACTGAAACACTTTGGTATGCTGCACCGCTGGGAAGACAGCTCAAAATATTTTTCCCAAAACCCTCCATGGGTGGGGGAAAAAACTGGCAAAAACTTGGGCCTCGGGGGCCTGTGTTTAAAAGGGGAAAAAAAAACCCCCTTTTTGGAAAAATTCCCCCCCAAAACCTTTTTTTGGGTTTTTTCCTGGAGGGCGCCAAAACTTTAAGGGGGTTCCCGGGGGGCTTCTTCAAATTT
  5   1   1         - Gas  5g                        TGas021g19.p1kSP6                                                                                                                                                                                                                                   TTTGTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATC
  5   1   1         - Abd0 5g                            IMAGE:7017771                                                                                                                                                                                                                                      GTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGT
  3  -1   1         - Int1      in                        CAAP11503.3p                                                                                                                                                                                                                                      GTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCAAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTCAATGATGAACTGGAATCCTTCAGGGCCGAGTGAGGGAGCGAGCCAAGGTTCGAATAGACCAGGCAATGAAGGAGTACGAGGAGGAGGAAAGGAAAAAGAGAATC
  5   1   1   10    - Eye  5g3  in                         CCAX2063.b1 .....................................................................................................................................................................................................................................GTCTGATCTCTGCTACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCAAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTCAATGATGAACTGGAAT
  5   1   1   10    - Int1 5g3  in                        CAAP12886.5p ...................................................................................................................................................................................................................................................ACACAATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCAAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTCAATGATGAACTGGAATCCTTCAGGGCCGAGTGAGGGAGCGAGCCTAGGTTCGAATAGACAAGGCAATGAAAGAGTACGAGGAGGGAGGAAAGGAAAAGAGAAATC
  5   1   1         - Tad5      in                           XZT583.5p                                                                                                                                                                                                                                                         ATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCCAGAGCTTTGAGGTGGATCCCAGGGCCT
  5   1   1         - HdA                            THdA034c15.p1kSP6                                                                                                                                                                                                                                                                        CGTGTGGGACCCATTGAAGTTTCTGATCACTAAGATGACACTCATCCCAGCATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACGAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAAACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCAAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTTCATGATGAACTGGAATC
  5   1   1         - Tad5      in                          XZT1045.5p                                                                                                                                                                                                                                                                                 CCCATTGAAGTTTCTGATGACGAAGATGACACTCATCCCAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCAAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTCAATGATGAACTGGAATCCTTCANGGCCGAGTGA
  5   1   1         - HdA       in                   THdA002l02.p1kSP6                                                                                                                                                                                                                                                                                     TTGAACTTTCTGATGACGAAGATGACACTCGTCCCCACATTGACTCTGCCCTTCTTTTCCGATGGCGTCACCATGCTCGCGTGGAATGGATGGAGCAGTTCGACC
  5   1   1         - Hrt1      in                         CAAQ9831.5p                                                                                                                                                                                                                                                                                                                       CAACATTGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCAAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTCAATGATGAACTGGAATCCTTNCAGGGCCGAGTGAGGGAGCGAGCCAAGGTTCGAATAGACAAGGCAATGAAGGAGTACGAGGAGGAGGAAAGGAAAAAGAGAATCGGTCCAGGCGGTTTGGATCCCGTGGAGGTGTATGAATCTCTCCCATCTG
  5   1   1         - Neu0      in                     NISC_ng10b02.y1                                                                                                                                                                                                                                                                                                                             NGACACTGCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGAT
  5   1   1         - Tad5                                 XZT67089.5p                                                                                                                                                                                                                                                                                                                                    GCCAGTCTTTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGGATGGAGCAGTTCGACAAGGAGAAAGAGGAGTTAAGTAAAGGGACCAGCGATTGTAAGAAGAAGCTGGCAGAGTGTCAGAAGAAGCTGAATGACCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCAAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTCAATGATGAACTGGAATCCTTCAAGGGCCGAGTGAGGGAGCGAGCCAAGGTTCGAATAGACAAGGCAATGAAGGAGTACGAGGAGGAGGAAAGGAAAAAGAGAATCGGTCCAGGCGGTTTGGATCCCGT
  5   1   1         - TbA                            TTbA069g18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGACTGACCTAGGCCTTACCGATGGAGGACCAATTGACGTACATAAGCTACAGTCACACCTGTGTCAGCTGACGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGATCTGAGGAATAACGATAATAACATGCCGTGGAATGTAGACACTCTGAGCAGGGATGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAACACAAAGAAGTAACAGAGGAGGAGAAAGAACGAAAGCACAAATCCTTTGTCAAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCGCCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTACAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCATACCATTGTTATGCAGTTTATCCTGGACCTGGCCAAGAGCTTGAACGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCAAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTCAATGATGAACTGGAATCCTTC
  5   1   1         - Abd0                               IMAGE:7015780                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCGGGATCTAGGCCTTAAGGATGGAGGACAAAGTGACGTACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAGGAGCAGAAGGACTGGGAGAAGAAAGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCAAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTCAATGATGAACTGGAATCCTTCAAGGGCCGAGTGAGGGAGCGAGCCAAGGTTCGAATAGACAAGGCAATGAAGGAGTACGAGGAGGAGGANAGGAAAAAGAGAATCGGTCCAGGCGGTTTGGATCCCGTGGAGGTGTATGAATCTCTCCCATCTGAGCTTCAGAAATGTTTTGAA
  5   1   1         - Thy1      in                        CBST5857.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGAGAATGAACTGAGGAAGAAAGAGAAGAACATGCCGTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCCGTCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCAAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTCAATGATGAACTGGAATCCTTCAAGGGCCGAGTGAGGGAGCGAGCCAAGGTTCGAATAGACAAGGCAATGAAGGAGTACGAGGAGGAGGAAAGGAAAAAGAGAATCGGTCCAGGCGGTTTGGATCCCGTGGAGGTGTATGAATCTCTCCCATCTGAGCTTCAGAAATGTTTTGATTCTAAAGATATTCAGATGTTACAGGACACCATCAGCAAAATGGACCCAACTGAAGCAAGATTTTTTATGAAGCAGTGCATTGACTCAGGACTTTGGGTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATAT
  5   1   1         - Tad5                                 XZT64549.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAGAGTGTATTTAACGTAAAATCTGAAAACAAAGAAGTAACAGAGGAGGAGAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACTTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCAAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTCAATGATGAACTGGAATCCTTCAAGGGCCGAGTGAGGGAGCGAGCCAAGGTTCGAATAGACAAGGCAATGAAGGAGTACGAGGAGGAGGAAAGGAAAAAGAGAATCGGTCCAGGCGGTTTGGATCCCGTGGAGGTGTATGAATCTCTCCCATCTGAGCTTCAGAAATGTTTTGATTCTAAAGATATTCAGATGTTACAGGACACCATCAGCAAAATGGACCCAACTGAAGCAAGATTTTTTATGAAGCAGTGCATTGACTCAGGACTTTGGGTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATA
  5   1   1         - Hrt1      in                         CAAQ1752.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GaggggtaatgtacccccnttctgtaaattataaggatattggaagtcactgagCTGTTCCATAAACAAACCAAAAGACTATAGTCTTATGGAAGTCTTATGTTTTATCTTTTACATAAGTTCTAGTGAGTCATCTGACACATGTCACTAAGCAcccatacacgggccgattctagctgccaacatctgtcccttagactgtttcggcagcttatcggcctgtgtatgggcactaacgacgcacctgcctgacagacatctggcctgacattgggttagttgatgcggtccccaaaccaacgggcgcccatacctgctgttctaatccgatcgtttggctccagggccaaacgactgaataagcccaatatcttccacccataggtggggctgtcgggagaagatccgctcgcttggggacctcgccaggcaagcagatcttagcgtgtatagccatcttaACTGATGACATCACTTGTCTACTTTACAGTTATCATAGTTATTCATAGTATTTTATTTTTGTTTTTAATCAACATATTTATTCACTTGCATTGCAGGAAGCAAGATTTTTTATGAAGCAGTGCATTGACTCAGGACTTTGGGTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATA
  5   1   1         - Tad0      in                     NISC_no20e02.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAAAGAACAAAAGCACAAAACCTTTGTCGAGAAGAACGTCAAGCAGCTGAAACACTTTGGTATGCTGCACCGCTGGGATGACAGTCAAAAATATTTATCCGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACCTGGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCAAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTCAATGATGAACTGGAATCCTTCAAGGGCCGAGTGAGGGAGCGAGCCAAGGTTCGAATAGACAAGGCAATGAAGGAGTACGAGGAGGAGGAAAGGAAAAAGAGAATCGGTCCAGGCGGTTTGGATCCCGTGGAGGTGTATGAATCTCTCCCATCTGAG
  5   1   1         - Te3       in                         CAAM8763.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGAGAAACACGCTCTTATGGAACAAGTCGCCCATCAGACCATTGTTATGCAGTTTATCCTGGAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCAAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTCAATGATGAACTGGAATCCTTCAAGGGCCGAGTGAGGGAGCGAGCCAAGGTTCGAATAGACAAGGCAATGAAGGAGTACGAGGAGGAGGAAAGGAAAAAGAGAATCGGTCCAGGCGGTTTGGATCCCGTGGAGGTGTATGAATCTCTCCCATCTGAGCTTCAGAAATGTTTTGATTCTAAAGATATTCAGATGTTACAGGACACCATCAGCAAAATGGACCCAACTGAAGCAAGATTTTTTATGAAGCAGTGCATTGACTCAGGACTTTGGGTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGT
  5   1   1         - Hrt1      in                         CAAQ8881.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          cggcagcttatcggcctgtgtatgggcactaacgacgcacctgcctgacagacatctggcctgacattgggttagttgatgcggtccccaaaccaacgggcgcccatacctgctgttctaatccgatcgtttggctccagggccaaacgactgaataagcccaatatcttccacccataggtggggctgtcgggagaagatccgctcgcttggggacctcgccaggcaagcagatcttagcgtgtatagccatcttaACTGATGACATCACTTGTCTACTTTACAGTTATCATAGTTATTCATAGTATTTTATTTTTGTTTTTAATCAACATATTTATTCACTTGCATTGCAGGAAGCAAGATTTTTTATGAAGCAGTGCATTGACTCAGGACTTTGGGTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTAC
  5   1   1         - TpA       in                   TTpA024c12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCTGGAGCTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCAAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTCAATGATGAACTGGAATCCTTCAAGGGCCGAGTGAGGGAGCGAGCCAAGGTTCGAATAGACAAGGCAATGAAGGAGTACGAGGAGGAGGAAAGGAAAAAGAGAATCGGTCCAGGCGGTTTGGATCCCGTGGAGGTGTATGAATCTCTCCCATCTGAGCTTCAGAAATGTTTTGATTCTAAAGATATTCAGATGTTACAGGACACCATCAGCAAAATGGACCCAACTGAAGCAAGATTTTTTATGAAGCAGTGCATTGACTCAGGACTTTGGGTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCANCAGCTGTTAATTG
  5   1   1         - Gas       in                   TGas064h04.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCAAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTCAATGATGAACTGGAATCCTTCAAGGGCCGAGTGAGGGAGCGAGCCAAGGTTCGAATAGACAAGGCAATGAAGGAGTACGAGGAGGAGGAAAGGAAAAAGAGAATCGGTCCAGGCGGTTTGGATCCCGTGGAGGTGTATGAATCTCTCCCATCTGAGCTTCAGAAATGTTTTGATTCTAAAGATATTCAGATGTTACAGGACACCATCAGCAAAATGGACCCAACTGAAGCAAGATTTTTTATGAAGCAGTGCATTGACTCAGGACTTTGGGTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCAT
  3   1   1         - Gas7 5g3  in                         XZG22186.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGGGCCTGCTTCCGACAGTTTTTCACCAAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTCAATGATGAACTGGAATCCTTCAAGGGCCGAGTGAGGGAGCGAGCCAAGGTTCGAATTGACAAGGCAATGAAGGAGTTCGAGGAGGAGGAAAGGAAAAAGAGAATCGGTCCAGGCGGTTTGGATCCCGTGGAGGTGTATGAATCTCTCCCATCTGAGCTTCAGAAATGTTTTGATTCTAAAGATATTCAGATGTTACAGGACCCCATCAGCAAAATGGACCCAACTGAAGCAAGATTTTTTATGAAGCAGTGCATTGACTCAGGACTTTGGGTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTTTCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGGGAACATCATAAGGATTATATACATAGAAGCAGCCCCCAGTCGTAATTTTCAATTTTaaaaagaaaaaaaaaataaaaagaagaaaaaaaaaaagggataaaccataaaaaaaaaccaaaaataaaaaaaaaggaaaaaaaaaaaaaaaaaT
  5   1   1         - Tad5      in                         XZT67032.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGTTCTTCACCAAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTCAATGATGAACTGGAATCCTTCAAGGGCCGAGTGAGGGAGCGAGCCAAGGTTCGAATAGACAAGGCAATGAAGGAGTACGAGGAGGAGGAAAGGAAAAAGAGAATCGGTCCAGGCGGTTTGGATCCCGTGGAGGTGTATGAATCTCTCCCATCTGAGCTTCAGAAATGTTTTGATTCTAAAGATATTCAGATGTTACAGGACACCATCAGCAAAATGGACCCAACTGAAGCAAGATTTTTTATGAAGCAGTGCATTGACTCAGGACTTTGGGTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGGTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCC
  3   1   1         - Ova1 5g3  in                         CABE3434.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACCAAGATTAAGACTGCAGACCAGCAGTACATGGACGCGTTCAATGATGAACTGGAATCCTTCAAGGGCCGAGTGAGGGAGCGAGCCAAGGTTCGAATAGACAAGGCAATGAAGGAGTNCGAGGAGGAGGAAAGGAAAAAGAGAATCGGTCCAGGCGGTTTGGATCCCGTGGAGGTGTATGAATCTCTCCCATCTGAGCTTCAGAAATGTTTTGATTCTAAAGATATTCAGATGTTACAGGACACCATCAGCAAAATGGACCCAACTGAAGCAAGATTTTTTATGAAGCAGTGCATTGACTCAGGACTTTGGGTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCAAAAAAGAAAAC
  5   1   1         - Tad5      in                         XZT16738.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATAGACAAGGCAATGAAGGAGTACGAGGAGGAGGAAAGGAAAAAGAGAATCGGTCCAGGCGGTTTGGATCCCGTGGAGGTGTATGAATCTCTCCCATCTGAGCTTCAGAAATGTTTTGATTCTAAAGATATTCAGATGTTACAGGACACCATCAGCAAAATGGACCCAACTGAAGCAAGATTTTTTATGAAGCAGTGCATTGACTCAGGACTTTGGGTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAA
  5   1   1         - Tad5      in                         XZT64548.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGAGGAGGAGGAAAGGAAAAAGAGAATCGGTCCAGGCGGTTTGGATCCCGTGGAGGTGTATGAATCTCTCCCATCTGAGCTTCAGAAATGTTTTGATTCTAAAGATATTCAGATGTTACAGGACACCATCAGCAAAATGGACCCAACTGAAGCAAGATTTTTTATGAAGCAGTGCATTGACTCAGGACTTTGGGTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTG
  5   1   1         - Tad5      in                         XZT63186.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGAAAAAGAGAATCGGTCCAGGCGGTTTGGATCCCGTGGAGGTGTATGAATCTCTCCCATCTGAGCTTCAGAAATGTTTTGATTCTAAAGATATTCAGATGTTACAGGACACCATCAGCAAAATGGACCCAACTGAAGCAAGATTTTTTATGAAGCAGTGCATTGACTCAGGACTTTGGGTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCANAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTG
  5   1   1         - Gas                            TGas030k11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATCCCGTGGAGGTGTATGAATCTCTCCCATCTGAGCTTCAGAATGTTTTGATTCTAAAGATATTCAGATGTTACAGGACACCATCAGCAAAATGGACCCAACTGAAGCAAGATTTTTTATGAAGCAGTGCATTGACTCAGGACTTTGGGTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAAC
  5   1   1         - Tad5      in                         XZT13347.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TACTGATGACATCACTTGTCTACTTTACAGTTATCATAGTTATTCATAGTATTTTATTTTTGTTTTTAATCAACATATTTATTCACTTGCATTGCAGGAAGCAAGATTTTTTATGAAGCAGTGCATTGACTCAGGACTTTGGGTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATC
  3   1   1         - Liv1 5g3  in                         CAAR3786.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGCTTCAGAAATGTTTTGATTCTAAAGATATTCAGATGTTACAGGACACCATCAGCAAAATGGACCCAACTGAAGCAAGATTTTTTATGAAGCAGTGCATTGACTCAGGACTTTGGGTTCCGAATGCAAAGNGAGGAGATGGTACGGAGCNTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCCACATTGGCTGTA
  3   1   1         - Ski1 5g3  in                         CABJ9228.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGAAATGTTTTGATTCTAAAGATATTCAGATGTTACAGGACACCATCAGCAAAATGGACCCAACTGAAGCAAGATTTTTTATGAAGCAGTGCATTGACTCAGGACTTNGGGTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCCACAAAAAAA
  3   1   1         - Hrt1      in                         CAAQ8881.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATAGTATTTTATTTTTGTTTTAATCAACATATTTATTCACTTGCATGCAGGGAAGCAAGATTTTTATGAAGCAGTGCATTGACTCAGGACTTTGGGTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCCACAAAAAAA
  3   1   1         - Gas       in                    TGas064h04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAAGATATTCAGATGTTACAGGACACCATCAGCAAAATGGACCCAACTGAAGCAAGATTTTTTATGAAGCAGTGCATTGACTCAGGACTTTGGGTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCCACAAAAAAATAAAAAAAA
  3   1   1         - TpA       in                    TTpA024c12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAAGATATTCAGATGTTACAGGACACCATCAGCAAAATGGACCCAACTGAAGCAAGATTTTTTATGAAGCAGTGCATTGACTCAGGACTTTGGGTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCCAAAAAAAAAAAAAAAAAA
  3   1   1         - TpA  5g3  in                    TTpA027d03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGCAAAATGGACCCAACTGAAGCAAGATTTTTTATGAAGCAGTGCATTGACTCAGGACTTTGGGTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGGATAGCACTGAAATAAATATACATTGACTTTTCCACAAAAAAAAAAAAAAAAAAAAAA
  3   1   1         - Int1 5g3  in                        CAAP12886.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGCAAAATGACCCCACCTGAAGCAAGATTTTTTATGAAGCAGTGCATTGACTCAGGACTTTGGTTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCCAC
  3   1   1         - Hrt1 5g3  in                        CAAQ10372.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCAAAATGGACCCACTGAAAGCAAGATTTTTATGAAGCAGTGCATTGACTCAGGACTTTGGGTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCCAC
  3   1   1         - Hrt1      in                         CAAQ9831.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCAAAATGGACCCAACTGAAGCAAGATTTTTATGAAGCAGTGCATTGACTCAGGACTNTGGGTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCCAC
  3   1   1         - Liv1 5g3  in                        CAAR12744.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGCAAAATGGACCCAACTGAAGCAAGATTTTTATGAAGCAGTGCATTGACTCAGGACTTTGGGTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCCAC
  3  -1   1         - Ova1      in                        CABE10526.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCAAAATGGACCCAACTGAAGCAAGATTTTTTATGAAGCAGTGCATTGACTCAGGACTTTGGGTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACT
  3   1   1         - Liv1 5g3  in                         CAAR3134.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGCAAAATGACCCAACTGAAGCAAGATTTTTTATGAAGCAGTGCATTGACTCAGGACTTGGGTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCCAC
  5  -1   1         - Ova1      in                        CABE10526.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GACCCAACTGAAGCAAGATTTTTTATGAAGCAGTGCATTGACTCAGGACTTTGGGTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACT
  5   1   1         - Liv1      in                         CAAR4384.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CATTGCAGGAAGCAAGATTTTTTATGAAGCAGTGCATTGACTCAGGACTTTGGGTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGG
  3   1   1         - Liv1      in                         CAAR4384.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTGCAGGAAGCAAGATTTTTTATGAAGCAGTGCATTGACTCAGGACTTGGGTTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCCAC
  3   1   1         - Tad5 FL   in                         XZT59008.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAACTGAAGCAAGATTTTTTATGAAGCAGTGCATTGACTCAGGACTNTGGGTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCC
  5  -1   1         - Int1      in                        CAAP11503.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAAGCAAGATTTTTTTATGAAGCAGTGCATTGACTCAGGACTTTGGGTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAA
  5   1   1         - Kid1      out                       CABA10634.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAAGCAAGATTTTTTATGACGCAGTGCATTGACTCAGGACTTTGGGTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGNGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCCACATTGGCTTGTATGCTGCCGT
  3   1   1         - Gas7 5g3  in                         XZG51410.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGCAGTGCATTGACTCAGACTTTTGGGTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCCACAAAAAAAAAAAAAAAGG
  3   1   1         - Tad5      in                         XZT64548.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCAGTGCATTGACTCAGGACTTTGGGTTCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTT
  3   1   1         - Tad5 5g3  in                         XZT18864.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGACTCAGGACTTTGGGTCCGAATGCAAGGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCCACATTGAAAAAAAAAAAAAAAGG
  3   1   1         - Hrt1      in                         CAAQ1752.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGTTCCGAATGCAAAGNGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCCAA
  3   1   1         - Ovi1 5g3  in                          CABI741.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACCGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCC
  3   1   1         - Ova1 5g3  in                         CABE6448.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCGAATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCCAC
  3   1   1         - Brn4 5g3  in                        CAAL11065.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCCCC
  3   1   1         - Tad5      in                         XZT16738.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCAAAGGGAGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCCACATTGGCTTGT
  3   1   1         - Gas7 5g3  in                         XZG49030.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGAGATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGCCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTAAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCCACAAAAAAAAAAAAAAAGG
  3   1   1         - Gas7 5g3  in                         XZG43067.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATGGTACGGAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTAGGTGACCATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCCCAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTCCCATACAAAGGGAAACTAGTACTCCCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCCCC
  3   1   1         - Spl2 5g3  in                        CBSS2366.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCCAC
  3   1   1         - Thy1      in                        CBST5857.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCCTGAGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCC
  5   1   1         - BrSp      in                     EC2BBA32BG06.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGAGGGCTCCTGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAACTGTAAACCTTCCTCAGAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTTATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTG
  3   1   1         - Te3       in                         CAAM8763.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACGGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCC
  3   1   1         - Tad5      in                         XZT67032.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGACTCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTCCCATACAAAGGGAAACTAGTACTCCCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCCCC
  3   1   1         - BrSp 5g3  in                     EC2BBA27AC12.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCAGAACCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGCTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGA
  3   1   1         - HdA       in                    THdA002l02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCTGTATATGAAGAGGCCAAGAGTGAAGCTGCTGACTAGATGGAGATTTCATGTGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCGTTTTTTTTTCTTTTTAGGGGAACATCATGAGGATGATATACATAGAGGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGGTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGGGGGATTGGGGCATAATATTCCCTTTTATTGAAGCGTTATGATTGGCTTTCCCCAAGCGGTTAATTGTCTGTTACTCTGGGTTCTTTTACCATACAAAGGGAAACTAGTACTTCCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAAGGGCTTTTTATATTTTCTCCCTTTCTTTTCATCAGGAAAATTCAAATTTGTACCACAATTTCAGTTTTCCACTGATTCCTGCGGTTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGGGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTTTATTTAGTCCCTCTAAGTGTGTTGGGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATTTACATTGGCTTTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   1         - Gas  FL   in                    TGas127m02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAGAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGTTATTGGCCCATAAGAGGTCCGGCTAAAACAATTTATCTTTTTTTTTTCTTTTTAGGGGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGAGGGCTGATTCAGGAAAGAACACAATTTTTTTTCAATAACACATTGTGGCTTGTTAAATGTCAGGGGGATGGGGGCATAATATTCCCTTTTACTGAAGCATTATGATTGGCTTCCCCCAAGCGGTTAATTGTCTGTTACTCGGTGTTTTTTTCCCATACAAAGGGAAACTAGTACTCCCTTGAAATTAGGGGTTGCTAATTGTAACCCTTCCTCAAAACAAGGGCTTTTTATATTTTCTCCCTTTTTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTATTGAGAAACCTCCAGATCAGCCAAACGGGGAGAGAGGGTATTCCCCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTTTATTTAGTCCCTTTAGTTTGTTCTGCTTTTCCACGGGGGTTAAGATGTGATACCCCTGAAATAAATATCCATTGCCTTTTCCGCCaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   1         - Eye  5g3  in                         CCAX2063.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGTGAAGCTGCTGACTAGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCC
  3   1   1         - BrSp 5g3  in                     EC2BBA24BG03.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGATGGAGACTTCATGAGAGACCAGAAGTGGCCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCTGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTTATCTCTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAAGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTAAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATGAC
  3   1   1         - TpA  5g3  in                    TTpA046h03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCAATGGCATTATCAGAAGAGCTCCAGATAGAAATAGGTGGAATTAGCGGGATCCCCAACAGAGTTATTGGCCCATAAGAGGTCCTGCTAATACAATTAATCTTTTTTTTTTCTTTTTAGGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGAGGGCTGATTCAGGAAAGAACACAACTTCTTTTCAATAACACATTGTGGCTTGTTAAATTTCAGGGGGATTGGGGCATAATATTCCCTTTTACTGAAGCATTATGATTGGCTTACCCCAAGCTGTTAATTTTCTGTTACTCTGGGTTCTTTTCCCATACAAAGGGAAACTAGTACTCCCTTGAAATTAGGGGTTGCTAATTGTAAACCTTCCTCAAAACAAGGGCTTTTTATATTTTTTCCCTTTTTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGTTGCTATGAACTTAATGAGAAACCTCCAGATCACCCAAACGGGGAGAGAGGGTATTCACCTTTGCTGGAAACTGCAGTGATTTATTCAATATCTGTTTTTATTTAGTCCCTTTATTCTGTTCGGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCCCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   1         - Tad5      in                          XZT1045.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGATAGAAATAGGTGGAATTAGCGGGATCCCCAACAGAGCTACTGGCCCATAAGAGGTCCTGCTAATACTATTAATCTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTCCCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTC
  3   1   1         - Tad5      in                           XZT583.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCCAACAGAGCTACTGCCCCATAAGAGGTCCTGCTAATACTATTTATCTTTTGTTTTTCTTTTTATGTGAACTTCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGTTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCCGTTAATTGTCTGTTACTCTGTGTTCTTTTCCCATACAAAGGGAAACTAGTGCTACCTTGAAATTATGGGTTGCTAATGGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGGGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATA
  3   1   1         - Te4  5g3  in                         CAAN3160.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACTATTTATCTTTTTTTTTTTCTTTTNGGGGGACCTTCTTAGGGTTTTTTTCCATAGAAGCGGCCCCCGGGAATTGTGCAGGAATAGATCTTTCCGGGGAGGGGTGTTTCGGGAAAGAACCCAATTTTTTTTCAATAACCCATTGGGGCTTTTTAAATTTCAGGGGGATTGGGGCATAATTTTCCCTTTTACGGAACCTTTTTGTTTGGCTTCCCCCAAGCTGTTAATTGTCTGTTACTCGGGGTTTTTTTCCCCTCCAAAGGGAAACTGGTCCTCCCTGGAAATTAGGGGTTGCTAATTGTAACCCTTCCTCAAAACAAGGGCTTTTTATATTTTCCCCCTTTTTTTTCCCCATGTTAATTCAAATTTGTAACCCAATTTCAGTTTTCCCCTGAT
  3   1   1         - Gas7 5g3  in                         XZG33048.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTATCTTTTTTTTTTCTTTTTAGGTGACCTTCATAAGGTTTATATCCATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTTTTTTCAATAACCCATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTCCCCCAAGCTGTTAATTGTCGGTTACTCTGGGTTCTTTTCCCATCCAAAGGGAAACTAGTCCTCCCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAAGGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACCCAATTTCAGTTTTCCACTGATTCCGGCTGCTATGAACTTACTGAGAAACCTCCAGTTCAGCCAAACGGTGGGAGGGGGTATTCCCCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACGGGGGTTAAGATGTGATAGCCCTGAAATAAATATCCATTGACTTTTCCCCAAAAAAAAAAAAAAAAAAAAACAAAAAAAGGGAT
  3   1   1         - BrSp      in                     EC2BBA23AE02.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTAAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTAAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATACCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGA
  5   1   1         - BrSp      in                     EC2BBA23AE02.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTTTTTTTTTTCTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTAAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTAAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATACCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTC
  5  -1   1         - Ski1      in                         CABJ3095.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTTTTTTTTTTTTTTTATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCCACAAAAACGAATCGATG
  3  -1   1         - Ski1      in                         CABJ3095.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATGTGAACATCATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCCACAAAAA
  3   1   1         - Tad5      in                         XZT63186.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CATAAGGATTATATACATAGAAGCAGCCCCCGTGAATTGTGCATGAATAGATCATTCCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCCAC
  5   1   1         - Te1       in                         CBWN7378.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCCACAAAAAAAAAAAAAAA
  3   1   1         - Te1       in                         CBWN7378.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCAGGGATGGCTGATTCAGGAAAGAACACAACTTCTATTCAATAACACATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCCACAAAAAAAAAAAAAAA
  3  -1   1         - TpA                             TTpA034b07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTCAATGTGGAAAAGTCAATGGTANNTATTTATTTCAGGTGCTATCACATCTTAACCCCAGTGCAGAAGCAGAACAGACTAAAGGGACTAAATAGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTTGTCCCTTTAGTCTGTTCCGCTTTGGCACTGGGGCCAAGATGTGTTCGCACTGAAATAAATATACATTGACTTTACCACATTGC
  3   1   1         - Neu0      in                     NISC_ng10b02.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTGTGGCTTGTTAAATGTCAGTGGGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCCACAAAAAAAAAAAAAAAAAAAG
  3   1   1         - HdA  5g3  in                    THdA021n24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGATTGGGGCATAATATTGCCTTTTACTGAAGCATTATGATTGGCTTACCACAAGCTGTTAATTGTCTGTTACTCTGTGTTCTTTTACCATACAAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATGACTTTCAAAAAAAAAAAAAAAAAAAAGCG
  3   1   1         - Tad0      in                     NISC_no20e02.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTCTTTTCCCATACAAAGGGAAACTAGTACTCCCTTGAAATTATGGGTTGCTAATTGTAACCCTTCCTCAAACCAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTAAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAACCCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCCCCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATCCATTGACTTTTCCCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   1         - Tad5      in                         XZT13347.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAGGGAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTT
  5   1   1         - Spl2      in                        CBSS6634.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTAAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCCAC
  3   1   1         - Spl2      in                        CBSS6634.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAACTAGTACTACCTTGAAATTATGGGTTGCTAATTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTAAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGATGTGATAGCACTGAAATAAATATACATTGACTTTTCCAC
  3   1   1         - BrSp      in                     EC2BBA32BG06.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTATGGGTTGCTAACTGTAAACCTTCCTCAAAACAATGGCTTTTTATATTTTCTCCCTTTCTTTTCATCATGTTAATTCAAATTTGTAACACAATTTCAGTTTTCCACTGATTCCTGCTGCTATGAACTTACTGAGAAACCTCCAGATCAGCCAAACGGTGAGAGAGCGTATTCACCTTTGCTGGAAACTGCAGTGATCTATTCAATATCTGTTTCTATTTAGTCCCTTTAGTCTGTTCTGCTTCTGCACTGGGGTTAAGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)