Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

 This cluster: approximate FL confidence score = 81%

 1012071757 Xt7.1-CAAL5742.3.5 - 104 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                        3     9    10    16    13    25    14    32    34    37    36    39    37    40    38    41    39    41    40    42    40    42    40    42    41    43    41    44    41    44    41    44    42    45    43    45    43    44    43    44    43    44    43    44    43    44    43    44    43    44    43    44    44    44    44    44    45    45    45    45    45    45    45    45    44    44    45    45    45    45    46    46    46    46    46    46    46    46    45    45    45    45    46    46    46    46    49    49    48    49    49    51    48    52    50    52    51    53    52    57    54    58    58    64    61    67    63    69    63    68    64    69    65    70    64    69    64    69    65    70    66    72    66    71    67    71    67    71    66    70    64    70    60    68    59    66    56    63    55    63    48    56    49    55    45    52    46    53    45    52    42    48    43    49    43    48    43    49    43    49    42    49    42    49    42    48    42    48    43    49    42    49    43    49    43    49    40    48    36    48    45    48    36    49    37    49    37    49    37    50    38    49    38    49    36    49    38    49    36    49    37    48    37    48    37    48    38    49    38    49    38    49    37    49    37    50    37    48    37    47    35    45    31    45    35    46    33    45    31    45    14    27    13    22    13    19    13    18    14    19    14    19    14    19    14    19    14    19    14    19    15    19    15    19    15    19    15    19    15    19    15    19    12    19    13    18    10    16     9    13     9    13     4     7     4     6     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     5     4     5     4     5     4     5     4     5     3     4
                                                                   VAR                                                                                                                                                                                                               TGGCGGCGCTCAGACACTTCCTGC
                                                                   VAR                                                                                                                                                                                                                                       CTCAGACACAGC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGAAGAGGAAAATCATTTGTGATTGATCCAGGGATCAATTTGGGGGCCAATGGTCCGTGCATTAGGTGCCCCTCTTCAGTTTGGGCAGCAGTATACAAAACTAGACGCAGTACGTGTGGGAGCCACACATACCCCAAAGGCTGGCCGTGGGTGGGAGTTGTTCCAAACGTAACCTTCTGTTCCCTGTGTGCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCGAGATATGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGACAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTATCGCCATTCCTACTAGTGCCCCCCTTGTGGCTGTTGTGCACTTTGCTTTGTGTCCCTTGTGGGGTCGTCGTCTCCCTGCCTTTCCCTGCGCGGTTTCTGTCTCAGCCTCCGTCTTACAGTGGGTTAGCCAGGCATATAAAGGGTTAATGGATACAGACCATCCTTGTGCCACCCCTGGGCCTAGGGTAACCCATAAATTGGGTGGGTGCCAGGGATTCAGCAAGTTCTACCCTGTAATACAGATCTAAGAACTGGGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGTGTAGTTTGTACTAGAGAGTAATATTAGTGAAAGAGCGCCCCCTAATTGCACCACTATATATAATTACTGCTGGTACTGATATGGGATGTGACCATGTTCTGGTATCTTTGTGCATCTGAAGCAGAGGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGACATGTGGCTCTGAAACCCACAGGGATCCAAATCTCAGTTCCAAGAGACCCAATAATAATAATCTGGGATCTGGAAGGTTTT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                       ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -------T--C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---------T--
                                               BLH ATG       5     249                                                                                                                                                                                                   
                                               EST CLI      14      33                                                                                                                                                                                                   
                                                                                                                                                                                                                                                                                                                           PROTEIN --- Sc ==== 3e-093     NP_014361.1 alpha-4-beta-4 subunit of mitochondrial isocitrate dehydrogenase 1; Idh1p[Saccharomyces cerevisiae] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                          PROTEIN --- Xt ---- 1e-096     NP_001025597.1 MGC107965 protein [Xenopus tropicalis] -----------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Sp ---- 7e-101     XP_001175786.1 PREDICTED: similar to NAD (H)-specific isocitrate dehydrogenase gamma subunit precursor isoform 1 [Strongylocentrotus purpuratus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                 PROTEIN --- Ce ---- 6e-116     NP_510362.1 isocitrate dehydrogenase (41.6 kD) (XO790) [Caenorhabditis elegans] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                PROTEIN --- Dm ---- 5e-122     NP_651000.1 CG6439-PA [Drosophila melanogaster] -----------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                              PROTEIN === Mm ==== 2e-171     NP_570954.1 isocitrate dehydrogenase 3, beta subunit; isocitrate dehydrogenase 3 beta; N14Atumor-related protein [Mus musculus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                               PROTEIN --- Hs ---- 5e-172     NP_777280.1 isocitrate dehydrogenase 3, beta subunit isoform b precursor; isocitricdehydrogenase; NAD+-specific isocitrate dehydrogenase beta precursor;NAD+-specific isocitrate dehydrogenase b subunit; NAD+-specific ICDH; isocitratedehydrogenase, NAD(+)-specific, mito [Homo sapiens]  ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                    PROTEIN --- Dr ---- 8e-173     NP_001002157.1 zgc:86647 [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                 PROTEIN --- Gg ---- 2e-173     NP_001026558.1 isocitrate dehydrogenase 3, beta subunit [Gallus gallus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                              PROTEIN === Xl ==== 0          AAH72104.1 MGC79028 protein [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                              PROTEIN === ?? ==== 0          NP_001085395.1 MGC79028 protein [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CAAL5742.3.5                                                                                                                                                                                                        ATG------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------ATG------------------------------------------------------------------------------ATG------------------------------------ATG------------------------------------------ATG------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG------------------ATG---------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------TAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------TAA------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
  3   1   2       add Ovi1      out                        CABI6065.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAGGAAAGGGGCAGAAAGATTGGAAATGATGGAGGAGAAGGAGGAAAGAGCAGAAAGTGGAAATGATGGAGAGGCTGAATGGGTAGAAACAGTGAAGATGATGGAGGATTACATTACATTAACATTTATTTATAAAGCGCCAACATATTCCGCAGCAAGGATAGGACCAGTGGAGATGATGGAGGAGGAGAGAAGGGTAGGTAGAAGAATAGAAATTGGAGGAAAGGGTAGGAACTATCAAGTTGATGGTGAAGGTGGAACGGTTAGAAAGAATGGAGATGATGAAGAGGAAAATCATTTGTGATTGATCCAGGGATCAATTTGGGGGCCAATGGTCCGTGCATTAGGTGCCCCTCTTCAGTTTGGGCAGCAGTATACAAAACTAGACGCAGTACGTGTGGGAGCCACACATACCCCAAAGGCTGGCCGTGGGTGGGAGTTGTTCCAAACGTAACCTTCTGTTCCCTGTGTGCCCTCAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTGTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGG
  3   1   2       ext Te5  PIPE in                         CAAO1389.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGTTTGCGTTTGATTATGCCACCAGAAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTCCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGG
  3   1   3        nb Hrt1 5g3  in                         CAAQ4868.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTGTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTGTGT
  3   1   3        nb Mus1      in                         CABH8155.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTTGCGTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGG
  3   1   2       add Brn4 5g3  in                         CAAL8997.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTG
  3   1   2       ext Brn4 5g3  in                        CAAL18947.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTG
  3   1   2       ext Tail 5g3  in                         CBSW1404.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTAGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTCCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTGAAAAAAAAAAAAAAA
  3   1   3        nb Brn4      in                         CAAL5866.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGAAGGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTCCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTG
  3   1   2       ext Mus1 5g3  in                         CABH9535.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTGAAGCCAAAAAAG
  3   1   2       ext Brn4 5g3  in                        CAAL18941.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTG
  3   1   2       add Gas7 5g3  in                          XZG4387.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAGGGCAGATCCAAGGTCACTGCTGTGCCCAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTAGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTTTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTTTTAGGGGCATCTGTGCCAACAACGGGTTCCTTTGCCCCAGGATTGGGGGCAAAAGTGTTTTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTCCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGGG
  3   1   3        nb BrSp 5g3  in                     EC2BBA20DF12.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTACTGGTCATGCCCAACTTGTATGGCAATATCATCGATAACCTGGCGGCCGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATATGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCCGCCCCCTTCTAGCGCCTACCTACTTGC
  3   1   3        nb Bone 5g3  in                        CBTC9651.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTAGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGTGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTCCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATG
  3   1   3        nb Tbd1 5g3  in                         CBXT3275.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTTTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTTTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTGAAAAAAAAAAAAAAA
  3  -1   3        nb Hrt1      in                         CAAQ6919.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTTTCTGGGAAATGAGGGTCTAGCGTGTGATTGG
  5  -1   3        nb Hrt1      in                         CAAQ6919.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTTTCTGGGAAATGAGGGTCTAGCGTGTGATTGG
  3   1   3        nb Te5       in                        CAAO12742.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTCCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTG
  3   1   3        nb Spl2      in                        CBSS6121.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCCGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACCATGTATGT
  3   1   3        nb Brn4 5g3  in                         CAAL8239.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTTTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTTTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTTTTTGGATTACACACAGGCCGTCATTTCCAACCTGAGCTTTTAGGGGCATTTGTGCCAACAACGGGTTCCTTTGCACCAGGATTGGGGGCAAAAGTGTTTTTTTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTCCCTGTTTTCCAAGGGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTTTGAATTTACCCGCTGCCCCCTTCTAGGGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTG
  5   1   3        nb Brn4                                 CAAL8301.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTGA
  3   1   3        nb Brn4 5g3  in                        CAAL20504.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTCCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTG
  3   1   3        nb Te1  5g3  in                        CBWN10250.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTAGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGTGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTCCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGCGAAAAAAAAAAAAAAA
  5   1   3        nb BrSp                            EC0CBA005CB03.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATATGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCC
  3   1   2       add Ovi1      in                        CABI14092.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGATGATGAAGAGGAAAATCATTTGTGATTGATCCAGGGATCAATTTGGGGGCCAATGGTCCGTGCATTAGGTGCCCCTCTTCAGTTTGGGCAGCAGTATACAAAACTAGACGCAGTACGTGTGGGAGCCACACATACCCCAAAGGCTGGCCGTGGGTGGGAGTTGTTCCAAACGTAACCTTCTGTTCCCTGTGTGCCCTCAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTGAAGCCAAAAAAA
  5   1   2       add Ovi1      in                        CABI14092.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGATGATGAAGAGGAAAATCATTTGTGATTGATCCAGGGATCAATTTGGGGGCCAATGGTCCGTGCATTAGGTGCCCCTCTTCAGTTTGGGCAGCAGTATACAAAACTAGACGCAGTACGTGTGGGAGCCACACATACCCCAAAGGCTGGCCGTGGGTGGGAGTTGTTCCAAACGTAACCTTCTGTTCCCTGTGTGCCCTCAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTGAAGCCAAAAAAA
  5   1   3        nb Thy1      in                        CBST5319.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCGGGTGCACGCCACCTCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTGAAGC
  3   1   3        nb Thy1      in                        CBST5319.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCC
  5   1   2       ext Thy1      in                       CBST13239.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTACGCTACTTCTCTGGATTAACACAGGCCGTCATCTCCAACCTGAGCTCTTAAGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAAGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTGAAGCCACTGGTCTGGGTGTAGTTTGTACTAGAGAGTAATATTAGTGAAAGAGCGCCCCCTAATTGCACCACTATATATAATTACTGCTGGTACTGATATGGGATGTGACCATGTTCTGGTATCTTTGTGCATCTGAAGCAGAGGAATAAACCGGACTGGACATGTGGCTCTGAAACCCACAGGGATCCAAATCTCAGTTCCAAGAGACCCAATAATAATAATCTGGGATCTGGAAGGTTTTATACTGTACATGTAGAAGAGTGTTTACATTGGAATCCACCAATAAATATTACAAGAAAGGGCAGAACACACACTTTGGCTGCACCAATTCTGTGGTTCTGTTTCTGACCTGGTCCATCTGACTACACCTTGCTCTGTCCTTACCAGCTCTTTAATATGAATAGCAATACGTTGGGGC
  5   1   2       ext Tbd1      in                        CBXT11901.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAATGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCCGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTGAAGCCACTGGTCTGGGTGTAGTTTGTACTAGAGAGTAATATTAGTGAAAGAGCGCCCCCTAATTGCACCACTATATATAATTACTGCTGGTACTGATATGGGATGTGACCATGTTCTGGTATCTTTGTGCATCTGAAGCAGAGGAAAAAACCGGACTGGACATGTGGCTCTGAAACCCACAGGGATCCAAATCTCAGTTCCAAGAGACCCAATAATAATAATCTGGGATCTGGAAGGTTTTATACTGTACATGTAGAAGAGTGTTTACATTGGAATCCACCAATAAATATTACAAGAAAGGGCAGAACACACACTTTGGCTGCACCAATTCTGTGGTTCTGTTTCTGACCTGGTCCATCTGACTACACCTTGCTCTGTCCTTACCAGCTCTTTAATATGAATAGCAATACGTTGGGGCAGATTCTAATCAATGGGA
  3   1   2       ext Thy1      in                       CBST13239.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTGAAGCCACTGGTCTGGGTGTAGTTTGTACTAGAGAGTAATATTAGTGAAAGAGCGCCCCCTAATTGCACCACTATATATAATTACTGCTGGTACTGATATGGGATGTGACCATGTTCTGGTATCTTTGTGCATCTGAAGCAGAGGAATAAACCGGACTGGACATGTGGCTCTGAAACCCACAGGGATCCAAATCTCAGTTCCAAGAGACCCAATAATAATAATCTGGGATCTGGAAGGTTTTATACTGTACATGTAGAAGAGTGTTTACATTGGAATCCACCAATAAATATTACAAGAAAGGGCAGAACACACACTTTGGCTGCACCAATTCTGTGGTTCTGTTTCTGACTTGGTCCATCTGACTACACCTTGCTCTGTCCTTACCAGCTCTTTAATATGAATAGCAATACGTTGGGGCAGATTCTAATCAATGGGAAAATTTTATTTTATGGTTTATCACGTCTGTATACAGGGACTTTACATTATTGCAGTAGACACAAAATTGCCCAACTATACTATATAATACAATGCCAATAAACTTTCTTTCTCC
  3   1   2       ext Tbd1      in                        CBXT11901.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCCGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTGAAGCCACTGGTCTGGGTGTAGTTTGTACTAGAGAGTAATATTAGTGAAAGAGCGCCCCCTAATTGCACCACTATATATAATTACTGCTGGTACTGATATGGGATGTGACCATGTTTTGGTATTTTTGTGCATTTGAAGCAGAGGAAAAAACCGGACTGGACATGTGGCTTTGAAACCCACAGGGATCCAAATTTCAGTTCCAAGAGACCCAATAATAATAATTTGGGATTTGGAAGGTTTTATACTGTACATGTAGAAGAGTGTTTACATTGGAATCCACCAATAAATATTACAAGAAAGGGCAGAACACACACTTTGGCTGCACCAATTTTGTGGTTTTGTTTTTGACCTGGTCCATTTGACTACACCTTGTTTTGTCCTTACCAGCTTTTTAATATGAATAGCAATACGTTGGGGCAGATTTTAATCAATGGGAAAATGTTATTTTATGGTTTATCACGTCTGTATACAGGGACTTTACATTATTGCAGTAGACACAAAATTGCCCAACTATACTATATAATACAATGCCAATAAACTTTCCTTTTCCATTAAAAAAAAAAAAAAAAAAAAAAAAAGAAAAAAAAAAAAAAA
  5   1   3        nb Tbd1      in                        CBXT15819.b1                                                                                                                                                                                                                 CTCAGACACTTCCTGCGCTCTACTCAGACACAGCTGTACCCACAGATCAGCCTGGCATGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTCCATGTCACCATGATCCCTGGGGGATGGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCGGCTGATGTGC
  5   1   3        nb Te3       in                         CAAM5265.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGAGTGCCTTCAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGTCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGGACCCGAGATATGGGAGGTTATTCCACGACAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTATCGCCATTCCTACTAGTGCCCCCTTGTGGCTGTTGTGCACTTTGCTTTGTGTCCCTTGTGGGGTCGTCGTCTCCCTGCCTTTCCCTGCGCGGTTTCTGTCTCAGCCTCCGTCTTACAGTGGGTTAGCCAGGCATATAAAGGGGTTA
  3   1   3        nb Hrt1      in                         CAAQ3473.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGGACCCGAGATATGGGAGGTTATTCCACGACAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTATCGCCATTCCTACTAGTGCCCCCCTTGTGGCTGTTGTGCACTTTGCTTTGTGTCCCTTGTGGGGTCGTCGTCTCCCTGCCTTTCCCTGCGCGGTTTCTGTCTCAGCCTCCGTCTTACAGTGGGTTAGCCAGGCATATAAAGGGTTAATGGATACAGACCATCCTTGTGCCACCCCTGGGCCTAGGGTAACCCATAAATTGGGTGGGTGCCAGGGATTCAGCAAGTTCTACCCTGTAATACAGATCTAAGAACTGGGAGAGAACCTTCAGCCGCTGCTCATTTCCTGTTACTGGGCGCCCTTGCCAGTCGGCCAATAAAACTGCTCTATAAGGGGCTCATTGCTCCACAAGCAGTCAGTCTGGGCCCAAGTGGTTCCGACTGTGGGAGCTCTAGCCTGGGCAAAGTATTGGGGCAGGTTGTGCCAGGCTGATGCCCAGCGTTGGAGCATTTACACACACACTGCCCACCCCCAGTGCCG
  3   1   2       add Gas7 5x3  in                         XZG36419.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAATATCATCGATAACCTGCGGCTGGGCTGTCGGGGGCGCTGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGGACCCGAGATATGGGAGGTTATTCCACGACAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTATCGCCATTCCTACTAGTGCCCCCCTTGTGGCTGTTGTGCACTTTGCTTTGTGTCCCTTGTGGGGTCGTCGTCTCCCTGCCTTTCCCTGCGCGGTTTCTGTCTCAGCCTCCGTCTTACAGTGGGTTAGCCAGGCATATAAAGGGTTAATGGATACAGACCATCCTTGTGCCACCCCTGGGCCTAGGGTAACCCATAAATTGGGTGGGTGCCAGGGATTCAGCAAGTTCTACCCTGTAATACAGATCTAAGAACTGGGAGAGAACCTTCAGCCGCTGCTCATTTCCTGTTACTGGGCGCCCTTGCCAGTCGGCCAATAAAACTGCTCTATAAGGGGCTCATTGCTCCACAAGCAGTCAGTCTGGGCCCAAGTGGTTCCGACTGTGGGAGCTCTAGCCTGGGCAAAGTATTGGGGCAGGTTGTGCCAGGCTGATGCCCAGCGTTGGAGCATTTACACACACACTGCCCACCCCCAGTGCCGCACAAATAAAAACCTTTATTTTTCATT
  3   1   3        nb Gas8      in                          st61a18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGGACCCGAGATATGGGAGGTTATTCCACGACAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTATCGCCATTCCTACTAGTGCCCCCCTTGTGGCTGTTGTGCACTTTGCTTTGTGTCCCTTGTGGGGTCGTCGTCTCCCTGCCTTTCCCTGCGCGGTTTCTGTCTCAGCCTCCGTCTTACAGTGGGTTAGCCAGGCATATAAAGGGTTAATGGATACAGACCATCCTTGTGCCACCCCTGGGCCTAGGGTAACCCATAAATTGGGTGGGTGCCAGGGATTCAGCAAGTTCTACCCTGTAATACAGATCTAAGAACTGGGAGAGAACCTTCAGCCGCTGCTCATTTCCTGTTACTGGGCGCCCTTGCCAGTCGGCCAATAAAACTGCTCTATAAGGGGCTCATTGCTCCACAAGCAGTCAGTCTGGGCCCAAGTGGTTCCGACTGTGGGAGCTCTAGCCTGGGCAAAGTATTGGGGCAGGTTGTGCCAGGCTGATGCCCAGCTTTGGAGCATT
  3   1   4      seed Tad5      in                          XZT5386.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGGACCCGAGATATGGGAGGTTATTCCACGACAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTATCGCCATTCCTACTAGTGCCCCCCTTGTGGCTGTTGTGCACTTTGCTTTGTGTCCCTTGTGGGGTCGTCGTCTCCCTGCCTTTCCCTGCGCGGTTTCTGTCTCAGCCTCCGTCTTACAGTGGGTTAGCCAGGCATATAAAGGGTTAATGGATACAGACCATCCTTGTGCCACCCCTGGGCCTAGGGTAACCCATAAATTGGGTGGGTGCCAGGGATTCAGCAAGTTCTACCCTGTAATACAGATCTAAGAACTGGGAGAGAACCTTCAGCCGCTGCTCATTTCCTGTTACTGGGCGCCCTTGCCAGTCGGCCAATAAAACTGCTCTATAAGGGGCTCATTGCTCCACAAGCAGTCAGTCTGGGCCCAAGTGGTTCCGACTGTGGGAGCTCTAGCCTGGGCAAAGTATTGGGGCAGGTTGTGCCAGGCTGATGCCCAGCGTTGGAGCATTTACACACACACTGCCCACCCCCAGTGCCGCACAAATAAAAACCTTTAT
  3   1   2       ext Tad5      in                         XZT47654.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGGACCCGAGATATGGGAGGTTATTCCACGACAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTATCGCCATTCCTACTAGTGCCCCCCTTGTGGCTGTTGTGCACTTTGCTTTGTGTCCCTTGTGGGGTCGTCGTCTCCCTGCCTTTCCCTGCGCGGTTTCTGTCTCAGCCTCCGTCTTACAGTGGGTTAGCCAGGCATATAAAGGGTTAATGGATACAGACCATCCTTGTGCCACCCCTGGGCCTAGGGTAACCCATAAATTGGGTGGGTGCCAGGGATTCAGCAAGTTCTACCCTGTAATACAGATCTAAGAACTGGGAGAGAACCTTCAGCCGCTGCTCATTTCCTGTTACTGGGCGCCCTTGCCAGTCGGCCAATAAAACTGCTCTATAAGGGGCTCATTGCTCCACAAGCAGTCAGTCTGGGCCCAAGTGGTTCCGACTGTGGGAGCTCTAGCCTGGGCAAAGTATTGGGGCAGGTTGTGCCAGGCTGATGCCCAGCGTTGGAGCATTTACACACACACTGCCCACCCCCAGTGCCGCACAAATAAAAACCTTTATTTTTCATT
  3   1   3        nb Te3       in                         CAAM5265.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGGACCCGAGATATGGGAGGTTATTCCACGACAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTATCGCCATTCCTACTAGTGCCCCCTTGTGGCTGTTGTGCACTTTGCTTTGTGTCCCTTGTGGGGTCGTCGTCTCCCTGCCTTTCCCTGCGCGGTTTCTGTCTCAGCCTCCGTCTTACAGTGGGTTAGCCAGGCATATAAAGGGTTAATGGATACAGACCATCCTTGTGCCACCCCTGGGCCTAGGGTAACCCATAAATTGGGTGGGTGCCAGGGATTCAGCAAGTTCTACCCTGTAATACAGATCTAAGAACTGGGAGAGAACCTTCAGCCGCTGCTCATTTCCTGTTACTGGGCGCCCTTGCCAGTCGGCCAATAAAACTGCTCTATAAGGGGCTCATTGCTCCACAAGCAGTCAGTCTGGGCCCAAGTGGTTCCGACTGTGGGAGCTCTAGCCTGGGCAAAGTATTGGGGCAGGTTGTGCCAGGCTGATGCCCAGCGTTGGAGCATTTACACACACACTGCCCACCCCCAGTGCCGCACAAATAAAAACCTTTATTTTTC
  3   1   2       add Gas8      in                          st86e23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTACATACATTATCATTCAGTGTAACCGCTGCCCCGGCACATTGCTCCCCATTTTTCTTTTGCTGCTTCCCATCTCACTTTTCTTTTGGTTCATTTGGCTGTTTGTGTTCTCTCCTGTGCGGCTGCCCCTCAGGTGCGGACCCGAGATATGGGAGGTTATTCCACGACAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTATCGCCATTCCTACTAGTGCCCCCTTGTGGCTGTTGTGCACTTTGCTTTGTGTCCCTTGTGGGGTCGTCGTCTCCCTGCCTTTCCCTGCGCGGTTTCTGTCTCAGCCTCCGTCTTACAGTGGGTTAGCCAGGCATATAAAGGGTTAATGGATACAGACCATCCTTGTGCCACCCCTGGGCCTAGGGTAACCCATAAATTGGGTGGGTGCCAGGGATTCAGCAAGTTCTACCCTGTAATACAGATCTAAGAACTGGGAGAGAACCTTCAGCCGCTGCTCATTTCCTGTTACTGGGCGCCCTTGCCAGTCGGCCAATAAAACTGCTCTATAAGGGGCTCATTGCTCCACAAGCAGTCAGTCTGGGCCCAAGTGGTTCCGACTGTGGGAGCTCTAGCCTGGGCAAAGTATTGGGGCAGGTTGTGCCAGGCTGATGCCCAGCGTTGGAGCATTTACACACACACTGCCCACCC
  3   1   2       ext Neu       in                    TNeu099o03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGACTGCAAATGTTACTTTCTGCAACAAACATGCTGCGCCCCACCTGAACCTNCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGGACCCGAGATATGGGAGGTTATTCCACGACAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTATCGCCATTCCTACTAGTGCCCCCTTGTGGCTGTTGTGCACTTTGCTTTGTGTCCCTTGTGGGGTCGTCGTCTCCCTGCCTTTCCCTGCGCGGTTTCTGTCTCAGCCTCCGTCTTACAGTGGGTTAGCCAGGCATATAAAGGGTTAATGGATACAGACCATCCTTGTGCCACCCCTGGGCCTAGGGTAACCCATAAATTGGGTGGGTGCCAGGGATTCAGCAAGTTCTACCCTGTAATACAGATCTAAGAACTGGGAGAGAACCTTCAGCCGCTGCTCATTTCCTGTTACTGGGCGCCCTTGCCAGTCGGCCAATAAAACTGCTCTATAAGGGGCTCATTGCTCCACAAGCAGTCAGTCTGGGCCCAAGTGGTTCCGACTGTGGGAGCTCTAGCCTGGGCAAAGTATTGGGGCAGGTTGTGCCAGGCTGATGCCCAGCGTTGGAGCATTTACACACACACTGCCCACCCCCAGTGCCGCACAAATAAAAACCTTTATTTTTCATTAAAAAAAAAAAAAAAAA
  3   1   2       add Eye       in                         CCAX1381.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGGACCCGAGATATGGGAGGTTATTCCACGACAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTATCGCCATTCCTACTAGTGCCCCCCTTGTGGCTGTTGTGCACTTTGCTTTGTGTCCCTTGTGGGGTCGTCGTCTCCCTGCCTTTCCCTGCGCGGTTTCTGTCTCAGCCTCCGTCTTACAGTGGGTTAGCCAGGCATATAAAGGGTTAATGGATACAGACCATCCTTGTGCCACCCCTGGGCCTAGGGTAACCCATAAATTGGGTGGGTGCCAGGGATTCAGCAAGTTTTACCCTGTAATACAGATTTAAGAACTGGGAGAGAACCTTCAGCCGCTGCTCATTTCCTGTTACTGGGCGCCCTTGCCAGTCGGCCAATAAAACTGCTCTATAAGGGGCTCATTGCTCCACAAGCAGTCAGTCTGGGCCCAAGTGGTTCCGACTGTGGGAGCTCTAGCCTGGGCAAAGTATTGGGGCAGGTTGTGCCAGGCTGATGCCCAGCTTTGGAGCATTTACACACACACTGCCCACCCCCAGTGCCGCACAAATAAAAACCTTTATTTTTCATTA
  3   1   3        nb HeRe                              EC2CAA4CA07.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGATACAGACCATCCTTGTGCCACCCCTGGGCTTAGGGTAACCCATAAATTGGGTGGGTGCCAGGGATTCAGCAAGTTCTACCCTGTAATACAGATCTAAGAACTGGGAGAGAACCTTTAGCCGCTGCTCATTTCCTGTTACTGGGCGCCCTTGCCAGTCGGCCAATAAAACTGCTCTATAAGGGGCTCATTGCTCCACAAGCAGTCAGTCTGGGCCCAAGTGGTTCCGACTGTGGGAGCTCTAGCCTGGGCAAAGTATTGGGGCAGGTTGTGCCAGGCTGATGCCCAGCATTGGAGCATTTACACACACACTGCCCACCCCC
  3   1   2       ext Brn4      in                        CAAL22394.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCAGGGATTCAGCAAGTTCTACCCTGTAATACAGATCTAAGAACTGGGAGAGAACCTTCAGCCGCTGCTCATTTCCTGTTACTGGGCGCCCTTGCCAGTCGGCCAATAAAACTGCTCTATAAGGGGCTCATTGCTCCACAAGCAGTCAGTCTGGGCCCAAGTGGTTCCGACTGTGGGAGCTCTAGCCTGGGCAAAGTATTGGGGCAGGTTGTGCCAGGCTGATGCCCAGCGTTGGAGCATTTACACACACACTGCCCACCCCCAGTGCCGCACAAATAAAAACCTTTATTTTTCATTAAAGCTCTTTTGTTTATTTGTTTTTGTTGAGTTTTGCATTTTAGAAGCGCTGCCCCCTTTACATTCTATAATTCTTCTGCCAAACTCTAAACATTAATCCCCTCATCATAGGGCTGTTAGCCCGGAGTAACTCCCCTCAATTCTACCTTTCATCTGTCGGCCCAAGAGAAAGTGACAGATATGGGCTCACACCACCCCTAGGGCCCTTGTTTTGTGGAGGATACTGGGAGATGTACCAGTGAAATGGCAACCAGCACCTCCTCCACATCCCTCTCTACTCCTCTCTTGGTCATTTACTATGGGTATAAGTTGGCCAAGTAGAGCAGCAGCTCATTCCATGTAGTTGGCCAGTGCATTGACAAACTACCGGTTTGTGGGTCAAGTTATATCAAAATGCTTATGGCATACATAGCAATCTATATCGCTCCTTTAAAGAAACAATAACAACT
  3   1   3        nb HeRe                             EC2CAA19AF08.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGATTCAGCAAGTTCTACCCTGTAATACAGATCTAAGAACTGGAAGAGAACCTTTAGCCGCTGCTCATTTCCTGTTACTGGGCGCCCTTGCCAGTCGGCCAATAAAACTGCTCTATAAGGGGCTCATTGCTCCACAAGCAGTCAGTCTGGGCCCAAGTGGTTCCGACTGTGGGAGCTCTAGCCTGGGCAAAGTATTGGGGCAGGTTGTGCCAGGCTGATGCCCAGCGTTGGAGCATTTATACACACACACACACACACACACTGCCCACC
  3   1   3        nb HeRe                              EC2CAA3AG11.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGATCTAAGAACTGGAAGAGAACCTTTAGCCGCTGCTCATTTCCTGTTACTGGGCGCCCTTGCCAGTCGGCCAATAAAACTGCTCTATAAGGGGCTCATTGCTCCACAAGCAGTCAGTCTGGGCCCAAGTGGTTCCGACTGTGGGAGCTCTAGCCTGAACAAAGTATTGGGGCAGGTTGTGCCAGGCTGATGCCCAGCAAAGGAGCATTTATCACACACACACACACACACACTGCCCACCCC
  3   1   3        nb Tbd1      in                        CBXT15819.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCATTTCCCTGTTACTGGGCCGCCCCTTGCCAGTCCGGCCAATAAAACTGCTCTATAAGGGGCTCATTGCTCCACAAGCAGTCAGTCTGGGCCCCAAGTGGTTCCGACTGTGGGAGCTCTAGCCTGGGCAAAGTATTGGGGCAGGTTGTGCCAGGCTGATGCCCAGCATTGGAGCATTTACACACACACTGCCCACCCCCAGTGCCGCACAAATAAAAACCTTTATTTTTCATTAAAAAAAAAAAAAAA
  3   1   3        nb Gas7      in                         XZG25378.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGTTACTGGGCGCCCTTGCCAGTCGGGCAATAAAACTGCTCTATAAGGGGCTCATTGCTCCACAAGCAGTCAGTCTGGGCCCAAGTGGTTCCGACTGTGGGAGCTCTAGCCTGGGCAAAGTATTGGGGCAGGTTGTGCCAGGCTGATGCCCAGCGTTGGAGCATTTACACACACACTGCCCACCCCCAGTGCCGCACAAATAAAAACCTTTATTTTTC

In case of problems mail me! (