Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 77%

 1012071676 Xt7.1-CAAQ10789.5.5 - 111 ESTs
                                                                       .........-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xt7.1-CAAQ10789.5.5                                                                                                                                                                                                                                                                                                                                                                                                      GAACAGAGTCGGGGACTCAAACTCCGCTGGGGCACAGGGATTGTTAGTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCGGGTTCCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAGCCGACAAACTTTATCCCATTATTCTGTTACCCCAAGGGGGGGCACTAAGCTGTTTAGGGGGGCAAGTAGGGTGCCCCCCAGTACTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAAGATAATAATATGCTAGTATAGTGTGTATAGGCAGGACCAATGGCAGTGGAGGGGGGTGGGGAGAAATGATAATTAAAGGGTATACAAACCATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGTGTGTTTCCCCTTAGGGAACTGTTTTGTGTTATTTATTTTTTGTACCATTGTACCAAATAAATACTCGCTAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGTGTGTTTCCCCTTAGGGAACTGTTTTGTGTTATTTTTTGTACCATTGTACCAAATAAATACTCGCTTTAACT
                                                  Xt7.1-CHK-1008222962                                                                                                                                                                                                                                                                                                                                                                                                            AGTCGGGGACTCAAACTCCGCTGGGGCACAGGGATTGTTAGTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCGGGTTCCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAGCCGACAAACTTTATCCCATTATTCTGTTACxCxxAGGGGGGGCACTAAGCTGTTTAGGGGGGCAAGTAGGGTGCCCCCCAGTACTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAAGATAATAATATGCTAGTATAGTGTGTATAGGCAGGACCAATGGCAGTGGAGGGGGGTGGGGAGAAATGATAATTAAAGGGTATACAAACCATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGTGTGTTTCCCCTTAGGxAxxxxxxTxxTxTxxxTTATTTTTTGTACCATTGTACCAAATAAATACTCGCTxxxAxxTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGTGTGTTTCCCCTTAGGGAACTGTTTTGTGTTATTTTTTGTACCATTGTACCAAATAAATACTCGCT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                           5    14    10    21    16    31    20    33    31    41    41    47    47    53    49    53    51    54    52    54    53    54    53    54    53    54    54    54    54    55    54    55    55    55    56    56    56    56    56    57    58    58    58    58    59    59    60    60    60    60    60    60    60    60    60    60    59    60    58    60    58    61    57    61    56    62    59    64    57    61    58    62    60    65    61    66    61    65    57    65    59    64    61    64    61    64    60    64    59    64    59    64    57    64    56    64    55    63    57    62    56    63    50    61    47    59    46    60    44    60    43    61    44    63    39    59    40    59    38    59    39    58    35    58    34    58    34    56    35    57    35    55    33    54    31    54    30    53    29    52    20    43    20    44    21    45    26    51    30    54    30    51    29    49    28    47    28    45    29    44    27    43    27    42    25    38    23    38    20    37    21    34    20    34    20    33    22    36    21    39    24    39    24    39    24    39    24    38    15    39    15    38    14    34    14    34    13    30    12    30    11    29    11    29    11    29    11    29    11    29    11    29    11    28    11    27    11    27    11    26    11    26    11    26    11    26    11    26    12    26    13    27    13    27    13    27    13    27    14    27    14    27    14    27    14    27    14    27    12    27    12    27    12    27    12    26    12    26    12    26    10    22     9    21     9    20     9    20     3     8     3     7     3     5     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3
  5   1   2  SIG                                     Xt7.1-CAAL22664.5                                                                                                                                                                                                                                                                                                                                                                   GAAAAGAAAAATAAAGATAATTCATCAATTTTAAAAAACAGAGTCGGGGACTCAAACTCCGCTGGGGCACAGGGATTGTTAGTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCAGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCGGCGCCTGCAGCTGCGCTACTGCGACTCTGACACATCGCTCGAGAAGACTCCACATCGTCTTCTCTGCCTCGACTGCTGAGGCTCATGCAAATAGACCGCCTCGTAGCAGGTACGACTGTATTCAGGGAACATTCTGAAGGGTTCTGGTGGTCAGTTCAACCGGTCAGTTCCAACAGTCGTCGAGATCAAGTAATTATGGACTACGTAGCACGTCAAGGTTGGAAATGTTGACTGTTTTGTCTCTTCGCCCAA------------GTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAAGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTTTATCGAATGTTGTTTGGGAAACTAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAGCCGACAAGCTTTATCCCATTATTCTGTTACTCACCCCAAGGGGGGGCACTAAGCTGTTTAGGGGGGCAAGTAGGGGGCCCCCCAGTACTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAAGATAATAATATGCTAGTATAGTGTGTATAGGCAGGACCAATGGCAGTGGAGGGGGGTGGGGAGAAATGATAATTAAAGGGTATACAAACCATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGTGTGTTTCCCCTTAGGGAACTGTTTTGTGTTATTTTTTGTACCATTGTACCAAATAAATACTCGCTTTAACTGGAAAAAAAAAAA
  5   1   2  SIG                                     Xt7.1-CAAQ10789.5                                                                                                                                                                                                                                                                                                                                                                                                          AGAGTCGGGGACTCAAACTCCGCTGGGGCACAGGGATTGTTAGTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCGGGTTCCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAGCCGACAAACTTTATCCCATTATTCTGTTACTCACCCCAAGGGGGGGCACTAAGCTGTTTAGGGGGGCAAGTAGGGTGCCCCCCAGTACTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAAGATAATAATATGCTAGTATAGTGTGTATAGGCAGGACCAATGGCAGTGGAGGGGGGTGGGGAGAAATGATAATTAAAGGGTATACAAACCATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGTGTGTTTCCCCTTAGGGAACTGTTTTGTGTTATTTTTTGTACCATTGTACCAAATAAATACTCGCTTTAACTGT
  5   1   2                                      Xt7.1-IMAGE:8950112.5                                                                                                                                                                                                                                                                                                                                                                                                                     CCTCTTCCGATACTAGTATGAGCCGATTCTTTTCGTCCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGGTAACGTCCCTGTGTCACTGTGCCCCAAGCCCCACCCACCTCACCAGGGCGGCCTATAGCGTCCATGCAAAGTATACGGGGGGCAGAGTGCCCTAAAAAATATAAGCAACGTGTAATTTGTTTAACCCTTTAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACT------------------------TAATAGGGAGGTGAAAATATTATTAATTCGTCCCGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCGGGTTCCAGGTCTCCCAAACCATGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGGAATTGTTTGTAAATCAATGAATATAATAAATGTAACATTGATCGTGTCTGGCAGCCGACCAACTTTATCCCATTATTCTGTTAACTCACCCCTAGGGGGGGCACTAATCTGTTTAGGGGGGTCAAGTAAGGATGGCCCCCAGTAACTATTG
  5   1   2                                           Xt7.1-st109d24.3                                                                                                                                                                                                                                                                                                                                                                                                                        AACTCCGCTGGGGCACAGGGCATTGTTAGTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGGTAACGTCCCTGTGTCACTGTGCCCCAAGCCCCACCCACCTCACCAGGGCGGCCTATAGCGTCCATGCAAAGTATACGGGGGGCAGAGTGCCCTAAAAAATATAAGCAACGTGTAATTTGTTTAACCCTTTAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGGGGGGTAAGGACTGTAATTCAGAGGGATCACTTCCTGGTGGGGGTTCCGGGTTGGGTTCCAGGTTTCCCAAACGGGGTTCCGGGTTTCCCAAACCAGGTTCGGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTTTGGAGGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTTTTTGGAATGTTGTTTGGGGAATTGTTTGTAAATCAAGGAATATAATAAATGTACCCCTGATG
  5   1   2  SIG                                     Xt7.1-CAAL20450.5                                                                                                                                                                                                                                                                                                                                                                                                                             CCGCTGGGGCACAGGGATTGTTAGTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGTGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCGGGTTCCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAGCCGACAAACTTTATCCCATTATTCTGTTACTCACCCCAAGGGGGGGCACTAAGCTGTTTAGGGGGGCAAGTAGGGGGCCCCCCAGTACTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAAGATAATAATATGCTAGTATAGTGTGTATAGGCAGGACCAATGGCAGTGGAGGGGGGTGGGGAGAAATGATAATTAAAGGGTATACAAACCATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGTGTGTTTCCCCTTAGGGAACTGTTTTGTGTTATTTTTTGTACCATTGTACCAAATAAATACTCGCTTTAACTGTGAAAAAAAAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTAGTGTGGATGGCGTTGTCTACT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGACTCTGACA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCTTAACCCGTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGATCCCTTAACCCGTTAAAAAGC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGTTGTTTGGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATCGAATGTTGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTAAATCAATG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAGCCGACAAACTTTATCCCATTATTCTGTTACTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACTCACCCCAAGGGGGGGCACTAAGCTGTTTAGGGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCAAGTAGGGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCCCCCAGTACTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAAGATAATAATATGCTAGTATAGTGTGTATAGGCAGGACCAATGGCAGTGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGAAATGATAATTAAAGGGTATACAAACCATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGTGTGTTTCCCCTTAGGGAACTGTTTTGTGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTTGTACCATTGTACCAAATAAATACTCGCTTTAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                      --CC--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ------T-----
                                               BLH ATG      67      86                                                                                                                                                                                                                                                                                                                                                                                                      
                                               BLH MIN      43     125                                                                                                                                                                                                                                                                                                                                                                                                      
                                               BLH OVR      67      36                                                                                                                                                                                                                                                                                                                                                                                                      
                                               EST CLI       4      28                                                                                                                                                                                                                                                                                                                                                                                                      
                                               ORF LNG      67       3                                                                                                                                                                                                                                                                                                                                                                                                      
                                                                       PROTEIN --- Dm ---- 4e-100     NP_729018.1 CG32245-PB [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                           PROTEIN --- Ce ---- 1e-103     NP_741797.1 MEChanosensory abnormality MEC-2, stomatin-like protein required for mechanosensation (51.9 kD) (mec-2) [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Xt ==== 1e-108     AAH64171.1 Hypothetical protein MGC75647 [Xenopus tropicalis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Sp ---- 3e-109     XP_788002.2 PREDICTED: similar to band 7.2b stomatin [Strongylocentrotus purpuratus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Dr ==== 1e-126     NP_571833.1 stomatin [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Mm ---- 5e-127     NP_038543.1 erythrocyte protein band 7.2; protein 7.2b [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Hs ---- 8e-128     NP_004090.4 stomatin isoform a; erythrocyte membrane protein band 7.2 (stomatin) [Homosapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED = Gg ==== 5e-129     XP_415401.2 PREDICTED: similar to band 7.2b stomatin [Gallus gallus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED = Xl ==== 2e-143     AAH54307.1 Unknown (protein for MGC:64577) [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === ?? ==== 2e-143     NP_001080862.1 stomatin [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                   Xt7.1-CAAQ10789.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG------TAG------------TAG---------TAA------TAA---------------------TAG------------------------------------------------------------------------TGA------------------------TGA---------------------------------------------------------TAA---------------TGA---TAATAAATGTAA---TGA---------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------ATG------TAG------TAG---------ATG------------------------TGATAA------------------------------TAG------TGAATG------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
  5   1   2  SIG                                     Xt7.1-CAAL22664.5                                                                                                                                                                                                                                                                                                                                                                   GAAAAGAAAAATAAAGATAATTCATCAATTTTAAAAAACAGAGTCGGGGACTCAAACTCCGCTGGGGCACAGGGATTGTTAGTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCAGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCGGCGCCTGCAGCTGCGCTACTGCGACTCTGACACATCGCTCGAGAAGACTCCACATCGTCTTCTCTGCCTCGACTGCTGAGGCTCATGCAAATAGACCGCCTCGTAGCAGGTACGACTGTATTCAGGGAACATTCTGAAGGGTTCTGGTGGTCAGTTCAACCGGTCAGTTCCAACAGTCGTCGAGATCAAGTAATTATGGACTACGTAGCACGTCAAGGTTGGAAATGTTGACTGTTTTGTCTCTTCGCCCAA------------GTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAAGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTTTATCGAATGTTGTTTGGGAAACTAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAGCCGACAAGCTTTATCCCATTATTCTGTTACTCACCCCAAGGGGGGGCACTAAGCTGTTTAGGGGGGCAAGTAGGGGGCCCCCCAGTACTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAAGATAATAATATGCTAGTATAGTGTGTATAGGCAGGACCAATGGCAGTGGAGGGGGGTGGGGAGAAATGATAATTAAAGGGTATACAAACCATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGTGTGTTTCCCCTTAGGGAACTGTTTTGTGTTATTTTTTGTACCATTGTACCAAATAAATACTCGCTTTAACTGGAAAAAAAAAAA
                                                  Xt7.1-CHK-1008277936                                                                                                                                                                                                                                                                                                                                                                         AAAAATAAAGATAATTCATCAATTxTxAxxAACAGAGTCGGGGACTCAAACTCCGCTGGGGCACAGGGATTGTTAGTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCxxGGGxGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCGGCGCCTGCAGCTGCGCTACTGCGACTCTGACACATCGCTCGAGAAGACTCCACATCGTCTTCTCTGCCTCGACTGCTGAGGCTCATGCAAATAGACCGCCTCGTAGCAGGTACGACTGTATTCAGGGAACATTCTGAAGGGTTCTGGTGGTCAGTTCAACCGGTCAGTTCCAACAGTCGTCGAGATCAAGTAATTATGGACTACGTAGCACGTCAAGGTTGGAAATGTTGACTGTTTTGTCTCTTC------------------------CCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAAGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTTTATCGAATGTTGTTTGGGAAACTAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAGCCGACAAGCTTTATCCCATTATTCTGTTACTCACCCCAAGGGGGGGCACTAAGCTGTTTAGGGGGGCAAGTAGGGGGCCCCCCAGTACTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAAGATAATAATATGCTAGTATAGTGTGTATAGGCAGGACCAATGGCAGTGGAGGGGGGTGGGGAGAAATGATAATTAAAGGGTATACAAACCATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGTGTGTTTCCCCTTAGGGAACTGTTTTGTGTTATTTTTTGTACCATTGTACCAAATAAATACTCGCTTTAACTGGAAAAAAAAAAAAAAAAA
  5   1   2       ext In60                            IMAGE:8948147.5p                                                                                                                                                                                                                                                                                                                                                                   GAAAAGAAAAATAAAGATAATTCATCAATTTTAAAAAAATCGTCCCGGGACTCAAACTCCGCTGGGGCACAGGGATTGTTAGTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCTTCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAAGACTCGGTCACCGTTAGAGT
  5   1   4   14 seed Brn4 5g3  in                        CAAL22664.5p ..........................................................................................................................................................................................................................................................................................................................................................................................GTGATTGTTATGAACAGAGTCGGGGACTCAAACTCCGCTGGGGCACAGGGATTGTTAGTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCGGCCGCCCTGCA
  5   1   3   10   nb Spl2 5g3  in                        CBSS3751.fwd ...........................................................................................................................................................................................................................................................................................................................................................................................TGATTGTTATGAACAGAGTCGGGGACTCAAACTCCGCTGGGGCACAGGGATTGTTAGTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCT
  5   1   2       add In54                            IMAGE:8946018.5p                                                                                                                                                                                                                                                                                                                                                                                                                  TACCATTTGATACAATAATATCGATAAAAAAAAATCGTCCCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGATCTCCCCTGCCCCGACAGCTTCATCATGTGGATATGAAAACCATTTCATTTCAAATCCCACCACAAGAATTCTGAAAAAAGAGCGGTCACCGTTAGTGTGGATGGCGTTGTCTATAACAGGTCATAACGCTACCCTGGTGATGGCCAATATAATTATTTCATAATTATCACCTG
  5   1   2       add In60                            IMAGE:8949706.5p                                                                                                                                                                                                                                                                                                                                                                                                                   TTGGTTTATATTATGTAGGGATTGAGCCTACATTATTCGTCCCGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCATTAACGCTTCCCTGGCAGTGGC
  5   1   2       ext TbA       in                   TTbA038g23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACTACTGGGGTATC
  5   1   2       ext In62                            IMAGE:8954462.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCTCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCGGCGCCTGCAGCTGCGCTACTGCGACTCTGACACATCGCTCGAGAAGACTCCACATCGTCTTCTCTGCCTCGACTGCTGAGGCTCATGCAAATAGACCGCCTCGTAGCAGGTACGACTGTATTCAGGGAACATTCTGAAGGGTTCTGGTGGTCAGTTCAACCGGTCAGTTCCAACAGTCGTCGAGATCAAGTAATTATGGACTACGTAGCACGTCAAGGTTGGAAATGTTGACTGTTTTGTCTCTTCGCCCAA
  3   1   4      seed Brn4 5g3  in                        CAAL22664.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATCGTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAAGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTTTATCGAATGTTGTTTGGGAAACTAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAGCCGACAAGCTTTATCCCATTATTCTGTTACTCACCCCAAGGGGGGGCACTAAGCTGTTTAGGGGGGCAAGTAGGGGGCCCCCCAGTACTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAAGATAATAATATGCTAGTATAGTGTGTATAGGCAGGACCAATGGCAGTGGAGGGGGGTGGGGAGAAATGATAATTAAAGGGTATACAAACCATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGTGTGTTTCCCCTTAGGGAACTGTTTTGTGTTATTTTTTGTACCATTGTACCAAATAAATACTCGCTTTAACTGTG
  3   1   3        nb Spl2 5g3  in                        CBSS3751.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCCTCTGCCCCTCGACCTGNTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAGCCGACAAACTTTATCCCATTATTCTGTTACTCACCCCAAGGGGGGGCACTAAGCTGTTTAGGGGGGCAAGTAGGGGGCCCCCCAGTACTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAAGATAATAATATGCTAGTATAGTGTGTATAGGCAGGACCAATGGCAGTGGAGGGGGGTGGGGAGAAATGATAATTAAAGGGTATACAAACCATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGTGTGTTTCCCCTTAGGGAACTGTTTTGTGTTATTTTTTGTACCATTGTACCAAATAAATACTCGCTTTAACTGG
  3   1   2       ext TbA       in                    TTbA038g23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAAGGGTTCCTGGTTGGGTTGCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTTTATCGAATGTTGTTTGGGAAACTAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTTTGGCAGCCGACAAGCTTTATCCCATTATTTTGTTACTCACCCCAAGGGGGGGCACTAAGCTGTTTAGGGGGGCAAGTAGGGGGCCCCCCAGTACTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAAGATAATAATATGGTAGTATAGTGTGTATAGGCAGGACCAATGGCAGTGGAGGGGGGTGGGGAGAAATGATAATTAAAGGGTATACAAACCATATTCATATCATAGCAAGGGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTGGATGTTGCACTCAGTGGGCACCGTGTGTTTCCCCTTAGGGAACGGTTTTGTGTTATTTTTTGTACCATTGTACCAAATAAATACTCGCTTTAACTGGAAAAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                     Xt7.1-CAAQ10789.5                                                                                                                                                                                                                                                                                                                                                                                                          AGAGTCGGGGACTCAAACTCCGCTGGGGCACAGGGATTGTTAGTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCGGGTTCCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAGCCGACAAACTTTATCCCATTATTCTGTTACTCACCCCAAGGGGGGGCACTAAGCTGTTTAGGGGGGCAAGTAGGGTGCCCCCCAGTACTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAAGATAATAATATGCTAGTATAGTGTGTATAGGCAGGACCAATGGCAGTGGAGGGGGGTGGGGAGAAATGATAATTAAAGGGTATACAAACCATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGTGTGTTTCCCCTTAGGGAACTGTTTTGTGTTATTTTTTGTACCATTGTACCAAATAAATACTCGCTTTAACTGT
                                                  Xt7.1-CHK-1008277938                                                                                                                                                                                                                                                                                                                                                                                                                GGGGACTCAAACTCCGCTGGGGCACAGGGATTGTTAGTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCGGGTTCCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAGCCGACAAACTTTATCCCATTATTCTGTTACTCACCCCAAGGGGGGGCACTAAGCTGTTTAGGGGGGCAAGTAGGGTGCCCCCCAGTACTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAAGATAATAATATGCTAGTATAGTGTGTATAGGCAGGACCAATGGCAGTGGAGGGGGGTGGGGAGAAATGATAATTAAAGGGTATACAAACCATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGTGTGTTTCCCCTTAGGGAACTGTTTTGTGTTATTTTTTGTACCATTGTACCAAATAAATACTCGCTTT
  5   1   2       ext In60 5g                         IMAGE:8950473.5p                                                                                                                                                                                                                                                                                                                                              TTTTTATTTTTAACGTTATCTGATACTTATTCTTAATTCGTCCCGGTGATTGTTATGAACAGAGTCGGGGACTCAAACTCCGCTGGGGCACAGGGATTGTTAGTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAAGGCCCGCGCCAAGGTCATAGCAGCCGAGGTGGAGATGAACGCCTCCCGGGCCCTGAAGAGCTTCCATAATGATCTCGGAGTCCCGGCGGCCTGCAGCTGCGCTACCTGCAGAACTCTGAACACCATCGCTCGAGAAGGACTCAACAATCGTCCTCTCTTGCCCTCGACTGCTGAGGGCTTCATGCAGAAATAGATCCTCTCTCT
  5   1   2       add In66 5x3                        IMAGE:8964364.5p                                                                                                                                                                                                                                                                                                                                                      GTTAATTTTAAAACATGAAATTTTAATATATAAAATTCCGGATGTTATGAACAGAGTCGGGGACTCAAACTCCGCTGGGGCACAGGGATTGTTAGTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGATCGCCTCCCGGGTCCTGAAAGAGCTTCCATAGTGATCCTCGGAGTCCCGGTCGCCCTGCAGCTGGCGCTTACTGCAGACTCTTGACACATTCGGCTTCCGAGAAGACTCCACCATCGCTTCGTCTGCCCTCGAACCTGCTGAGGACTCATGTGCAGAAATAGAACCGCGGCCT
  5   1   2       add In54 5g                         IMAGE:8944146.5p                                                                                                                                                                                                                                                                                                                                                                             ACAAAGACGGACCCCAGGGACCCACCCCTAAAAAAAAACATTCGCTTTCCGCTGGGGCACAGGGATTGTTAGTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGGTATCAAGGTGGAGCGGGTGGAGATTAATGACGTGAAGCTTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCATGGTCATAGCAGCCGAGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGAAGTCCCGGCCGCCTGCACTGCGCTACCTGCAGACTCTGACACATCGCTCGAAAGACTTCCACAATCCGTCTCCCTCTGCCCCTCAACCTGCTGAAAGGCTTCTGGCCAAAAAT
  5   1   2       add In54 5g                         IMAGE:8946728.5p                                                                                                                                                                                                                                                                                                                                                                             ACCCACTGACACAATATGATCCCGTCAATACGAATTCGTCCCCAAACTCCGCTGGGGCACAGGGATTGTTAGTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGATAACCTTTTCATTCTACATCCCCCCCCAATAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGTAT
  5   1   2       add In54 5g                         IMAGE:8946777.5p                                                                                                                                                                                                                                                                                                                                                                             AGCGGCGGATACACAGTAGCAACTAATTAAAATTCGTCCCCTCAAACTCCGCTGGGGCACAGGGATTGTTAGTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCTTTCGACATCCCCCCCCAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGT
  5   1   2       add In62 5g                         IMAGE:8954024.5p                                                                                                                                                                                                                                                                                                                                                                                GTTTTTTTTTTTTGCTTTTTTTTAAAATTAAAATTCCCTCTTTTCCGCTGGGGCACAGGGATTGTTAGTTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGGTCATAGCAGCCGAGGGTGAGATGACGCCTCTCGGGCCCTGAAAGAGGCTTCCGTAGTGATCTCGGAGTCCCGGTCGGCCTGCAGCTGCGCTACTGCGACTCTGAACTACAATCGGCTCGAAAAGAGTCACATCGATCTCCCTCTGCCCTCGAACTGCTGATGCATCATGCGAATAGACCGACCTCGGATAGGCCGCATGGCGGTACGC
  5   1   2   12  add Tad5 5g3  in                         XZT58983.5p ...................................................................................................................................................................................................................................................................................................................................................................................GGGACTGGTGATTGTTATGAACAGAGTCGGGGACTCAAACTCCGCTGGGGCACAGGGATTGTTAGTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCTCTACCTGCAGACTCTGACCACCATCGCCT
  5   1   2       add In66 5g                         IMAGE:8966550.5p                                                                                                                                                                                                                                                                                                                                                                                        ATTTTTTTTTTTGTTTGTTTTAAATATTAATATTATCTCCGCTGGGGACAGGGATTGTTAGTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACTAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCATACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATTCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACTGACGACTGGGGGTATCAAGGTGGAGCGGGTGGTAATTAATGACGTGAAGCTGCCCGTCCAGTTGCAAGAGCGATGGCGTCAAAGCCGAGGCTGCCAGGGAGGCCCGCGCAAGGTCATACAGCCGATGGTGAATGAACGCCTCCCGGGCCCTGAAAAGCTTCCATATTGATCTCGGAGTCTCCGGCCGCTTGTAGTTGCGCTACCTGTAAATCTGATCTCATCGCTTCGAGAAGACTCCCATACGATCTCCTTCTGCCCTTCGACTGTTGAAGGCTTCTTGACGATAATCTGCCCTCGTAAGCCTAGGGTAAGACGTATTCAAATGTTCCTCTTGTAGGTTCTGTTG
  5   1   2   12  add Thy1 5g3  in                        CBST9893.fwd ............................................................................................................................................................................................................................................................................................................................................................................................GGTGATTGTTATGAACAGAGTCGGGGACTCAAACTCCGCTGGGGCACAGGGATTGTTAGTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGA
  5   1   2       add In60 5g                         IMAGE:8952226.5p                                                                                                                                                                                                                                                                                                                                                                                                 AATACCTATATACCAAATTTTACACTAAAAAATTACGTCCCGGGATTGTTAGTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGTAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACTGCAGACTCTGACACATCGCTCGGAGACTCAACATCGTCTTTCCTCTGCCCCTCGACTGCTGAAGGGCTTCAGTGCGATTGAC
  5   1   2       ext Gas8 5g3  in                          st43o04.5p                                                                                                                                                                                                                                                                                                                                                                                                          AGAGTCGGGGACTCAAACTCCGCTGGGGCACAGGGATTGTTAGTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCA
  5   1   2       add In54 5g                         IMAGE:8944142.5p                                                                                                                                                                                                                                                                                                                                                                                                            ACCTTTCCCCTAAGGAGGACCCTCTTAAAAAAAAAGTCCCGTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGTAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCGGCCGCCCTGCAGCTGCGCTACTGCAGACTCTGACACATCGCCTCGAAAGACTTCACATCGTCTCCTCTGCCCTCGACTGCTGAGCTTCATGCAAAATAGACCGCCTCGTAGGCGGAGGGGTAACGACGTTAATTC
  5   1   2       add In54 5x3                        IMAGE:8945726.5p                                                                                                                                                                                                                                                                                                                                                                                                              GGTTTATAAAAATTGAGGGGAGGGTGGCAGCTTCAAATTCGTCCCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGACGCCTTCCCGGGCCCTGAAAAGAGCTTCTATAATTGATCTCGGAGTCCCCGGCCGCTCTGCAGCTGCGCTACCTGCAGATCTCTGACCACATCGCCTTCGAAAAAACCTCCACAATCGTCTCCCTCTGCCCTTGACTTGCTGGAACGCTTCATGCAGAATAGAACCCCGTCCTCTCGTATGGGTCGAAGGGTAACGAACATGTAATTCAAAGTGGAATCCTTTTACCTGAGTGAGGGTGTTACTAGATGT
  5   1   2       add In60 5g                         IMAGE:8948979.5p                                                                                                                                                                                                                                                                                                                                                                                                               ATTTTATATTAAAAAAGATTAAATAACAATTCTTTATTCGTCCCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGATCCTGTCCCAGATCCTCTCTGATAGATAAGAGATTGCCCCATAACATGCATTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAGGACGTGAAGCTGCCCGTCCATTGCAGAGAGCGATTGGCGGCATAATCCTATGCTGCCATGGAAGTCCGCTCCAAGGTCATAGCACCGAGGGGAGATGAACGCCTTCCGGGCCTGAAAGATGCTTCCATATTGATTCTGGATTCCCCAGCCTCCCTGCGTTTGCGTTACTG
  5   1   2       add In60 5g                         IMAGE:8951665.5p                                                                                                                                                                                                                                                                                                                                                                                                               CAAGGTTTATTAAACCTTTTTTTATAATAAAATACGTCTTGGATCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAAAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAAAGAAAAGATTGCCCATAACATGCAGTTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAAGGGAGGCCCGCGCCATGGTCATAGCAGCCGAGGGGAGATGAACGCCTCCTGGTCCCTGAAAGAGGCTTTCCATAGTGATCTCGGAGTCCCCGGGCGCCCTGCAGCTTGCGCTACCTGCAGACTCCTGGACCACCAT
  5   1   2       add In54 5g                         IMAGE:8945766.5p                                                                                                                                                                                                                                                                                                                                                                                                                   ACAAACGTCACTGTAACCGGATCCCCCACGATTCGAATTCGTCCCGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAATGTCATAGCAGCCGAGGGGAGATGACGCCTCCCGGGCCCTGAAAGAGCTTCCATAGTGATCTCGGAGTCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACACATCGCCTCGGAGAAGACTCCACCATCGTCCTCCCTCTGCCCCCTCGACCTGCTGAAGGGCTTCATG
  5   1   2       ext Gas8 5g3  in                          st71b03.5p                                                                                                                                                                                                                                                                                                                                                                                                                    GCAGGGCTCCGCTGGGGCACAGGGATTGTTAGTGGATCCAAGTTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCANAGAGCGATGGCGGCAGAAGCC
  5   1   2       add In54 5g                         IMAGE:8944044.5p                                                                                                                                                                                                                                                                                                                                                                                                                     AAAAACTACCGCTGGGGCACAGGGATTGTTAGTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGAGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGTGGAGCGGTGGAGATTAAGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGCAGAAGCCGAGCTGCAGGAGCCCGCGCAGTCATAGCAGCCGAGGGGAGATGACGCTCCGGCCTGAAGAGCTTCATATGATCTCGGAGTCCCGCCGCCTGCACTGGCTACTGCAATCTGACCCATCGCTCGAAAGAATCCACCATCGCTTCCTTGCTGACTGCTAGCTCTGCATGACGGCCTGTTAGCAGTAACAACTTTATCAGTTATCTTTCTCGTAGTCG
  5   1   2       add In60 5g                         IMAGE:8949099.5p                                                                                                                                                                                                                                                                                                                                                                                                                         TTTTTTTATTTACTTTAGTAAAAATATAAAAATTCGTCCGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAAACTCATCCACCCGGCTCCTGGCCCAGACCACCCTGAGATACGTCCTGGGGGACCAAGAACCTGT
  5   1   3   20   nb Hrt1 5g                             CAAQ10789.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................CTCCGCTGGGGCACAGGGATTGTTAGTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCG
  5   1   2       ext Gas1 5g3  in                     NISC_mq18h01.y1                                                                                                                                                                                                                                                                                                                                                                                                                              CGCTGGGGCACAGGGATTGTTAGTGGATCCAAGTGACATGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGG
  5   1   2       add Limb      in                        CBSU1584.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGGCACAGGGATTGTTAGTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATTACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGANAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCAC
  5   1   2       add In60                            IMAGE:8951213.5p                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTTTTAATTTTAATTCTCTTTTTTTTTAAAAAAAAAATCTCCTACCCGAGCTTAAGTCCAGGAGGGCCAATCTTGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTTCATAGCAGCCGAGGGTGAGATGAACGCCTCCCGGGCCCTGAAGAGGCTTCCATAGTGATCTCGGAGTCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCTCCGAGAAGAACTTCACATCGTCTTCCTCTGCTCTCGACTGCTGAAAGGCTTTCATGTCGAATTAGACCCGGCCCTCGTTAGGCCGCAGAGGGGTATGTGACTGGTTAATTT
  5   1   2       add In66                            IMAGE:8964551.5p                                                                                                                                                                                                                                                                                                                                                                                                                                              AGTTTTTTATCACTCCAAAAAATATTTAAAAAAAAGCCCGTGCTTTAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCTCGAGAAGACTCCACCATCGTCTTCCCTCTGCCCCTCGACTGCTGATGCTTTCATGCAGAAATAGACCCGCTCTCCGTTAGAGAGGGTACGAACTGTAATTCCAATCGAATCACTACTGTAGGTTCTGGGTGTGGTTTCCAGGACTCTCCCAAAACG
  5   1   2       add In54 5g                         IMAGE:8946233.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAAGTGGAGCGGGTGGAGATTAAGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGCCCGCGCCAAGGTCATAGCACCGAGGGGGAGATGACGCCTCCCGGGCCTGAGAGCTTCCATATGATCTCGGAGTCCCCGCGCCTGCACCTGCGCTACTGCAGACTCTGAACTACATCCCTCGAAAGAATCACAATCGTCTTCCTCTGCCTGACTGCTGAGGGCTTCATGCGAAATAAACGGC
  5   1   2   10  add Tbd1 5g3  in                        CBXT12777.b1 ...................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACACTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACGCTGGCAGTGGCCAATATTACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGG
  5   1   4   10 seed Fat1 5g3  in                          CABC493.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................TGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTC
  5   1   2       add In60 5g                         IMAGE:8951458.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATGGAAACATTTGGCCGACCCCTTTTAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCCGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCCAGGTCATAGCAGCCGAGGGTGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACTGCAGACTCTGACACATCGCTTCGAGAAGACTCACATCGTCTCCTCTGCCCTCGACTGCTGAGGCTCATGCAGAAATGACCGCCTCGTAGGCGGAGGGGTACGACTGTATATCAGAGTGATAACT
  5   1   3   22   nb Tad5 PIPE                            XZT71884.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGTAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGTAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGTGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTC
  5   1   3        nb TbA  5x3                       TTbA022d09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGNGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCCTCGACCTGGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAAGGGTTCCTGGTTGGG
  5   1   3   22   nb Tad5 5g                              XZT67875.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCG
  5   1   2       add In66 5g                         IMAGE:8963652.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGAATCTTGGCCGACACCGAGCTTAATGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGAGATGAACGCCTCCCGGGCCCTGAAGAGGCTTCATAGTGATCTCGGAGTTCCCGGGCGCCCTGCAGCTGCGCTACTGCAGACTCTGACACATCGCTCGAGAAGACTCACATCGTCTTCCTCTGCCTCGACTGCTGAGCTCATGCGATAGATCGGCCTCGTAGCGAGGTACGACGTAATTCGAGTGATACTCTTTCCGGTAG
  5   1   3        nb HdA  5g                       THdA014o06.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCAT
  5   1   3        nb Gas8 5g3  in                          st75i20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGA
  5   1   3        nb Int1      in                        CAAP12322.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCG
  5   1   3        nb Hrt1      in                        CAAQ10035.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCG
  5   1   3        nb Hrt1      in                         CAAQ8770.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGG
  5   1   2       add In62                            IMAGE:8955223.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGAGATCCGAGGCTGCAGGGAGCCCGCGCCAGTCTAGCAGCGAGGGGAGTGACGCTCCGGGCTGAAGAGCTCATATGTCTCGATCCGGCGCTGAGTGGTACTGAATCTGACACATGCTCAAAATCACTCGCTCTTGCTGCTGTGAGTCTGAAAAACGCTCTAGCAGGACATGATCAGGTCTCTGAGTCTGTGTCGTCACGTCGTCACGTCGTCATATAATATTTTGACTACTAACACTCATGTGATTTACGTAGAGGTGCATTCTTTCGGCTGGAGCTTGTGTAATATT
  5   1   2       add In54                            IMAGE:8942745.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AATAAATTAAATTAAATATAAATAAAAATAAAAATACGTCCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAAACTCAGCCACCCGGCTCCTGGCCCAGACCTCCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAATAGATTGCCCATAACATGCATTCCACCCTGGATGTGGCGACAGACGAATGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAATCTGCCCGTCCAGTTGCAGATAGCGATGGCGATCAAGCCGAGGCTGCCTGGGAGGCCCGCGCCAAGGTCATAGCAGCCCGAGGGTGAAATGAACTCCACCCGGGACT
  5   1   2       add In54                            IMAGE:8943127.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTTCTGGTTGGGTTCCAGGTCTCCAAACGGGTTCAGTCTCCCAAACCAGTTCCGGTCCAAATGATATCAATAGTTTAATTTTTTATGACGATCCCTTAACCGGTTTAAAGCCCAAAACCGTCTATCGAATGTGGTTG
  5   1   3        nb Lun1      in                          CABD629.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCGGGTTCCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAAC
  5   1   3        nb Te5       ?                          CAAO3067.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGTGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGG
  3   1   2       add Tad5 5g3  in                         XZT58983.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCTCTACCTGCAGACTCTGACCACCATCGCCTCCGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCATGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTG
  5   1   2       add Spl2      in                        CBSS4265.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAAGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTTTATCGAATGTTGTTTGGGAAACTAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAGCCGACAAGCTTTA
  5   1   3        nb Gas8      in                          st90m20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCGANAAGAACTCCACCATCGTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCANAAATAGACCCGCCCTCGTTAGGNCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAG
  5   1   3        nb Gas8      in                         st115g10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCANTCCACCCTGGATGTGGCGACNGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCGGGTTCCAGGTCTCCCAAACCAGG
  3   1   3        nb Lun1      in                          CABD629.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCGGGTTCCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAGCC
  3   1   2       add Tbd1 5g3  in                        CBXT12777.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGTCTACTATCGGGTCAATAACGCTACGCTGGCAGTGGCCAATATTACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTTGGGTTCCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAGCCGAAAAAAAAAAAAAAA
  3   1   2       ext Gas8 5g3  in                          st71b03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCGGGTTCCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTGTTGAAATCA
  3   1   3        nb Gas8      in                         st115g10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGANTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTNTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGT
  3   1   3        nb Gas8                                 st112d24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGGATGNGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGNGAAGCTGCCNGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCACCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTC
  3   1   3        nb Int1      in                        CAAP12322.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCGGGTTCCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAGCCGACAAACTTTATCCCATTATTCTGTTACTCACCCCAAGGGGGGGCACTAAGCTGTTTAGGGGGGCAAGTAGGGTGCCCCCCAGTACTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAAGATAATAATATGCTAGTATAGTGTGTATAGGCAGGACCAATGGCAGTGGAGGGGGGTGGGGAGAAATGATAATTAAAGGGTATACAAACCATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGTGTGTTTCCCCTTAGGGAACTGTTTT
  5   1   2       add Tail      in                         CBSW1708.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCGGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAAAAAAAAAAAAAAA
  3   1   4      seed Fat1 5g3  in                          CABC493.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCGGGTTCCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAGCCGACAAACTTTATCCCATTATTCTGTTACTCACCCCAAGGGGGGGCACTAAGCTGTTTAGGGGGGCAAGTAGGGTGCCCCCCAGTACTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAAGATAATAATATGCTAGTATAGTGTGTATAGGCAGGACCAATGGCAGTGGAGGGGGGTGGGGAGAAATGATAATTAAAGGGTATACAAACCATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGTGTGTTTCCCCTTAGGGAACTGTTTTGTGTTATTTTTTGTACCATTGTACCAAATAA
  5   1   3        nb AbdN                               IMAGE:7005598                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGAACTCACCATCGTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCGGGTTCCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAGCCGACAAACTTTATCCCATTATTCTGTTACTCACCCCAAGGGGGGGCACTAAGCTGTTTAGGGGGGCAAGTAGGGTGCCCCCCAGTACTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAAGATAATAATATGCTAGTATAGTGTGTATAGGCAGGACCAATGGCAGTGGAGGGGGGTGGGGAGAAATGATAATTAAAGGGTATACAAACCATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGTGTGTTTCCCCTTAGGGAACTGTTTTGTGGTATTTTTTGTACCATTGTACCAAATAAATACTCGCCTTTAACTGTGGAAAAAAAAAAAN
  3   1   2       add Thy1 5g3  in                        CBST9893.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTTCTGGTTGGGTTCCAGGTCTCCCAAACCGGGTTCCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAGCCGACAAACTTTATCCCATTATTCTGTTACTCACCCCAAGGGGGGGCACTAAGCTGTTTAGGGGGGCAAGTAGGGTGCCCCCCAGTACTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAAGATAATAATATGCTAGTATAGTGTGTATAGGCAGGACCAATGGCAGTGGAGGGGGGTGGGGAGAAATGATAATTAAAGGGTATACAAACCATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGTGTGTTTCCCCTTAGGGAACTGTTTTGTGTTATTTTTTGTACCATTGTACCAAATAAATACTCGCTTTAACTGT
  3   1   3        nb Gas8                                 st105h14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCCAANCCGGGTTCCCAGGTCTCCCA
  3   1   3        nb Hrt1      in                        CAAQ10035.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCGGGTTCCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAGCCGACAAACTTTATCCCATTATTCTGTTACTCACCCCAAGGGGGGGCACTAAGCTGTTTAGGGGGGCAAGTAGGGTGCCCCCCAGTACTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAAGATAATAATATGCTAGTATAGTGTGTATAGGCAGGACCAATGGCAGTGGAGGGGGGTGGGGAGAAATGATAATTAAAGGGTATACAAACCATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGTGTGTTTCCCCTTAGGGAACTGTTTTGTGTTATTTTTTGTACCATTGTACCAAATAAATACTCGCTTTAACTGT
  3   1   2       add Limb      in                        CBSU1584.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCAGGTCTCCCAAACCGGGTTCCAGGTCTCCCATACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAGCCGACAAACTTTATCCCATTATTCTGTTACTCACCCCAAGGGGGGGCACTAAGCTGTTTAGGGGGGCAAGTAGGGGGCCCCCCAGTACTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAAGATAATAATATGCTAGTATAGTGTGTATAGGCAGGACCAATGGCAGTGGAGGGGGGTGGGGAGAAATGATAATTAAAGGGTATACAAACCATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGTGTGTTTCCCCTTAGGGAACTGTTTTGTGTTATTTTTTGTACCATTGTACCAAATAAATACTCGCTTTAACTGTG
  3   1   2       add Spl2      in                        CBSS4265.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAAGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTTTATCGAATGTTGTTTGGGAAACTAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAGCCGACAAGCTTTATCCCATTATTCTGTTACTCACCCCAAGGGGGGGCACTAAGCTGTTTAGGGGGGCAAGTAGGGGGCCCCCCAGTACTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAAGATAATAATATGCTAGTATAGTGTGTATAGGCAGGACCAATGGCAGTGGAGGGGGGTGGGGAGAAATGATAATTAAAGGGTATACAAACCATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGTGTGTTTCCCCTTAGGGAACTGTTTTGTGTTATTTTTTGTACCATTGTACCAAATAAATACTCGCTTTAACTGG
  3   1   2       add Tail      in                         CBSW1708.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCGGGTTCCGGGT
  3   1   3        nb Gas8 5g3  in                          st75i20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCGGGTTCCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAGCCGACAAACTTTATCCCATTATTCTGTTACTCACCCCAAGGGGGGGCACTAAGCTGTTTAGGGGGGCAAGTAGGGTGCCCCCCAGTACTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAAGATAATAATATGCTAGTATAGTGTGTATAGGCAGGACCAATGGCAGTGGAGGGGGGTGGGGAGAAATGATAATTAAAGGGTATACAAACCATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGTGTGTTTCCCCTTAGGGAACTGTTTTG
  3   1   2       ext Gas8 5g3  in                          st43o04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCGGGTTCCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAGCCGACAAACTTTATCCCATTATTCTGTTACTCACCCCAAGGGGGGGCACTAAGCTGTTTAGGGGGGCAAGTAGGGTGCCCCCCAGTACTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAAGATAATAATATGCTAGTATAGTGTGTATAGGCAGGACCAATGGCAGTGGAGGGGGGTGGGGAGAAATGATAATTAAAGGGTATACAAACCATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCACGTAAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCCACCCGTGTGTTTCCCCTTAGGGAANCTGTTT
  3   1   3        nb Gas8                                  st44o04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCCAANCCGGGTTNCAGGTCTCNCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGNCGATCCCTTNACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTGTTTGNAAATCAATGAATATAATAAATGTAACT
  3   1   3        nb Gas8                                  st72b03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTCCAGGTCTCCCAAACCGGGTTCCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATNATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTNACCCGTAAAAAGCCAAAAACCNTCTATCGAACNTTGTTTGGGGAA
  3   1   2       ext Gas1 5g3  in                     NISC_mq18h01.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTGGGGAATTGTTTGTAAATCAATGAATATAATAAATGTAACCCTGATTGTGTTTGGCAGCCGACAAACTTTATCCCATTATTTTGTTACTCACCCCAAGGGGGGGCACTAAACTGTTTAGGGGGGCAAGTAGGGTGCCCCCCAGTACTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAAGATAATAATATGCTAGTATAGTGTGTATAGGCAGGACCAATGGCAGTGGAGGGGGGTGGGGAGAAATGATAATTAAAGGGTATTCAAACCATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAACCTCGCTGTGGGTTTGTGCCCAGTAACTTACAGTTGCCAAAGTTTGATGTTGCACTCAGTCGGCCCCGTGTGTTTCCCCTTAGGGAACTGTTTTGTGTTATTTTTTGTACCATTGTACCAAATAAATACTCGCTTTAACTGTGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaG
  3   1   3        nb Hrt1      in                         CAAQ8770.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATTATTCTGTTCACTCGCCACAAGGGGGGGCCATTAGCTGTTTAGGGGGGCAAGTAGGGTGCCCCCCAGTTCTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAAGATAATAATATGCTAGTATAGTGTGTATAGGCAGGACCACATGGCAGTGGAGGGGGGTGGGGAGAAATGATAATTAAAGGGTATACAAACCATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGTGTGTTTCCCCTTAGGGAACTGTTTTGTGTTATTTTT
  3   1   3        nb Eye                                  CCAX4136.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACCCCAAGGGGGGGCACTAAGCTGTTTAGGGGGGCAAGTAGGGTGCCCCCCAGTACTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAAGATAATAATATGCTAGTATAGTGTGTATAGGCAGGACCAATGGCAGTGGAGGGGGGTGGGGAGAAATGATAATTAAAGGGTATACAAACCATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGTGTGTTTCCCCTTAGGGAACTGTTTTGTGTTATTTTTTGTACCATTGTACCAAATAAATACTCGCTTTAACTGTG
  3   1   3        nb Gas8      in                          st90m20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGGGGGGTGGGGAGAAATGATANTTAAAGGGTATACAAACCATATTCATATCATAGCAAGNGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCTGTAANCTTGCAGTCGCCAAAGTTCGATGTTGCA
  3   1   3        nb Brn4                                  CAAL569.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGTGTGTTTCCCCTTAGGGAACTGTTTTGTGTTATTTTTTGTACCATTGTACCAAATAAATACTCGCTTTANCTGG
  5   1   2                                      Xt7.1-IMAGE:8950112.5                                                                                                                                                                                                                                                                                                                                                                                                                     CCTCTTCCGATACTAGTATGAGCCGATTCTTTTCGTCCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGGTAACGTCCCTGTGTCACTGTGCCCCAAGCCCCACCCACCTCACCAGGGCGGCCTATAGCGTCCATGCAAAGTATACGGGGGGCAGAGTGCCCTAAAAAATATAAGCAACGTGTAATTTGTTTAACCCTTTAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACT------------------------TAATAGGGAGGTGAAAATATTATTAATTCGTCCCGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCGGGTTCCAGGTCTCCCAAACCATGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGGAATTGTTTGTAAATCAATGAATATAATAAATGTAACATTGATCGTGTCTGGCAGCCGACCAACTTTATCCCATTATTCTGTTAACTCACCCCTAGGGGGGGCACTAATCTGTTTAGGGGGGTCAAGTAAGGATGGCCCCCAGTAACTATTG
                                                  Xt7.1-CHK-1008277944                                                                                                                                                                                                                                                                                                                                                                                                                           CCGATACTAGTATGAGCCGATTCTTTTCGTCCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGGTAACGTCCCTGTGTCACTGTGCCCCAAGCCCCACCCACCTCACCAGGGCGGCCTATAGCGTCCATGCAAAGTATACGGGGGGCAGAGTGCCCTAAAAAATATAAGCAACGTGTAATTTGTTTAACCCTTTAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCA------------TGTATTTAATAGGGAGGTGAAAATATTATTAATTCGTCCCGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCGGGTTCCAGGTCTCCCAAACCATGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGGAATTGTTTGTAAATCAATGAATATAATAAATGTAACATTGATCGTGTCTGGCAGCCGACCAACTTTATCCCATTATTCTGTTAACTCACCCCTAGGGGGGGCACTAATCTGTTTAGGGGGGTCAAGTAAGGATGGCCCCCAGTAA
  5   1   2       ext In60                            IMAGE:8949455.5p                                                                                                                                                                                                                                                                                                                                                                                                                     CCTCTTCCGATACTAGTATGAGCCGATTCTTTTCGTCCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCA
  5   1   4      seed Gas8      in                         st110d24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                              TTGTTAGTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGGTAACGTCCCTGTGTCACTGTGCCCCAAGCCCCACCCACCTCACCAGGGCGGCCTATAGCGTCCATGCAAAGTATACGGGGGGCAGAGTGCCCTAAAAAATATAAGCAACGTGTAATTTGTTTAACCCTTTAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACC
  5   1   2       ext In60                            IMAGE:8950112.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTGTATTTAATAGGGAGGTGAAAATATTATTAATTCGTCCCGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCGGGTTCCAGGTCTCCCAAACCATGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGGAATTGTTTGTAAATCAATGAATATAATAAATGTAACATTGATCGTGTCTGGCAGCCGACCAACTTTATCCCATTATTCTGTTAACTCACCCCTAGGGGGGGCACTAATCTGTTTAGGGGGGTCAAGTAAGGATGGCCCCCAGTAACTATTGGGAG
  3   1   4      seed Gas8      in                         st110d24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGAGAAACGTCTTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGNCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGNTTCCATAGTGATCTNGGAGTCCCCGGCCNCCCTGCAGCTGCGCTACNTGCAGACTNTGACCACCATCGCCTNCGAGAAGAACTCCACCATCGTNTTCCCTCTGNCCCTNGACCTGNTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCGGGTTCCATGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGATCGATCCCTTAACCCGTTAAAAAGCCAAAANCCGTCTATCGAATGTTGTNNGGGGAATT
  5   1   2                                           Xt7.1-st109d24.3                                                                                                                                                                                                                                                                                                                                                                                                                        AACTCCGCTGGGGCACAGGGCATTGTTAGTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGGTAACGTCCCTGTGTCACTGTGCCCCAAGCCCCACCCACCTCACCAGGGCGGCCTATAGCGTCCATGCAAAGTATACGGGGGGCAGAGTGCCCTAAAAAATATAAGCAACGTGTAATTTGTTTAACCCTTTAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGGGGGGTAAGGACTGTAATTCAGAGGGATCACTTCCTGGTGGGGGTTCCGGGTTGGGTTCCAGGTTTCCCAAACGGGGTTCCGGGTTTCCCAAACCAGGTTCGGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTTTGGAGGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTTTTTGGAATGTTGTTTGGGGAATTGTTTGTAAATCAAGGAATATAATAAATGTACCCCTGATG
                                                  Xt7.1-CHK-1008277942                                                                                                                                                                                                                                                                                                                                                                                                                              GCTGGGGCACAGGGCATTGTTAGTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGGTAACGTCCCTGTGTCACTGTGCCCCAAGCCCCACCCACCTCACCAGGGCGGCCTATAGCGTCCATGCAAAGTATACGGGGGGCAGAGTGCCCTAAAAAATATAAGCAACGTGTAATTTGTTTAACCCTTTAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCGGGGGGGTAAGGACTGTAATTCAGAGGGATCACTTCCTGGTGGGGGTTCCGGGTTGGGTTCCAGGTTTCCCAAACGGGGTTCCGGGTTTCCCAAACCAGGTTCGGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTTTGGAGGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTTTTTGGAATGTTGTTTGGGGAATTGTTTGTAAATCAAGGAATATAATAAATGTACCCCTGATGGTGTTG
  5   1   2       ext Gas8      in                         st111d24.5p                                                                                                                                                                                                                                                                                                                                                                                                                        AACTCCGCTGGGGCACAGGGCATTGTTAGTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGGTAACGTCCCTGTGTCACTGTGCCCCAAGCCCCACCCACCTCACCAGGGCGGCCTATAGCGTCCATGCAAAGTATACGGGGGGCAGAGTGCCCTAAAAAATATAAGCAACGTGTAATTTGTTTAACCCTTTAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAAT
  5   1   4      seed Gas8      in                         st109d24.5p                                                                                                                                                                                                                                                                                                                                                                                                                           CTCCGCTGGGGCACAGGGATTGTTAGTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGGTAACGTCCCTGTGTCACTGTGCCCCAAGCCCCACCCACCTCACCAGGGCGGCCTATAGCGTCCATGCAAAGTATACGGGGGGCAGAGTGCCCTAAAAAATATAAGCAACGTGTAATTTGTTTAACCCTTTAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCA
  3   1   4      seed Gas8      in                         st109d24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCGGGTTCCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTGTTGAAATCAA
  3   1   2       ext Gas8      in                         st111d24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCTGCAGAGAGCGATGGCGGCAGAAGCCGAGGNTGCCAGGGANGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCCGGNCCATGAAAGAGGNTTCCATAGTGATCTNGGAGTCCCCGGCCGCCCTGCAGCTGCGTNACCTGCAGACTNTGACCACCATCGCCTCCGAGAAGAACTCCACCAT
  3   1   2       ext TpA  5x3  out                   TTpA054h21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCAGGGAGGCCCGCCCCAAGTTCATAGCAGCCGGGGGGGAGATGAACCCCTCCCGGGCCCTGAAAGGGGTTTCCATAGTGATTTGGGAGTCCCCGGCCCCCCTGCAGTTGGGTTACCTGCAGATTTTGACCCCCTTCGCTTCGGAGAAGAATTCCCCCTTGTTTTTCCTTTTGCCCCTCGCCCTGTGGAAGGGTTTCATGCAGAAATAGACCCCCCCTCGTTAGGCGGGGGGGTAAGGACTGTAATTCAGAGGGATCACTTCCTGGTGGGGGTTCCGGGTTGGGTTCCAGGTTTCCCAAACGGGGTTCCGGGTTTCCCAAACCAGGTTCGGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTTTGGAGGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTTTTTGGAATGTTGTTTGGGGAATTGTTTGTAAATCAAGGAATATAATAAATGTACCCCTGATGGTGTTGGGCaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  5   1   2  SIG                                     Xt7.1-CAAL20450.5                                                                                                                                                                                                                                                                                                                                                                                                                             CCGCTGGGGCACAGGGATTGTTAGTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGTGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCGGGTTCCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAGCCGACAAACTTTATCCCATTATTCTGTTACTCACCCCAAGGGGGGGCACTAAGCTGTTTAGGGGGGCAAGTAGGGGGCCCCCCAGTACTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAAGATAATAATATGCTAGTATAGTGTGTATAGGCAGGACCAATGGCAGTGGAGGGGGGTGGGGAGAAATGATAATTAAAGGGTATACAAACCATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGTGTGTTTCCCCTTAGGGAACTGTTTTGTGTTATTTTTTGTACCATTGTACCAAATAAATACTCGCTTTAACTGTGAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008277940                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGCACAGGGATTGTTAGTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGTGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCGGGTTCCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAGCCGACAAACTTTATCCCATTATTCTGTTACTCACCCCAAGGGGGGGCACTAAGCTGTTTAGGGGGGCAAGTAGGGGGCCCCCCAGTACTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAAGATAATAATATGCTAGTATAGTGTGTATAGGCAGGACCAATGGCAGTGGAGGGGGGTGGGGAGAAATGATAATTAAAGGGTATACAAACCATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGTGTGTTTCCCCTTAGGGAACTGTTTTGTGTTATTTTTTGTACCATTGTACCAAATAAATACTCGCTTTAACTGTGAAAAAAAA
  5   1   2       ext In60 5g                         IMAGE:8950653.5p                                                                                                                                                                                                                                                                                                                                                                           ATACATTATTACCACCTTTCAATATTTTTTTTAATTCGTCCCCTCAAACTCCGCTGGGGCACAGGGATTGTTAGTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCTCCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGAGGACAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCTCATA
  5   1   2   10  ext Eye  5g3  in                         CCAX8116.b1 ................................................................................................................................................................................................................................................................................................................................................................................................................GGGACTCAAACTCCGCTGGGGCACAGGGATTGTTAGTGGATCCAAGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAG
  5   1   2   14  ext Brn4 5g3  in                        CAAL20450.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................TTAGTGGATCCATGTGACAGGGACATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGTGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCCTCG
  5   1   4      seed Lun1      in                         CABD8791.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCATCGATTCGGGAATGGCCGACACCGAGCTTAAGTCCAGGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTC
  5   1   3        nb Gas8      in                          st65o18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAGGGCCAATCAGGAGGACAGGAATATAGAAGAGTCAGACGGCGGGCTTGGATGCTGCGGTTGGTTTTTGGTGATTTTGTCCTTCTTCTTCACGCTCCTCACCTTCCCCATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCG
  5   1   3        nb Tad5      in                         XZT11345.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATATCCGTATGGATGTGCATAAAGATTGTGAAGGAATATGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGTGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCAAACCGGGTTCCAGGTCTCCCAAAACAGGTTC
  5   1   3        nb Thy1      in                        CBST5443.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGGACGTGTGGGTGAGCGCGCAATCATTTTCAGACTGGGGCGTATCCTGCGCGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACCGACAGCTTCATCAATGTGGATATGAGAACCATTTCATTCGACATCCCCCCCCAAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTTCTGGTTGGG
  5   1   2       ext Tad5      in                          XZT3943.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGAGACCATTTCATTCGACATCCCCCCCCAGAGATTCTGACAAAGGACTCGGTCACCGTTAGTGTGGATGGCGTTGTCTACTATCGGGTCAATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCGGGTTCCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAGCCGACAAACTTTATCCCATTAATCTGT
  5   1   2       ext Tad5      in                          XZT9941.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATCGGGTCATAACGCTACCCTGGCAGTGGCCAATATCACCAACGCAGACTCAGCCACCCGGCTCCTGGCCCAGACCACCCTGAGAAACGTCCTGGGGACCAAGAACCTGTCCCAGATCCTCTCTGATAGAGAAGAGATTGCCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGTGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCGGGTTCCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAGCCGACAAACTTTATCCCATTATTCTGTTACTCACCC
  3   1   3        nb Tad5      in                         XZT11345.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATAGGGAAGAGATTGGCCATAACATGCAGTCCACCCTGGATGTGGCGACAGACGACTGGGGTATCAAGGTGGAGCGGGTGGAGATTAAGGACGTGAAGCTGCCCGTCCAGTTGCAGAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCGCCAAGGTCATAGCAGCCGAGGGTGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTCTGACCACCATCGCCTCCGAGAAGAACTCCACCATCGTCTTCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCGGGTTCCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTAATTGTTTGTAAATCAATGAATATAATAAAGGTAACACTGATCGTGTCTGGCAGCCGAAAATAAAAAAAAAA
  3   1   2       ext Eye  5g3  in                         CCAX8116.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCAGTTGCAGAAGAGCGATGGCGGCAGAAGCCGAGGCTGCCAGGGAGGCCCGCCCCCAAGGTCATAGCAGCCGAGGGGGAGATGAACGCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATCTCGGAGTCCCCGGCCGCCCTGCAGCTGCGCTACCTGCAGACTTTGACCACCATCGCCTCCGAGAAGAACTCCACCATCGTTTTCCCTTTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCGGGTTCCAGGTTTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTTTGGCAGCCG
  3   1   2       ext Brn4 5g3  in                        CAAL20450.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGAGAGCGATGGCGGCAGAAACCGAGGCTTCCAGGGAGGCCCGCCCCAAGGTCATAGCAGCCGAGGGTGAGATGAACCCCTCCCGGGCCCTGAAAGAGGCTTCCATAGTGATTTTGGAGTCCCCGGCCGCCCTGCAGGTGGGCTACCTGCAGATTTTGACCCCCATTGCCTCCGAGAAGAAATCCCCCATTGTTTTCCCTTTGCCCCTCGACCTGGTGAAGGGGTTCATGCAGAAATAGACCCCCCCTCGTTTGGCCGGGGGGTAACGACTGTAATTCAGAGGGATCCCTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTTTCCCAAACCGGGTTCCAGGTTTCCCAAACCAGGTTCCGGGTCCCAAAATGATTTCAAATAAGTTTAATTTTTTTTTGGCGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTTTTTTGAATGTTGTTTGGGGAATTAATTGTTTGTAAATCAATGAATTTAATAAATGTAACCCTGATCGTGTTTGGCAGCCG
  3   1   4      seed Lun1      in                         CABD8791.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCGGGTTCCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAGCCGACAAACTTTATCCCATTATTCTGTTACTCACCCCAAGGGGGGGCACTAAGCTGTTTAGGGGGGCAAGTAGGGTGCCCCCCAGTACTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAAGATAATAATATGCTAGTATAGTGTGTATAGGCAGGACCAATGGCAGTGGAGGGGGGTGGGGAGAAATGATAATTAAAGGGTATACAAACCATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGTGTGTTTCCCCTTAGGGAACTGTTTTGTGTTATTTTTTGTACCATTGTACCAAATAAATACTCGCTTTAACTGG
  3   1   2       ext Tad5      in                          XZT3943.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCCTCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCGGGTTCCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAGCCGACAAACTTTATCCCATTATTCTGTTACTCACCCCAAGGGGGGGCACTAAGCTGTTTAGGGGGGCAAGTAGGGTGCCCCCCAGTACTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAAGATAATAATATGCTAGTATAGTGTGTATAGGCAGGACCAATGGCAGTGGAGGGGGGTGGGGAGAAATGATAATTAAAGGGTATACAAACCATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGTGTGTTTCCCCTTAGGGAACTGTTTTGTGTTATTTTTTGTACCATTGTACCAAATAAATACTCGCTTAACTGAAAAAAAAAAAAAAAGGG
  3   1   3        nb Gas8      in                          st65o18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCTGCCCCTCGACCTGCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTCCTGGTTGGGTTCCAGGTCTCCCAAACCGGGTTCCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAGCCGACAAACTTTATCCCATTATTCTGTTACTCACCCCAAGGGGGGGCACTAAGCTGTTTAGGGGGGCAAGTAGGGTGCCCCCCAGTACTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAAGATAATAATATGCTAGTATAGTGTGTATAGGCAGGACCAATGGCAGTGGAGGGGGGTGGGGAGAAATGATAATTAAAGGGTATACAAACCATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGTGTGTTTCCCCTTAGGGAACTGTTT
  3   1   3        nb Thy1      in                        CBST5443.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTGAAGGGCTTCATGCAGAAATAGACCCGCCCTCGTTAGGCCGAGGGGTAACGACTGTAATTCAGAGTGATCACTTCCTGGTAGGGGTTTCTGGTTGGGTTCCAGGTCTCCCAAACCGGGTTCCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAGCCGACAAACTTTATCCCATTATTCTGTTACTCACCCCAAGGGGGGGCACTAAGCTGTTTAGGGGGGCAAGTAGGGTGCCCCCCAGTACTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAAGATAATAATATGCTAGTATAGTGTGTATAGGCAGGACCAATGGCAGTGGAGGGGGGTGGGGAGAAATGATAATTAAAGGGTATACAAACCATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGTGTGTTTCCCCTTAGGGAACTGTTTTGTGTTATTTTTTGTACCATTGTACCAAATAAATACTCGCTTTAACTGG
  5   1   3        nb Tad5                                 XZT59086.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCTGGTTGGGTTCCAGGTCTCCCAAACCAGGTTCCGGGTCCCAAAATGATATCAAATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAGCCGACAAACTTTATCCCATTATTCTGTTACTCACCCCAAGGGGGGGCACTAAGCTGTTTAGGGGGGCAAGTAGGGGGCCCCCCAGTACTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAAGATAATAATATGCTAGTATAGTGTGTATAGGCAGGACCAATGGCAGTGGAGGGGGGTGGGGAGAAATGATAATTAAAGGGTATACAAACCATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGTGTGTTTCCCCTTAGGGAACTGTTTTGTGTTATTTTTTGTACCATTGTACCAAATAAATACTCGCTTTAACTGTAAAAAAAAAAAAAAAGG
  5   1   3        nb Bone      in                        CBTC1262.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAGCCGACAAACTTTATCCCATTATTCTGTTACTCACCCCAAGGGGGGGCACTAAGCTGTTTAGGGGGGCAAGTAGGGGGCCCCCCAGTACTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAAGATAATAATATGCTAGTATAGTGTGTATAGGCAGGACCAATGGCAGTGGAGGGGGGTGGGGAGAAATGATAATTAAAGGGTATACAAACCATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGTGTGTTTCCCCTTAGGGAACTGTTTTGTGTTATTTTTTGTACCATTGTACCAAATAAATACTCGCTTTAACTGT
  3   1   3        nb Bone      in                        CBTC1262.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AATAAGTTTAATTTTTTATTGACGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAGCCGACAAACTTTATCCCATTATTCTGTTACTCACCCCAAGGGGGGGCACTAAGCTGTTTAGGGGGGCAAGTAGGGGGCCCCCCAGTACTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAAGATAATAATATGCTAGTATAGTGTGTATAGGCAGGACCAATGGCAGTGGAGGGGGGTGGGGAGAAATGATAATTAAAGGGTATACAAACCATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGTGTGTTTCCCCTTAGGGAACTGTTTTGTGTTATTTTTTGTACCATTGTACCAAATAAATACTCGCTTTAACTGT
  3   1   2       ext Tad5      in                          XZT9941.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAATTTTTTTTTGGAGATCCCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTTTTGGGGGAATTAATGGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGGGTTTGGCAGCCGACAAAATTTATCCCATTTTTTTGTTACTCACCCCAAGGGGGGGCACTAAGCTGTTTAGGGGGGCAAGTAGGGGGCCCCCCAGTCCTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAGGATAATAATATGCTAGTATAGGGTGTATAGGCAGGACCAATGGCAGTGGAGGGGGGTGGGGGGAAATGATAATTAAAGGGTATACAAACCATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGGGTGTTTCCCCTTAGGGAACTGTTTTGTGTTATTTTTTGTACCATTGTTCCAAATAAATACTCGCTTTA
  3   1   2       ext Tad5      in                         XZT43316.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCACGCGTCCGCTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTTTGGCAGCCGACAAACTTTATCCCATTATTCTGTTACTCACCCCAAGGGGGGGCACTAAGCTGTTTAGGGGGGCAAGTAGGGGGCCCCCCAGTACTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAAGATAATAATATGCTAGTATAGTGTGTATAGGCAGGACCAATGGCAGTGGAGGGGGGTGGGGAGAAATGATAATTAAAGGGTATACAAACCATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGTGTGTTTCCCCTTAGGGAACTGTTTTGTGTTATTTTTTGTACCATTGTACCAAATAAATACTCGCTTTAACTGTG
  5   1   2       ext Tad5      in                         XZT43316.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTAACCCGTTAAAAAGCCAAAAACCGTCTATCGAATGTTGTTTGGGGAATTAATTGTTTGTAAATCAATGAATATAATAAATGTAACACTGATCGTGTCTGGCAGCCGACAAACTTTATCCCATTATTCTGTTACTCACCCCAAGGGGGGGCACTAAGCTGTTTAGGGGGGCAAGTAGGGGGCCCCCCAGTACTATGGAGGGACCCAGTTAGTGTAAAGATCAGTGCAAAAGCAGAACGTTATTATTGTTAAGATAATAATATGCTAGTATAGTGTGTATAGGCAGGACCAATGGCAGTGGAGGGGGGTGGGGAGAAATGATAATTAAAGGGTATACAAACCATATTCATATCATAGCAAGTGTGAATGTTTATAGGTAGATTGATAAAAATAAGCCTCGCTGTGGGTCTGTGCCCAGTAACTTACAGTCGCCAAAGTTCGATGTTGCACTCAGTCGGCACCGTGTGTTTCCCCTTAGGGAACTGTTTTGTGTTATTTTTTGTACCATTGTACCAAATAAATACTCGCTTTAACTGTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)