Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 91%

 1012071805 Xt7.1-CABJ7447.3.5 - 101 ESTs
                                                                       ........-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABJ7447.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTGTAGGAAGCTGCTGCTGTTCCCTGGCTCGGCAAAAGGCTCCTGAGGGCCTAAGCAGCGCTTAGAGACCTGTAATTGTACAGCGTAGCGGGACACCATGTCAGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTACTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGAAAGTGGGGGAGAAGCTCTTTGGTCCTTATGTATGGGGAAGGTATGATGTACTATTCATGCCACCATCTTTCCCATTTGGTGGAATGGAGAACCCCTGCATCACATTTGTTACCCCATGTCTGCTGGCTGGTGATCGCTCATTGGCTGATGTTATCATACACGAGATTTCACACAGCTGGTTCGGGAACCTGGTCACCAGTGCCAACTGGGGAGAATTTTGGCTGAATGAGGGTTTCACAATGTATGCCCAACGTAGAATTACTACTGAATTATATGGTCCTGCTTACACTTGCCTGGAAGCAGCTGCTGGAAGAGCCCTGTTACGGCAGCACATGGACTCTTCTGGGGAAGACCACCCTTTGAACAAATTACGAGTAAAGATAGAGCCTGGTGTGGATCCAGATGATACTTATAATGAGACTCCCTACGAGAAAGGGTTCTGCTTTGTTTCATACTTGGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAAAATGCAATAAACCAAAATAAACATCAA
                                                  Xt7.1-CHK-1008223215                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAGCTGCTGCTGTTCCCTGGCTCGGCAAAAGGCTCCTGAGGGCCTAAGCAGCGCTTAGAGACCTGTAATTGTACAGCGTAGCGGGACACCATGTCAGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTACTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGAAAGTGGGGGAGAAGCTCTTTGGTCCTTATGTATGGGGAAGGTATGATGTACTATTCATGCCACCATCTTTCCCATTTGGTGGAATGGAGAACCCCTGCATCACATTTGTTACCCCATGTCTGCTGGCTGGTGATCGCTCATTGGCTGATGTTATCATACACGAGATTTCACACAGCTGGTTCGGGAACCTGGTCACCAGTGCCAACTGGGGAGAATTTTGGCTGAATGAGGGTTTCACAATGTATGCCCAACGTAGAATTACTACTGAATTATATGGTCCTGCTTACACTTGCCTGGAAGCAGCTGCTGGAAGAGCCCTGTTACGGCAGCACATGGACTCTTCTGGGGAAGACCACCCTTTGAACAAATTACGAGTAAAGATAGAGCCTGGTGTGGATCCAGATGATACTTATAATGAGACTCCCTACGAGAAAGGGTTCTGCTTTGTTTCATACTTGGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAAAATGCAATAAACCAAAATAAACATCAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      3     5     3     7     5     9    11    18    18    23    19    24    20    25    22    27    29    29    31    31    31    31    31    31    31    32    31    32    31    32    32    32    32    32    32    32    32    32    32    32    34    34    34    34    34    35    35    36    35    36    36    36    36    36    36    37    36    37    36    37    36    37    36    36    37    37    37    37    37    37    37    37    37    37    37    37    37    37    39    40    39    41    39    41    40    42    40    42    41    42    41    42    42    42    42    42    42    42    42    42    42    43    42    43    42    43    42    44    44    45    44    44    41    45    43    44    43    44    44    45    43    44    40    44    36    43    37    45    37    45    34    45    33    45    32    43    30    44    32    44    31    44    27    41    27    40    25    35    26    35    24    33    24    33    24    32    24    31    24    29    24    28    21    25    19    22    19    23    19    23    19    23    18    24    18    24    17    24    16    24    16    25    16    24    16    24    16    24    15    23    15    23    15    23    15    24    15    25    16    27    18    29    20    29    23    29    23    29    22    28    25    31    27    36    29    37    32    41    36    46    34    46    41    49    42    48    42    47    43    48    44    48    44    48    44    49    43    48    43    48    44    49    45    50    45    50    43    49    43    49    45    50    45    50    43    49    45    49    44    48    44    48    44    47    43    46    43    46    42    45    42    45    42    45    41    44    42    43    42    43    42    43    42    43    42    43    42    43    42    43    41    43    41    43    41    42    41    41    40    40    39    39    40    40    40    40    40    40    39    39    39    40    38    38    38    38    38    38    38    38    38    38    37    37    37    37    37    37    36    37    36    36    36    36    35    35    34    34    34    34    31    32    28    29    26    26     5     5
  5   1   2  SIG                                      Xt7.1-CABJ7447.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAAGCGAAAGCCTTGTAGGAAGCTGCTGCTGTTCCCTGGCTCGGCAAAAGGCTCCTGAGGGCCTAAGCAGCGCTTAGAGACCTGTAATTGTACAGCGTAGCGGGACACCATGTCAGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTACTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGAAAGTGGGGGAGAAGCTCTTTGGTCCTTATGTATGGGGAAGGTATGATGTACTATTCATGCCACCATCTTTCCCATTTGGTGGAATGGAGAACCCCTGCATCACATTTGTTACCCCATGTCTGCTGGCTGGTGATCGCTCATTGGCTGATGTTATCATACACGAGATTTCACACAGCTGGTTCGGGAACCTGGTCACCAGTGCCAACTGGGGAGAATTTTGGCTGAATGAGGGTTTCACAATGTATGCCCAACGTAGAATTACTACTGAATTATATGGTCCTGCTTACACTTGCCTGGAAGCAGCTGCTGGAAGAGCCCTGTTACGGCAGCACATGGACTCTTCTGGGGAAGACCACCCTTTGAACAAATTACGAGTAAAGATAGAGCCTGGTGTGGATCCAGATGATACTTATAATGAGACTCCCTACGAGAAAGGGTTCTGCTTTGTTTCATACTTGGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAAAATGCAATAAACCAAAATAAACATCA
  5   1   2  SIG                                      Xt7.1-CABG9677.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTACTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAANAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGANAGTGGGGGAGAAGCTCTTTGGTCCTTATGTATGGGGAAGGTATGATGTACTATTCATGCCACCATCTTTCCCATTTGGTGGAATGGAGAACCCCTGCATCACATTTGTTACCCCATGTCTGCTGGCTGGTGATCGCTCATGGGCTGATGTTAT------------CAGTACTGTCTATGCATGTTTACAGGTCCTGCTTACACTTGCCTGGAAGCAGCTGCTGGAAGAGCCCTGTTACGGCAGCACATGGACTCTTCTGGGGAAGACCACCCTTTGAACAAATTACGAGTAAAGATAGAGCCTGGTATGTATTTGTTAACAAAGATACATAACATCAGATGCTGCATAGTAACATTTCTCCTCTTTTCTTTCTCTTTTTCAATTGGCAGGTGTGGATCCAGATGATACTTATAATGAGACTCCCTACGAGAAAGGGTTCTGCTTTGTTTCATACTTGGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAAAATGCAATAAACCAAAATAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGGAAGCAGCTGCTGGAAGAGCCCTGTTACGGCAGCACATGGACTCTTCTGGGGAAGACCACCCTTTGAAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAATTACGAGTAAAGATAGAGCCTGGTATGTATTTGTTAACAAAGATACATAACATCAGATGCTGCATAGTAACATTTCTCCTCTTTTCTTTCTCTTTTTCAATTGGC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----A----G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----------AT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             A-----------
                                               BLH ATG      97     453                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               BLH MIN      94     277                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               BLH OVR      97      11                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               CDS MIN      97      13                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               EST CLI      21      13                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               ORF LNG      97       4                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Sc ---- 3e-084     NP_014353.1 Similar to human LTA4 hydrolase but in vivo substrates not yet defined.;Ynl045wp [Saccharomyces cerevisiae] -----------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ce ---- 5e-096     NP_001023056.1 C42C1.11a [Caenorhabditis elegans] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Dm ==== 1e-099     NP_724138.1 CG10602-PB, isoform B [Drosophila melanogaster] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Sp ---- 0          XP_793744.2 PREDICTED: similar to Arginyl aminopeptidase (aminopeptidase B) [Strongylocentrotus purpuratus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Dr ==== 0          NP_001002741.1 zgc:100971 [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Hs ---- 0          NP_064601.3 ar [Homo sapiens]  -===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Mm ---- 0          NP_663392.1 arginyl aminopeptidase (aminopeptidase B) [Mus musculus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Gg ---- 0          XP_419245.2 PREDICTED: similar to MGC80387 protein [Gallus gallus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Xl ==== 0          AAH82410.1 MGC82089 protein [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === ?? ==== 0          NP_001087880.1 MGC82089 protein [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED = Xt ==== 0          AAH67945.1 Hypothetical protein MGC69297 [Xenopus tropicalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABJ7447.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGA---------------------------------------TAG---------ATG---------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------TAG------------------TGA---------TAG---------------------------------------------------------------------------ATG---TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
  5   1   1         - Int1      in                         CAAP8916.5p CCGAGGCTGGATTCTGGGTTTCTATATACGGCAATGGCAGACAGGGGTGATTTGTTGCCCGCAGTTAAATCTCTACCTATGGGAGGTGTCAAATTTCCCAAAAATGACTTGCCATTAAATAACTTTACAATTGCCACAGGTAAACTTCAGCACTCAAGCCGATTCAGCTTAATCACAGGAAAATGTGGCATTTTCCCACAAATATGCTGTAATGCTGTTTTAGGTTTTATTTGCGCCAATCTGAATGTTATTCACTGGCGGGTCATTATTGTAAGATTTTCCACCTGAGGTAGCACAGATGTAACTGCTTATTGATGTTCTGCTTGGTAGAGTTCTTTTGACTGGGACATGCCTATGGCAGTACATATGTAATTTTCATTTAAAACATGTTTTGCATTGTCTGCCATTTATGTATTGCTCTTTTGTCTCTTTTACTGCTGATTGTGCACTTTGCTTATCTTTTACACTTTACACTGCTGAGCTTGTGTATTATACTTCCCTTATTTTTTGCTGCATCAGCCTTTTTATGCTGTTTATTTGCATGAAAATGTTGAAATGAGACATTTATGTTGCTGTTATCAGGGGATTGGATGAACCTTGATATTACAAGTTTTACTCATGACTGANAGGTTTTTTTTTTTCTAACTAGCAGTCAGTGCTATAATTGGTGCTTGAATGTGCATTACTTTAATACCTTCCAGAATCACTTGGAAATATAAAGAANAAGTTGCCATAGCCCCTACATGAGGATGGCACACAAAATAACCCT
  5   1   2  SIG                                      Xt7.1-CABJ7447.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAAGCGAAAGCCTTGTAGGAAGCTGCTGCTGTTCCCTGGCTCGGCAAAAGGCTCCTGAGGGCCTAAGCAGCGCTTAGAGACCTGTAATTGTACAGCGTAGCGGGACACCATGTCAGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTACTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGAAAGTGGGGGAGAAGCTCTTTGGTCCTTATGTATGGGGAAGGTATGATGTACTATTCATGCCACCATCTTTCCCATTTGGTGGAATGGAGAACCCCTGCATCACATTTGTTACCCCATGTCTGCTGGCTGGTGATCGCTCATTGGCTGATGTTATCATACACGAGATTTCACACAGCTGGTTCGGGAACCTGGTCACCAGTGCCAACTGGGGAGAATTTTGGCTGAATGAGGGTTTCACAATGTATGCCCAACGTAGAATTACTACTGAATTATATGGTCCTGCTTACACTTGCCTGGAAGCAGCTGCTGGAAGAGCCCTGTTACGGCAGCACATGGACTCTTCTGGGGAAGACCACCCTTTGAACAAATTACGAGTAAAGATAGAGCCTGGTGTGGATCCAGATGATACTTATAATGAGACTCCCTACGAGAAAGGGTTCTGCTTTGTTTCATACTTGGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAAAATGCAATAAACCAAAATAAACATCA
                                                  Xt7.1-CHK-1008279114                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAAGCCTTGTAGGAAGCTGCTGCTGTTCCCTGGCTCGGCAAAAGGCTCCTGAGGGCCTAAGCAGCGCTTAGAGACCTGTAATTGTACAGCGTAGCGGGACACCATGTCAGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTACTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGAAAGTGGGGGAGAAGCTCTTTGGTCCTTATGTATGGGGAAGGTATGATGTACTATTCATGCCACCATCTTTCCCATTTGGTGGAATGGAGAACCCCTGCATCACATTTGTTACCCCATGTCTGCTGGCTGGTGATCGCTCATTGGCTGATGTTATCATACACGAGATTTCACACAGCTGGTTCGGGAACCTGGTCACCAGTGCCAACTGGGGAGAATTTTGGCTGAATGAGGGTTTCACAATGTATGCCCAACGTAGAATTACTACTGAATTATATGGTCCTGCTTACACTTGCCTGGAAGCAGCTGCTGGAAGAGCCCTGTTACGGCAGCACATGGACTCTTCTGGGGAAGACCACCCTTTGAACAAATTACGAGTAAAGATAGAGCCTGGTGTGGATCCAGATGATACTTATAATGAGACTCCCTACGAGAAAGGGTTCTGCTTTGTTTCATACTTGGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAAAATGCAATAAACCAAAATAAACATCAAAAAAA
  5   1   1           Gas1 FL                     IMAGE:5308559.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGCAAAAGGCTCCTGAGGGCCTAAGCAGCGCTTAGAGACCTGTAATTGTACAGCGTAGCGAGGGCACCATGTCAGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGTTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTGCTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTTCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGACACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGAAAGTGGGGGAGAAGCTCTTTGGTCCTTATGTATGGGGAAGGTATGATGTACTATTCATGCCACCATCTTTCCCATTTGGTGGAATGGAGAACCCCTGCATCACATTTGTTACCCCATGTCTGCTGGCTGGTGATCGCTCATTGGCTGATGTTATCATACACGAGATTTCACACAGCTGGTTCGGGAACCTGGTCACCAATGCCAACTGGGGAGAATTTTGGCTGAATGAGGGTTTCACAATGTATGCCCAGCGTAGAATTACTACTGAATTATATGGTCCTGCTTACACTTGCCTGGAAGCAGCTGCTGGAAGAGCCCTGTTACGGCAGCACATGGACTCTTCTGGGGAAGACCACCCTTTGAACAAATTACGAGTAAAGATAGAGCCTGGTGTGGATCCAGATGATACTTATAATGAGACTCCCTACGAGAAAGGGTTCTGCTTTGTTTCATACTTAGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATTTCTGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAGCAGAACTAGCAAACCTCTGGTCTTCTACACCACTTGACACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCATCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGCCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAAAATGCAATAAACCAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2   10  ext Ski1 5g3  in                         CABJ9527.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCCGAGGGTCTGTGCCTTTACGTACTACCAAAGGCGGGGACTCTTTTTGTTTAATAAGCAAAAGCGAAAGCCTTGTAGGAAGCTGCTGCTGTTCCCTGGCTCGGCAAAAGGCTCCTGAGGGCCTAAGCAGCGCTTAGAGACCTGTAATTGTACAGCGTAGCGGGACACCATGTCAGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTACTGCCCCCCAGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTAATAGA
  5   1   2       add In60 5g                         IMAGE:8952170.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAACGTTTATTTTTAATATTTTATATATTTAAAAATCTCCCTTGTAGGAAGCTGCTGCTCTTCCCTGGCTCGGCAAAAGGCTCCTGAGGGCCTAAGCAGCGCTTAGAGACCTGTAATTGTACAGCGTAGCGGGACACCATGTCAGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTGCTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGACACAGCCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCGTGTGTGGCGAGCCTTGTCTTATAGAGCAGCTAAAAGAGTATGATGAAGTATAGAGAGTCTGAAGTGGGGGAGAAGCTCTTTGGGTCCTATG
  5   1   2   14  ext Te5  5g3  in                        CAAO11062.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAAAGCGAAAGCCTTGTAGGAAGCTGCTGCTGTTCCCTGGCTCGGCAAAAGGCTCCTGAGGGCCTAAGCAGCGCTTAGAGACCTGTAATTGTACAGCGTAGCGGGACACCATGTCAGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTACTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATNGGAGTATAGA
  5   1   2       add In60 5g                         IMAGE:8947592.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTTTTAATAACTGAACATTCGATTCGAATTCGTCCCCGGCAAAAGGCTCCTGAGGGCCTAAGCAGCGCTTAGAGACCTGTAATTGTACAGCGTAGCGGGACACCATGTCAGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTGCTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGACACAGCCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGTAGGACCAAAGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAGAGTATGATGGAGTAATAGAGGAGTTCCTGAAAGTTGGGGAGAAGCTTCTTTGTCTTATGTATGGGGACGTATGATGTACTATTCATGCCACATTCTTTCCATTGTGATGGAAGACCCTGCATCCAGTGTACCATGTTCGCTGCCTGGTATCGCCCTCAATTGGCCTGAAAGAGCTTATC
  5   1   2       add In60 5g                         IMAGE:8948806.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTTTTAATAAATAACGGAAACATACAATTCAAATTCGTCCAGGGCCTAAGCAGCGCTTAGAGACCTGTAATTGTACAGCGTAGCGGGACACCATGTCAGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTACTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTTAAAAGAGTATGATGGAGTAATAAGAGGAGTTCCTGAAGTGGGGGAGAGCTCTTTGGTCTTATGTTATGGGGAGTATGAATGTACTATTCATGCACATCTTTCCATTTGTGAATGAAACCCCTGCATCACATTTGTAACCCATGCTCGCTGACTGATCGCTCATTGTCTGAAGTTATCCATACACCGCAGAATTTTTTTCAC
  5   1   2       add In54 5g                         IMAGE:8943013.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACAACATTAACAAAGATACAACAAATAAAATTCGTCCCTGAGGGCCTAAGCAGCGCTTAGAGACCTGTAATTGTACAGCGTAGCGGGACACCATGTCAGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTGCTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGACACAGCCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACAAAGAGCCGTGTGTGGGCCGAGCCTTGTCTATAGAGCAGCTAAAAGAGTATGATGGAGTATTAGAGAGTTCTTGAATGGGGGAGAGCTCTTTGTCCTTATGTATGGGAGTAATGATGTACTATTTCATGCACCATCTTTCCCATTGCTGATGGAGTCCCTGCATCCATTTGTTACCAAGTTCTGCTGCCTGGTGAATCGCTCACTTGG
  5   1   3   10   nb Eye  5g3  in                         CCAX8944.b1 .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGCTGTTCCCTGGCTCGGCAAAAGGCTCCTGAGGGCCTAAGCAGCGCTTAGAGACCTGTAATTGTACAGCGTAGCGGGACACCATGTCAGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGGAACATGAGGAGTTGTCGTGGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTG
  5   1   3        nb Abd0 5g3  in                       IMAGE:6999794                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCCTGGCTCGGCAAAAGGCTCCTGAGGGCCTAAGCAGCGCTTAGAGACCTGTAATTGTACAGCGTAGCGGGACACCATGTCAGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTACTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAAGTAGGACCAAGGAGCCGT
  5   1   0       chi Int1      in                        CAAP13929.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAATATAAAGAAAAAGTTGCCATAGCCCCTACATGAGGATGGCACACAAATTAACCCTCCCCTGTCCACCCTCTCCTAATTAAGAGCAATTTTAACCTATAATAGTAATGAAGTCATAAATAGGCCCTGGCTATGGAAGATGGAGAATCCTCTATCaaacacaggatttcttgtctccttttttgtaaacgtgttcttcgggtatctgacttcctcacagaaaaatcccccattccagaatctgcacagttctctcctttttctcctctcctgctccccctcccacaagaattaataaaactcactcccacctcccttaggaatgtgtaatctgagctataaggctagagctgcaaacaggaagctatgacgaccaagctaaaatggcagctgcaatcttaaacaagcagagaaagctccttgggctctttattcaggtTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGAAAGTGGGGGAGAAGCTCTTTGGTCCTATGTATGGGGGAGGTATGATGTACTATTCATGCCACCATCTTTCCCCATTGGTGGA
  5   1   3        nb Gas1 FL   in                    IMAGE:5308559.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GATGGCAAAAGGCTCCTGAGGGCCTAAGCAGCGCTTAGAGACCTGTAATTGTACAGCGTAGCGAGGGCACCATGTCAGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGTTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTGCTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTTCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTT
  5   1   3        nb AbdN 5g                            IMAGE:7004230                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGGCAAAAGGCTCCTGAGGGCCTAAGCAGCGCTTAGAGACCTGTAATTGTACAGCGTAGCGGGACACCATGTCAGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTACTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAAAGAGTATGATGGAGTAATAGAGGAGTTTCCTGGAAAGTGGGGGGGAGAAAGCCTCTTTGGGTCCTTTATGGTATGGGGG
  5   1   2       add In62 5g                         IMAGE:8955040.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAAAGGCTCCTGAGGGCCTAAGCAGCGCTTAGAGACCTGTAATTGTACAGCGTAGCGGGACACCATGTCAGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTGCTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGACACAGCCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAGGAGTATGATGAGTATAGAGGAGTTCCTGAAAGTGGGGGGAGAAGCTTTTTGGTCCTTATGTTTGGGAAGTATGATGTACTATTCATGCCACCATCTTCCCATTGTGATGGAAGACCCTGCATCACATTGTACCCATGCCGCTGCTGGGATCGCTCATGCTGATGTTTACAAACGAAATCCACACGCTGTCGACTGTCACATGCCACTGGGGAATTGCCTGAGAGGTCAGTTAGCCAGTAATCCACGAATAGGCTCGTGTTTACCCTTGCCGAACCGTGGAACGTGTACCAGCCACATGTAAC
  5   1   2       add In63 5g                         IMAGE:8961259.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAAGGCTCCTGAGGGCCTAAGCAGCGCTTAGAGACCTGTAATTGTACAGCGTAGCGAGGGCACCATGTCAGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGTTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTGCTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTTCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGACACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAGGAGTATGATGGAGTAATAGAGGAGTCCTGAAAGTGGGGGAGAGCTCTTTGGTCCTTATGTATGGGAGTATGATGTACTATTCATGCCACCATCTTCCCATTTGGTGATGAGACCCTGCATCACATTGTTACCCATGTTGCTGCTGGGATCGCTCATGCTGATGTTATCTAACCGAGAATTCAACAGCTGTCGGACTGTACAATGCACTGGGGGAAATGCTGATGAGGTCAATTGCCACGTAAATTACTGAATTATGTCGCTACCTGCCGTGAACCCGTCGTGAAACGGGT
  5   1   3        nb Gas  5g                        TGas035c09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAAAGCTCCTGAGGGCCTAAGCAGCGCTTAGAGACCTGTAATTGTACAGCGTAGCGGGACACCATGTCAGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTACTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACA
  5   1   3        nb HdA  5g                        THdA019p17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAAGGCTCCTGAGGGCCTAAGCAGCGCTTAGAGACCTGTAATTGTACAGCGTAGCGGGACACCATGTCAGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTACTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAANAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGAAAGTGGGGGAGAAGCTCTTTGGTCCTTATGTATGGGGAAAGTATGATGTACTATTCA
  5   1   3        nb HdA  5g                        THdA019p23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAAGGCTCCTGAGGGCCTAAGCAGCGCTTAGAGACCTGTAATTGTACAGCGTAGCGGGACACCATGTCAGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTACTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGAAAGTGGGGGAGAAGCTCTTTGGGTCTTATGTATGGGGAAGGTATGATGTACTATTC
  5   1   3        nb In60 5g                         IMAGE:8951674.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGCTTTCCTAGAAGGGCCTAAGCAGCGCTTAGAGACCTGTAATTGTACAGCGTAGCGGGACACCATGTCAGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTGCTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGACACAGCCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGAAGTGGGGAGAGCTCTTTGGTCTTATGTATGGGGAAGGATGATGTACTATCATGCACATCTTTCCCATTTGGTGGATGGAGAACCCTGCATACACATTTGTTTAACCCAGTGTCTGC
  5   1   2       add In62 5g                         IMAGE:8955773.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTTGAGGGCCTAAGCAGCGCTTAGAGACCTGTAATTGTACAGCGTAGCGGGACACCATGTCAGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTGCTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGACACAGCCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGAGCCGTGTGTGGGCCGAGTCTTGTCTTTATAGAGCAGCTAAAAGGAGTATGATGGAGTATAGAGAGTTCCTGAAAGTGGGGAGAGCTCTTTGGTCTTATGTATGGAAGTATGATGTACTATCATGCAACATCCTCCCATTGTGAATGAGATCTGGCATCATTGGTTACCATGTCTGCCTGCTGGTGATCGGCTCTATGGCCTAGAGCTAC
  5   1   3        nb In63 5g                         IMAGE:8960073.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGACGGGCCTAAGCAGCGCTTAGAGACCTGTAATTGTACAGCGTAGCGGGACACCATGTCAGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTGCTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGACACAGCCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAGAGTATTGATGGAGTAATAGAGGAGTTCCTGAAGTGGGGAGAGCTCTTTGGTCTTTTGTATGGGGAGTATGGATGTACTATCCATGCCACATCTTTCCATTGGTGGAATGAGAAGCCTTCATCACATTTGTGTTACCCATG
  3  -1   2       ext Lun1      in                         CABD2048.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGAGGGCCTAAGCAGCGCTTAGAGACCTGTAATTGTACAGCGTAGCGGGACACCATGTCAGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTACTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTAATAGAGGGAGTCCTGAAAGTGGGGGAGAAGCTCTTTGGTCCTTATGTATGGGGAAGGTATGATGTACTATTCATGCCACCATCTTTCCCATTTGGGGGAAT
  3  -1   2       ext Int1      in                        CAAP12427.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGGGCCTAAGCAGCGCTTAGAGACCTGTAATTGTACAGCGTAGCGGGACACCATGTCAGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTACTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGANAGTGGGGGAGAAGCTCTTTGGTCCTATGTATGGGGAGGTATGATGTACTATTCATGCCACCATCTTT
  5   1   3        nb Egg  5g                       TEgg074e04.p1kSP6w                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTAAGCAGCGCTTAGAGACCTGTAATTGTACAGCGTAGCGAGGGCACCATGTCAGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGTTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTGCTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTTCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTNTTAATTCGAGATGACACAACCTATT
  5   1   3   10   nb Limb 5g3  in                        CBSU6448.fwd ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCAGCGCTTAGAGACCTGTAATTGTACAGCGTAGCGGGGCACCATGTCAGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTACTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGACACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCG
  5   1   3   10   nb Liv1 5g3  in                        CAAR12979.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAATTCGGCACGAGGGTACAGCGTAGCGGGACACCATGTCAGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTACTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGAAAGTGGGGGAGAAGCTCTTTGGTCCTTATGTAT
  3  -1   3        nb Fat1      in                         CABC2253.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGACTCCTATAGGGCGAGAGGTGCGGGACACCATGTCAGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTACTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAANAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGAAAGTGGGGGAGAAGCTCTTTGGTCCTTATGTATGGGGAAGGTATGATGTACTATTCATGCCACCATCTTTCCCATTTGGTGGAATGGAGAACCCCTGCATCACATTTGTTACCCCATGTCTGCTGGCTGGTGATCGCTCATTGGCTGATG
  5   1   4   10 seed Ovi1 5g3  in                        CABI10295.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGACCTGTAATTGTACAGCGTAGCGGGACACCATGTCAGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTACTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGAAAGTGGGGGAGAAGCTCTTTGGTCCTATGTATG
  3  -1   3        nb Int1      out                       CAAP14858.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGGGCGAGAGGGGGACACCATGTCAGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTACTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGAAAGTGGGGGAGAAGCTCTTTGGTCCTTATGTATGGGGAAGGTATGATGTACTATTCATGCCACCATCTTTCCCATTTGGTGGAATGGAGAACCCCTGCATCACATTTGTTACCCCATGTCTGCTGGCTGGTGATCGCTCATTGGCTGATGGTATCATACACG
  5   1   3   10   nb Int1 5g3  in                         CAAP7066.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGTAGCGGGACACCATGTCAGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTACTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGAAAGTGGGGGAGAAGCTCTTTGGTCCTTATGTATGGGGAAGGTATGATGTACTATTCATGCCACCATCTTTCCCATTTGGTGGAATGGAGAACCCCTGCATCACATTTGTTACCCCATGTCTGCTGGCTGGTGATCGCTCATTGGCTGATGTTATCATA
  5   1   3   10   nb Int1 5g3  in                         CAAP8556.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ACCATGTCAGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTACTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAANAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGANAGTGGGGGAGAAGCTCTTTGGTCCTTATGTATG
  5   1   3        nb In60 5g                         IMAGE:8949458.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCATGTCAGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTGCTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGACACAGCCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATTCAGCAGAGGTACGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATATAAACCAGCTAAAAAGGAGTATGATGGAGTAATTACAGGAGTTCCTGAAAGTTGGGGAGAAAGCTCCTTTTGGTCCTTATGTTATGGGGATAGTATGAATGTA
  5   1   3        nb Int1      in                         CAAP7792.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTACTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAANAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGAAAGTGGGGGAGAAGCTCTTTGGTCTTATGTATGGGGAAGGTATGATGTACTATTCATGC
  5   1   3        nb Int1      in                        CAAP14625.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGTTACCGGGAGTTCCAGCCCGAGCACATGACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTACTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGAAAGTGGGGGAGAAGCTCTTTGGTCCTTATGTATGGGGAAGGTATGATGTACTATTCATGCCACCATCTTTCCCATTTG
  5   1   3        nb Int1      in                         CAAP1267.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTACTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGAAAGTGGGGGAGAAGCTCTTTGGTCCTTATGTATGGGGAAGGTATGATGTACTATTCATGCCACCATCTTTCCCATTTGGTGGAATGGAGAACCCCTGCATCACATTTGTTACCCCATGTCTGCTGGCTGGTGATCGCTCATTGGCTGATGTTATCATACACGAGATTTCACACAGCTGGTTCGGGAACCTGGTCACCAGTGCCAACTGGGGAGA
  5   1   3        nb Int1      in                         CAAP3007.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGGAGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTACTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGAAAGTGGGGGAGAAGCTCTTTGGTCCTTATGTATGGGGAAGGTATGATGTACTATTCATGCCACCATCTTTCCCATTTGGTGGAATGGAGAACCCCTGCATCACATTTGTTACCCCATGTCTGCTGGCTGGTGATCGCTCATTGGCTGATGTTATCATACACG
  5   1   0       chi Tad5      in                         XZT36227.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCGGGAGACCGAGGAGCTGCGACTGGACACACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTACTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGAAAGTGGGGGAGAAGCTCTTTGGTCCTTATGTATGGGGAAGGTCCTGCTTACACTTGCCTGGAAGCAGCTGCTGGAAGAGCCCTGTTACGGCAGCACATGGACTCTTCTGGGGAAGACCACCCTTTGAACAAATTACGAGTAAAGATAGAGCCTGGTATGTATTTGTTAACAAAGATACATAACATCAGATGCTGCATAGTAACATTT
  5   1   2       add In60                            IMAGE:8950380.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTTGATAATTCAAGTTAAATTCATTTGATTCTTAAATCGTCCCCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTACTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGAAAGTGGGGGAGAAGCTCTTTGGTCCTTATGTATGGGGAAGGTATGATGTACTATTCATGCCACCATCTTTCCCATTTGGTGGAATGGAGAACCCCTGCATCACATTTGTTACCCCATGTCTGCTGGCTGGTGATCGCTCATTGGCTGATGTTATCATACACGAGATTTCACACAGCTGGTTCGGGAACCTGGTCACCAGTGCCAACTGGGGAGAATTTTGGCTGAATGAGGGTTTCACAATGTATGCCCACGTAGAATTACTACTGAATTATATGGTCTGCTTACCTGCTGGAAGCAGCTGCTGGAAGAAGCCTGTTACCGCAGCCATGACTCTCTGGGAAGAACATCCTTTGACCATACGAGTAAGGATAAAGCCTGGTGGTGTGATCCGAAGTAGATAT
  5   1   2       ext Ski1      in                         CABJ7447.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTACTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGAAAGTGGGGGAGAAGCTCTTTGGTCCTTATGTATGGGGAAGGTATGATGTACTATTCATGCCACCATCTTTCCCATTTGGTGGAATGGAGAACCCCTGCATCACATTTGTTACCCCATGTCTGCTGGCTGGTGATCGCTCATTGGCTGATGTTATCATACACGAGATTTCACACAGCTGGTTCGGGAACCTGGTCACCAGTGCCAACTGGGGAGAATTTTGGCTGAATGAGGGTTTCACAATGTATGCCCAACGTAGAAATACTACTGAATTATATGGTCCTGCTTACACTTGCCTGGAAGCAGCTGCT
  3  -1   3        nb Int1      in                        CAAP13606.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCTCCGTCTGCCCAGCCTACTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGCCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGAAAGTGGGGGAGAAGCTCTTTGGTCCTTATGTATGGGGAAGGTATGATGTACTATTCATGCCACCATCTTTCCCATTTGGTGGAATGGAGAACCCCTGCATCACATTTGTTACCCCATGTCTGCTGGCTGGTGATCGCTCATTGGCTGATGTTATCATACACGAGATTTCACACAGCTGGTTCGGGAACCTGGTCACCAGTGCCAACTGGGGAGAATTTTGGCTGAATGAGGGTTTCACAATGTATGCCCAACGTAGAATTACTACTGAATTATATGGTCCTGCTTACACTTGCCTGGAAGCAGCTGCTGGAAGAGCCCTGTTACGGCAGCACATGGACTCTTCTGGGGAAGACCACCCTTTGAACAATTACGAGTAAAGATAGAGCCTGGTGTGGATCCAGATG
  5   1   2       add In54                            IMAGE:8946423.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCCCCCCGACGTCACCGGACCCCCCCGCTTCGAATTCGTCCCGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGAAAGTGGGGGAGAAGCTCTTTGGTCCTTATGTATGGGGAAGGTATGATGTACTATTCATGCCACCATCTTTCCCATTTGGTGGAATGGAGAACCCCTGCATCACATTTGTTACCCCATGTCTGCTGGCTGGTGATCGCTCATTGGCTGATGTTATCATACACGAGATTTCACACAGCTGGTTCGGGAACCTGGTCACCAGTGCCAACTGGGGAGAATTTTGGCTGAATGAGGGTTTCACAATGTATGCCCAACGTAGAATTACTACTGAAATTATATGGTCCTGCTTACACTTGCCTGGAAGCAACTGCTGGAAGAGCCCTGTTACGGCAGCACATGGACTTCTTCTGGGGGAGACCACCCTTTGACCAAATTACGAGTAAAGGATAGAGCCTGGTGTGGATCCTGATGATATTAATAATGGGACTCCTACCAGAAAGGTTCTGCTTTGTTTCTTACTTGGCCTACTTCACTGGGGACGAACCAGTTGATGCCATTTTTTAAGGCCCTATGAGAATATAAGATACACGATCTCA
  5   1   2       add In66                            IMAGE:8967196.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTGGGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGACACAGCCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGAAAGTGGGGGAGAAGCTCTTTGGTCCTTATGTATGGGGAAGGTATGATGTACTATTCATGCCACCATCTTTCCCATTTGGTGGAATGGAGAACCCCTGCATCACATTTGTTACCCCATGTCTGCTGGCTGGTGATCGCTCATTGGCTGATGTTATCATACACGAGATTTCACACAGCTGGTTCGGGAACCTGGTCACCAATGCCAACTGGGGAGAATTTTGGCTGAATGAGGGTTTCACAATGTATGCCCAACGTAGAATTACTACTGAATTATATGGTCCTGCTTACACTTGCCTGGAAGCAGCTGCTGGAAGAGCCCTGTTACGGCAGCACATGGACTCTTCTGGGGAAGACCACCCTTTGAACAAATTACGAGTAAAGATAGAGCCTGGTGTGATCAGATGATACTTATAATGAGACTCCCTACGAGAAAGGCTCTGCTTTGTTTCTACTTGCCACCTCACTGGGACGACAGGTTGATGCATTTTAGCTATTGGTGAATAAGTCAGGTCAGAAAGCATC
  5   1   2       add In66                            IMAGE:8964595.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAAACGGTTTATCTTAAATAAATACAATTATAAAACTCCCGCAGGCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGACACAGCCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGAAAGTGGGGGAGAAGCTCTTTGGTCCTTATGTATGGGGAAGGTATGATGTACTATTCATGCCACCATCTTTCCCATTTGGTGGAATGGAGAACCCCTGCATCACATTTGTTACCCCATGTCTGCTGGCTGGTGATCGCTCATTGGCTGATGTTATCATACACGAGATTTCACACAGCTGGTTCGGGAACCTGGTCACCAATGCCAACTGGGGAGAATTTTGGCTGAATGAGGGTTTCACAATGTATGCCCAACGTAGAATTACTACTGAATTATATGGTCCTGCTTACACTTGCCTGGAAGCAGCTGCTGGAAGAGCCCTGTTACGGCAGCACATGGACTCTTCTGGGGAAGACCACCCTTTGAACAAATTACGAGTAAAGATAGAGCCTGGTGTGATCCAGATGATACTTATAATGAGACTCCCTACGAGAAAGGGTTCTGCTTTGTTTCATACTTGTCCACCTCACTGGGGACAGACCAGTTGATGCATTTTAAAGCTATTGTGAATAAGTTCAGTTCAGAGCATTTCTTGTCTTGATTAAAGCCCTTGGAGTTA
  5   1   2       add In63                            IMAGE:8958740.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACCTTCATAATGTATTATCCAGACACAAAATAGAATTCGTCCCCGCCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGAAAGTGGGGGAGAAGCTCTTTGGTCCTTATGTATGGGGAAGGTATGATGTACTATTCATGCCACCATCTTTCCCATTTGGTGGAATGGAGAACCCCTGCATCACATTTGTTACCCCATGTCTGCTGGCTGGTGATCGCTCATTGGCTGATGTTATCATACACGAGATTTCACACAGCTGGTTCGGGAACCTGGTCACCAGTGCCAACTGGGGAGAATTTTGGCTGAATGAGGGTTTTCACAATGTATGCCCAACGTAGAATTACTACTGAATTATATGGTCCTGCTTACACTTGCCTGGAAGCAGCTGCTGGAAGAGCCCTGTTACGGCAGCACATGGACTCTTCTGGGGAAGACCACCCTTTGAACAAATTACGAGTAAAGATAGAGCCTGGTATGTATTTGTTAACAAGATACATAACATCAGATGCTGCATAGTACATTTCTCTCTTTTCTTTCTCTTTTTCATGCAGTGTGAATCCAGATGATACTTATAATGAGACTCCTACGAGAAGGGTTCTGCTTTGTTTTCATACTTGGTCCACCTCACTGGGGGAACAGAACCAAGTTTGGAGGTGGCAT
  5   1   2       add In60                            IMAGE:8948875.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGTTTTTTTATTGAGGCTCAAAACATATTCATAATTCGTCCCCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGAAAGTGGGGGAGAAGCTCTTTGGTCCTTATGTATGGGGAAGGTATGATGTACTATTCATGCCACCATCTTTCCCATTTGGTGGAATGGAGAACCCCTGCATCACATTTGTTACCCCATGTCTGCTGGCTGGTGATCGCTCATTGGCTGATGTTATCATACACGAGATTTCACACAGCTGGTTCGGGAACCTGGTCACCAGTGCCAACTGGGGAGAATTTTGGCTGAATGAGGGTTTCACAATGTATGCCCAACGTAGAATTACTACTGAATTATATGGTCCTGCTTACACTTGCCTGGAAGCAGCTGCTGGAAGAGCCCTGTTACGGCAGCACATGGACTCTTCTGGGGAAGACCACCCTTTGAACAAATTACGAGTAAAGATAGAGCCTGGTGTGGATCCAGATGATACTTATAATGAGACTCCCTACGAGAAAGGGTTCTGCTTTGTTTCATACTTTGGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTCAAGTTCCAGAGCATTCTTGCTGATGAGCCCTTGAGTTTTATCTAGATATTTTCAGAACTGAAGCAATGGAGTGATACGATTTCCGTCTGATTGACATGCTAACCCTTCAAGATGCCTCCTTCCTCCGAACTGTCCCTGAAAGGCACTATGAATAGCAACGACTAGCCACTCTGTTCCTTCCATCTCCCACTTGGAATACGTGA
  5   1   2       ext Neu       in                   TNeu125m13.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATAACTCTGACCGCCATGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGAAAGTGGGGGAGAAGCTCTTTGGTCCTTATGTATGGGGAAGGTATGATGTACTATTCATGCCACCATCTTTCCCATTTGGTGGAATGGAGAACCCCTGCATCACATTTGTTACCCCATGTCTGCTGGCTGGTGATCGCTCATTGGCTGATGTTATCATACACGAGATTTCACACAGCTGGTTCGGGAACCTGGTCACCAGTGCCAACTGGGGAGAATTTTGGCTGAATGAGGGTTTCACAATGTATGCCCAACGTAGAATTACTACTGAATTATATGGTCCTGCTTACACTTGCCTGGAAGCAGCTGCTGGAAGAGCCCTGTTACGGCAGCACATGGACTCTTCTGGGGAAGACCACCCTTTGAACAAATTACGAGTAAAGATAGAGCCTGGTGTGGATCCAGATGATACTTATAATGAGACTCCCT
  5   1   2       ext Tad5      in                         XZT37964.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGACGCGTGGGTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGAAAGTGGGGGAGAAGCTCTTTGGTCCTTATGTATGGGGAAGGTATGATGTACTATTCATGCCACCATCTTTCCCATTTGGTGGAATGGAGAACCCCTGCATCACATTTGTTACCCCATGTCTGCTGGCTGGTGATCGCTCATTGGCTGATGTTATCATACACGAGATTTCACACAGCTGGTTCGGGAACCTGGTCACCAATGCCAACTGGGGAGAATTTTGGCTGAATGAGGGTTTCACAATGTATGCCCAACGTAGAATTACTACTGAATTATATGGTCCTGCTTACACTTGCCTGGAAGCAGCTGCTGGAAGAGCCCTGTTACGGCAGCACATGGACTCTTCTGGGGAAGACCACCCTTTGAACAAATTACGAGTAAAGATAGAGCCTGGTGTGGATCCAGATGATACTTATAATGAGACTCCCTACGAGAAAGGGTTCTGCTTTGTTTCATACTTGGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGANAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCAGACCTGT
  5   1   2       add In54                            IMAGE:8944352.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCCCCTGATATCTAGGACACTCCGATTCGATTCGTCCCGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGAAAGTGGGGGAGAAGCTCTTTGGTCCTTATGTATGGGGAAGGTATGATGTACTATTCATGCCACCATCTTTCCCATTTGGTGGAATGGAGAACCCCTGCATCACATTTGTTACCCCATGTCTGCTGGCTGGTGATCGCTCATTGGCTGATGTTATCATACACGAGATTTCACACAGCTGGTTCGGGAACCTGGTCACCAATGCCAACTGGGGAGAATTTTGGCTGAATGAGGGTTTCACAATGTATGCCCAGCGTAGAATTACTACTGAATTATATGGTCCTGCTTACACTTGCCTGGAAGCAGCTGCTGGAAGAGCCCTGTTACGGCAGCACATGGACTCTTCTGGGGAAGACCACCCTTTGAACAAATTACGAGTAAAGATAGAGCCTGGTGTGGATCCAGATGATACTTATAATGAGACTCCCTACGAGAAAGGGTTCTGCTTTGTTTCATACTTAGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGATATTTTCCAGACTGAAAGCAAAGGGAGTGGATACGATTTCTGGTCTGGATTTGACATTGGCTAACACTCCAGGATGGCTCTTTCTCCCAGACTTGTCCCTGAAAGGCACTTATGAAACACTGCCGACTAGCAAACTCTGGTCTTCTACCACTTGAACTGAATCATATCAAGTTGTATCAA
  5   1   3        nb In66                            IMAGE:8962827.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGGTGCCGCCTTTTTGTTAGACATTTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGAAAGTGGGGGAGAAGCTCTTTGGTCCTTATGTATGGGGAAGGTATGATGTACTATTCATGCCACCATCTTTCCCATTTGGTGGAATGGAGAACCCCTGCATCACATTTGTTACCCCATGTCTGCTGGCTGGTGATCGCTCATTGGCTGATGTTATCATACACGAGATTTCACACAGCTGGTTCGGGAACCTGGTCACCAATGCCAACTGGGGAGAATTTTGGCTGAATGAGGGTTTCACAATGTATGCCCAACGTAGAATTACTACTGAATTATATGGTCCTGCTTACACTTGCCTGGAAGCAGCTGCTGGAAGAGCCCTGTTACGGCAGCACATGGACTCTTCTGGGGAAGACCACCCTTTGAACAAATTACGAGTAAAGATAGAGCCTGGGTGTGGATCCAGATGATACTTATAATGAGACTCCCTACGAGAAAGGGTTCTGCTTTGTTTCATACTTGGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAGCCCTTGAGTTTTATCTAGAATATTTTCAGAACTGAAGCAAGGGAGTGATACGATTATCCGGTCTTGGATTTGACATTGCTAAACACTCCAGATGCTTCATTTCTCCAGACCTGTTCCCTGAGAGCACTTTATGAACAGCACAGAACTTAGCAAACCTTCTGG
  5   1   3        nb BrSp      in                     EC2BBA21CC10.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGAAAGTGGGGGAGAAGCTCTTTGGTCCTTATGTATGGGGAAGGTATGATGTACTATTCATGCCACCATCTTTCCCATTTGGTGGAATGGAGAACCCCTGCATCACATTTGTTACCCCATGTCTGCTGGCTGGTGATCGCTCATTGGCTGATGTTATCATACACGAGATTTCACACAGCTGGTTCGGGAACCTGGTCACCAATGCCAACTGGGGAGAATTTTGGCTGAATGAGGGTTTCACAATGTATGCCCAACGTAGAATTACTACAGAATTATATGGTCCTGCTTACACTTGCCTGGAAGCAGCTGCTGGAAGAGCCCTGTTACGGCAGCACATGGACTCTTCTGGGGAAGACCACCCTTTGAACAAATTACGAGTAAAGATAGAGCCTGGTGTGGATCCAGATGATACTTATAATGAGACTCCCTACGAGAAAGGGTTCTGCTTTGTTTCATACTTGGCCCACCTCACTGGGGACCAGACCAGGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGC
  3  -1   3        nb Int1                                 CAAP2194.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAAAAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGAAAGTGGGGGAGAAGCTCTTTGGTCCTTATGTATGGGGAAGGTATGATGTACTATTCATGCCACCATCTTTCCCATTTGGTGGAATGGAGAACCCCTGCATCACATTTGTTACCCCATGTCTGCTGGCTGGTGATCGCTCATTGGCTGATGTTATCATACACGAGATTTCACACAGCTGGTTCGGGAACCTGGTCACCAGTGCCAACTGGGGAGAATTTTGGCTGAATGAGGGTTTCACAATGTATGCCCAACGTAGAATTACTACTGAATTATATGGTCCTGCTTACACTTGCCTGGAAGCAGCTGCTGGAAGAGCCCTGTTACGGCAGCACATGGACTCTTCTGGGGAAGACCACCCTTTGAACAAATTACGAGTAAAGATAGAGCCTGGTGTGGATCCAGATGATACTTATAATGAGACTCCCTACGAGAAAGGGTTCTGCTTTGTTTCATACTTGGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCCAGCACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCC
  5   1   2       add Liv1      in                        CAAR11589.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTTGGTCCTTATGTATGGGGAAGGTATGATGTACTATTCATGCCACCATCTTTCCCATTTGGTGGAATGGAGAACCCCTGCATCACATTTGTTACCCCATGTCTGCTGGCTGGTGATCGCTCATTGGCTGATGTTATCATACACGAGATTTCACACAGCTGGTTCGGGAACCTGGTCACCAGTGCCAACTGGGGAGAATTTTGGCTGAATGAGGGTTTCACAATGTATGCCCAACGTAGAATTACTACTGAATTATATGGTCCTGCTTACACTTGCCTGGAAGCAGCTGCTGGAAGAGCCCTGTTACGGCAGCACATGGACTCTTCTGGGGAAGACCACCCTTTGAACAAATTACGAGTAAAGATAGAGCCTGGTATGTATTTGTTAACAAAGATACATAACATCAGATGCTGCATAGTAACATTTCTCCTCTTTTCTTTCTCTTTTTCAATTGGCAGGTGTGGATCCAGATGATACTTATAATGAGACTCCCTACGAGAAAGGGTTCTGCTTTGTTTCATACTTGGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCA
  5   1   3        nb Tad5                                 XZT11037.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TATAGAGGATTCCTGAAGTGGGGGAGAAGCTCTTTGGTCCTTATGTATGGGGAAGGTATGATGTACTATTCATGCCACCATCATTCCCATTTGGTGGAATGGAGAACCCCTGCATCACATTTGTTACCCCATGTCTGCTGGCTGGTGATCGCTCATTGGCTGATGTTATCATACACGAGATTTCACACAGCTGGTTCGGGAACCTGGTCACCAATGCCAACTGGGGAGAATTTTGGCTGAATGAGGGTTTCACAATGTATGCCCAACGTAGAATTACTACTGAATTATATGGTCCTGCTTACACTTGCCTGGAAGCAGCTGCTGGAAGAGCCCTGTTACGGCAGCACATGGACTCTTCTGGGGAAGACCACCCTTTGAACAAATTACGAGTAAAGATAGAGCCTGGTGTGGATCCAGATGATACTTATAATGAGACTCCCTACGAGAAAGGGTTCTGCTTTGTTTCATACTTGGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAGACTATNTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGC
  5   1   3        nb Gas7      in                         XZG20811.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAGCTCTTTGGTCCTTATGTATGGGGAAGGTATGATGTACTATTCATGCCACCATCTTTCCCATTTGGTGGAATGGAGAACCCCTGCATCACATTTGTTACCCCATGTCTGCTGGCTGGTGATCGCTCATTGGCTGATGTTATCATACACGAGATTTCACACAGCTGGTTCGGGAACCTGGTCACCAATGCCAACTGGGGAGAATTTTGGCTGAATGAGGGTTTCACAATGTATGCCCAACGTAGAATTACTACTGAATTATATGGTCCTGCTTACACTTGTCTGGAAGCAGCTGCTGGAAGAGCCCTGTTACGGCAGCACATGGACTCTTCTGGGGAAGACCACCCTTTGAACAAATTACGAGTAAAGATAGAGCCTGGTGTGGATCCAGATGATACTTATAATGAGACTCCCTACGAGAAAGGGTTCTGCTTTGTTTCATACTTGGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGANAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCT
  5   1   2       add In66                            IMAGE:8966301.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTTATCGTATGGGGAAGGTATGATGTACTATTCATGCCACCATCTTTCCCATTTGGTGGAATGGAGAACCCCTGCATCACATTTGTTACCCCATGTCTGCTGGCTGGTGATCGCTCATTGGCTGATGTTATCATACACGAGATTTCACACAGCTGGTTCGGGAACCTGGTCACCAATGCCAACTGGGGAGAATTTTGGCTGAATGAGGGTTTCACAATGTATGCCCAACGTAGAATTACTACTGAATTATATGGTCCTGCTTACACTTGCCTGGAAGCAGCTGCTGGAAGAGCCCTGTTACGGCAGCACATGGACTCTTCTGGGGAAGACCACCCTTTGAACAAATTACGAGTAAAGATAGAGCCTGGTGTGGATCCAGATGATACTTATAATGAGACTCCCTACGAGAAAGGGTTCTGCTTTGTTTCATACTTGGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAGTTGATCCCACATATGGAGGACTATCAGCTTGTCTACTTTTTGGATAGAGTACTGAGTTGTCACCCACTGCCTGATGAAATGTTCGACCACTGAAAGTATATCAAAGAATTTCCCATGCTACAATGCTGACTGCGATGCCTGCCAATTGTATGGAGATGGACTATCAAGCCTCCCACTTTCTATAAAGACTTC
  5   1   3        nb Mus1      in                        CABH11946.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGCCACCATCTTTCCCATTTGGTGGAATGGAGAACCCCTGCATCACATTTGTTACCCCATGTCTGCTGGCTGGTGATCGCTCATTGGCTGATGTTATCATACACGAGATTTCACACAGCTGGTTCGGGAACCTGGTCACCAGTGCCAACTGGGGAGAATTTTGGCTGAATGAGGGTTTCACAATGTATGCCCAACGTAGAATTACTACTGAATTATATGGTCCTGCTTACACTTGCCTGGAAGCAGCTGCTGGAAGAGCCCTGTTACGGCAGCACATGGACTCTTCTGGGGAAGACCACCCTTTGAACAAATTACGAGTAAAGATAGAGCCTGGTGTGGATCCAGATGATACTTATAATGAGACTCCCTACGAGAAAGGGTTCTGCTTTGTTTCATACTTGGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATGTATTGAAGATGACTATCAGCTCCACTTTCATAAAGTCAGG
  5   1   3        nb Spl2      in                        CBSS3817.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGTAGAATTACTACTGAATTATATGGTCCTGCTTACACTTGCCTGGAAGCAGCTGCTGGAAGAGCCCTGTTACGGCAGCACATGGACTCTTCTGGGGAAGACCACCCTTTGAACAAATTACGAGTAAAGATAGAGCCTGGTGTGGATCCAGATGATACTTATAATGAGACTCCCTACGAGAAAGGGTTCTGCTTTGTTTCATACTTGGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGNCAGCTGGCTCAAGGCAGCACAGGACCTC
  5   1   0       chi Brn4                                CAAL10860.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCATGCTCTGCCTGCCCTATAAACAACAAATAAATGAACAAACAAAACAATCCCTGCCCTTCAGAATGCAGACCAGCACTGATAGTTTTCTTACTAATCTGGCCACCGGCCAGCCGGGAAAGGATTGTTGTACACAGCTTCAGGAGAGAGGTGAAATCGGTTAATTTAAAGAAACAATAAATTTCTAATTGAAGCACATTGCAAATACGTTTCTTTTTAGGTTTACAATCCTTACATGCAATATTGTTTTTTTGCCTTTACAGATTACAGTCTAAATGCATAATATATTAATTCTGGACAAATTGTAGCAATAAGTTTGCAACAACCTTTTTCTCTGATAGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCGGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCANAGGCAGCACAGGACCTCGCTAGGGAG
  5  -1   0       chi Int1      in                         CAAP7329.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTTGCTGAAATATAATTACATTCTTCTGTATGTGTGGCTTTTACTAATCTAGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTNTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGTAAGAATTTGTGGATGGGCCTACTAAGTAAAAACTATTTTTTCATGGGTTGCATGTATGTAGCATCTTGGACCTGGAGGAACGCTGTTTCGTTTCACTGTGTACTGTACTGTATATGGTTGAAATGACAATAAAAACCTACTTGACTTGACTTGAAAGTGCAGTATACCATAGTTAATTCTATAGTTGATGGAATGGTATATTATTTATAATGCACTTCAAACTGATTTACCTGTGCTGTGTTTTCATATGTATCTCTGTTAATTAGGAAGACATTATTAATAAACACTTATTTTATAATGTAAAAGCATAACGATAATATATAACATAATGATATAACATACAAAGTGATCTGAGTTTTGAGAGATTTGACACTGACTTATTATTGTGATGAGAATACTTCTTCTGATTTGTAATCTTCTCCCTAAACCAATCTGTATTCTCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTA
  3   1   3        nb Int1 5g3  in                         CAAP7066.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTGAACAAATTACGAGTAAAGATAGAGCCTGGTGTGGATCCAGATGATACTTATAATGAGACTCCCTACGAGAAAGGGTTCTGCTTTGTTTCATACTTGGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTAC
  3   1   3        nb Int1 5g3  in                         CAAP8556.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAACAAATTACGAGTAAAGATAGAGCNTGGTGTGGATCCAGATGATATTTATAATGAGACTCCCTACGAGAAAGGGTTCTGCTTTGTTTCATACTTGGCCCACCTCACTGGGGACCAGACCAAGTNTGATGCATTNTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATA
  3   1   3        nb Int1      in                         CAAP1267.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTACGAGTAAAGATAGAGCCTGGTGTGGATCCAGATGATACTTATAATGAGACTCCCTACGAGAAAGGGTTCTGCTTTGTTTCATACTTGGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTAAA
  3   1   2       ext Neu       in                    TNeu125m13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAAAGATAGAGCCTGGTGTGGATCCAGATGATACTTATAATGAGACTCCCTACGAGAAAGGGTTCTGCTTTGTTTCATACTTGGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGGTCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAAAATGCAATAAACCAAAATAAACATCAAAAAAAAAAAAAAAAAA
  5  -1   3        nb Int1      out                       CAAP13205.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGTGTGGATCCAGATGATACTTATAATGAGACTCCNTACGAGAAAGGGTTCTGCTTTGTTTCATACTTGGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAG
  3  -1   0       chi Int1      in                         CAAP7329.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAAACTAGCTTGTATTGATAAGTCTTTATAATAGAATAAAAAATATAAAAACATATTTGTAAAAGGCATCTGGGCTGGTAAAGTGCAGTATTCTATCAGCATCTTCCACAACAACAAAAAAAAACAAAAATTGGGAACATTATTCCTTATGGGGCTATACACACTTGAATATGGAGTTAAAACAAGCAGAAAAGAAATGCACTCACTGAGATATATGTTCCTCTGTGTGTGTTGCTTTACAAGGCATAATATGCCTCATACTGAATTGTACAGACCCTTATAAATTCATTTATAATGCCTTTCTAGGCATACATTATATATTTTTACCTATAAGTATTTCTGCAGGTCTTTATAGTAGCACTATTAATGTTTGCTGAAATATAATTACATTCTTCTGTATGTGTGGCTTTTACTAATCTAGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGTAAGAATTTGTGGATGGGCCTACTAAGTAAAAACTATTTTTTCATGGGTTGCATGTATGTAGCATCTTGGACCTGGAGGAACGCTGTTTCGTTTCACTGTGTACTGTACTGTATATGGTTGAAATGACAATAAAAACCTACTTGACTTGACTTGAAAGTGCAGTATACCATAGTTAATTCTATAGTTGATGGAATGGTATATTATTTATAATGCACTTCAAACTGATTTACCTGTGCTGTGTTTTCATATGTATCTCTNGTAATTAGGAAGACATTATTAATAAACACTTATTTTANATGTAAAAGGCTAACGATAATATA
  3   1   2       ext Ski1      in                         CABJ7447.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGAAAGGGTTCTGCTTTGTTTCATACTTGGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAAAATGCAATAAACCAAAATAAACATC
  5  -1   3        nb Fat1      in                         CABC2253.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGAAAGGGTTCTGCTTTGTTTCATACTTGGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAAAATGCAATAAACCAAAATAAACATC
  3   1   2       ext Tad5      in                         XZT37964.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGGGTTCTGCTTTGTTTCATACTGGGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAAAATGCAATAAACCAAAATAACCTTC
  5  -1   2       ext Int1      in                        CAAP12427.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCTTTGTTTCATACTTGGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAAAATGCAATAAACCAAAATAAACATCAAAAA
  5  -1   3        nb Int1      in                        CAAP13606.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCTTTGTTTCATACTTGGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTTTCCTCGTGCCGATTG
  3   1   2       add Int1      in                        CAAP13929.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCTTTGTTTCATACTTGGCCCACCTCACTGGGGACCAGACCAAGTNTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCCTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAAAATGCAATAAACCAAAATAAACATC
  3   1   3        nb Hrt1      out                         CAAQ714.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCTTTGTTCATACTTTGGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAAAATGCAATAAACCAAAATAAACATC
  3   1   2       add Lun1      out                        CABD8227.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATAGGAATAAAAAATATAAAAACATATTTGTAAAAGGCATCTGGGCTGGTAAAGTGCAGTATTCTATCAGCATCTTCCACAACAACAAAAAAAAACAAAAATTGGGAACATTATTCCTTATGGGGCTATACACACTTGAATATGGAGTTAAAACAAGCAGAAAAGAAATGCACTCACTGAGATATATGTTCCTCTGTGTGTGTTGCTTTACAAGGCATAATATGCCTCATACTGAATTGTACAGACCCTTATAAATTCATTTATAATGCCTTTCTAGGCATACATTATATATTTTTACCTATAAGTATTTCTGCAGGTCTTTATAGTAGCACTATTAATGTTTGCTGAAATATAATTACATTCTTCTGTATGTGTGGCTTTTACTAATCTAGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAAAATGCAATAAACCAAAATAAACATC
  3   1   3        nb Liv1 5g3  in                        CAAR12979.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCACTGGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAAAATGCAATAAACCAAAATAAACATC
  3   1   4      seed Ovi1 5g3  in                        CABI10295.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAAAATGCAATAAACCAAAATAAACATC
  3   1   2       ext Te5  5g3  in                        CAAO11062.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAAAATGCAATAAACCAAAATAAACATC
  3   1   2       add Int1      in                         CAAP8916.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAAAATGCAATAAACCAAAATAAACATC
  3   1   3        nb Mus1      in                        CABH11946.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGACCAAGTTTGATGCATTTTTAAAGGCTNATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAAAATGCAATAAACCAAAATAAACATC
  3   1   3        nb Abd0 5g3  in                       IMAGE:6999794                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      NCCAAGTTTTGATGCATTTTTAAAGGCCTNATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTCCCACACTGTC
  3   1   3        nb Int1      in                        CAAP14625.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGACCAAGTTTGATGCATTTTAAAGGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAAAATGCAATAAACCAAAATAAACATCAAAAAAA
  3   1   2       add Liv1      in                        CAAR11589.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAAAATGCAATAAACCAAAATAAACATC
  3   1   3        nb Spl2      in                        CBSS3817.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGTNTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAAAATGCAATAAACCAAAATAAACATC
  3   1   2       ext Ski1 5g3  in                         CABJ9527.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAAAATGCAATAAACCAAAATAAACATC
  3   1   3        nb Int1      in                         CAAP7792.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTCCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAA
  5  -1   2       ext Lun1      in                         CABD2048.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAAAATGCAATAAACCAAAATAAACATC
  3   1   2       add Tad5      in                         XZT36227.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAAAATGCAATAAACCAAAATAAACATCAAAAAAAAAAAAAAAGG
  5   1   0       chi Liv1                                 CAAR9892.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGTGAGAGCTTATGTGTGGTATCCAAATGAATTGATTTCTTGTTTCTTCACTCTGAGTTATATGGACATAGAGATTTAAATTACTTAGAGCAGTAACATACTCCTTTGGCGGGGAACCACATTTAATTTGGTTTACAAAAAACTAGCTTGTATTGATAAGTCTTTATAATAGAATAAAAAATATAAAAACATATTTGTAAAAGGCATCTGGGCTGGTAAAGTGCAGTATTCTATCAGCATCTTCCACAACAACAAAAAAAAACAAAAATTGGGAACATTATTCCTTATGGGGCTATACACACTTGAATATGGAGTTAAAACAAGCAGAAAAGAAATGCACTCACTGAGATATATGTTCCTCTGTGTGTGTTGCTTTACAAGGCATAATATGCCTCATACTGAATTGTACAGACCCTTATAAATTCATTTATAATGCCTTTCTAGGCATACATTATATATTTTTACCTATAAGTATTTCTGCAGGTCTTTATAGTAGCACTATTA
  3   1   3        nb Gas7      in                         XZG20811.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCGGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCTCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAAAATGCAATAAACCAAAATAAACATC
  3   1   3        nb Int1      in                         CAAP3007.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAAAATGCAATAAACCAAAATAAACATC
  3   1   3        nb Limb 5g3  in                        CBSU6448.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAAAATGCAATAAACCAAAATAAACATC
  3   1   3        nb Eye  5g3  in                         CCAX8944.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAAAATGCAATAAACCAAAATAAACATC
  3   1   3        nb BrSp      in                     EC2BBA21CC10.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCAAAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTAC
  3   1   3        nb Gas0                                 dad46e07.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCTTCCCAGACCTTGTCCCTGGAGAGGCACTTATGAAACCAGCAATAGAACTAGCAAACCTCTGGTCTTCTATTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCCCAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGATGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAAAATGCAATAAACCAAAATAAACATCAAAAAAA
  3   1   3        nb Gas1 FL   in                    IMAGE:5308559.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTCCCCTGGAGAGGCACTTATGAAACCAGCAGCAGAACTAGCAAACCTCTGGTCTTCTACACCACTTGACACTGAAATTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCATCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGTTAGGGAGACCTTTACGCAAACTTGCCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAAAATGCAATAAGCCAAAAAAAAAAAAAAAAAAAAAAAAAG
  5   1   2  SIG                                      Xt7.1-CABG9677.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTACTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAANAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGANAGTGGGGGAGAAGCTCTTTGGTCCTTATGTATGGGGAAGGTATGATGTACTATTCATGCCACCATCTTTCCCATTTGGTGGAATGGAGAACCCCTGCATCACATTTGTTACCCCATGTCTGCTGGCTGGTGATCGCTCATGGGCTGATGTTAT------------CAGTACTGTCTATGCATGTTTACAGGTCCTGCTTACACTTGCCTGGAAGCAGCTGCTGGAAGAGCCCTGTTACGGCAGCACATGGACTCTTCTGGGGAAGACCACCCTTTGAACAAATTACGAGTAAAGATAGAGCCTGGTATGTATTTGTTAACAAAGATACATAACATCAGATGCTGCATAGTAACATTTCTCCTCTTTTCTTTCTCTTTTTCAATTGGCAGGTGTGGATCCAGATGATACTTATAATGAGACTCCCTACGAGAAAGGGTTCTGCTTTGTTTCATACTTGGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAAAATGCAATAAACCAAAATAAA
                                                  Xt7.1-CHK-1008279112                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTACTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAANAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGANAGTGGGGGAGAAGCTCTTTGGTCCTTATGTATGGGGAAGGTATGATGTACTATTCATGCCACCATCTTTCCCATTTGGTGGAATGGAGAACCCCTGCATCACATTTGTTACCCCATGTCTGCTGGCTGGTGATCGCTCATGGGCTGA------------------------TGTCTATGCATGTTTACAGGTCCTGCTTACACTTGCCTGGAAGCAGCTGCTGGAAGAGCCCTGTTACGGCAGCACATGGACTCTTCTGGGGAAGACCACCCTTTGAACAAATTACGAGTAAAGATAGAGCCTGGTATGTATTTGTTAACAAAGATACATAACATCAGATGCTGCATAGTAACATTTCTCCTCTTTTCTTTCTCTTTTTCAATTGGCAGGTGTGGATCCAGATGATACTTATAATGAGACTCCCTACGAGAAAGGGTTCTGCTTTGTTTCATACTTGGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAAAATGCAATAAACCAA
  5   1   4   10 seed Int1 5g3  in                        CAAP14932.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGCCAGAGGCAGGACGGCGGAAGATGTAGCCACAGCTTCCAGTTACCGGGAGTTCCAGCCCGAGCACATGCACCTGGAGCTGACAGTAGACACAGAGGCTCGAATACTGCGGGGCTCCCAGCGGCTGGACGTGCAGGTGTTGCGGGAGACCGAGGAGCTGCGACTGGACACTCACCGCTGCTTGCGAGTGCTGGGAGCTCGGCTGGAGAAGGGCCAGGGGGAACATGAGGAGTTGTCGTGGGAGGAAAAGCCTTTCACACGCTATGGCACTATGGTGGTTCTCCGTCTGCCCAGCCTACTGCCCCCCGGAGCCAGGGTTCGGGTGATACTCGATTATGAGGCAGCGGATAGCCCAGGGGTTTGTTGGTTGGACCCACAGCAGACTGCAGGCAAGAAGAAGCCTTACATGTACACGCAAGGCCAGGCTGTTTTGAACCGCTCCTTCTTCCCATGCTTTGACACACCGGCTGTTAAATGCACCTATTCTGCCAATGTCAAGGTGCCTGAAGGTTTTACAGCTGTTATGAGTGCAAATAACTCTGACCGCCAAGGGGATACTTTTAAATTCGAGATGGCACAACCTATTCCAGCATATCTGGTGGCTCTGGTGGTTGGTGACATTGTATCAGCAGAGGTAGGACCAAGGAGCCGTGTGTGGGCCGAGCCTTGTCTTATAGAAGCAGCTAANAAGGAGTATGATGGAGTAATAGAGGAGTTCCTGANAGTGGGGGAGAAGCTCTTTGGTCCTTATGTATGGGGAAGGTATGATGTACTATTCATGCCACCATCTTTCCCATTTGGTGGAATGGAGAACCCCTGCATCACATTTGTTACCCCATGTCTGCTGGCTGGTGATCGCTCATGGGCTGATGTTATCATA
  5   1   2   10  ext Int1 5g3  in                         CAAP2544.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTTTCAGTACTGTCTATGCATGTTTACAGGTCCTGCTTACACTTGCCTGGAAGCAGCTGCTGGAAGAGCCCTGTTACGGCAGCACATGGACTCTTCTGGGGAAGACCACCCTTTGAACAAATTACGAGTAAAGATAGAGCCTGGTATGTATTTGTTAACAAAGATACATAACATCAGATGCTGCATAGTAACATTTCTCCTCTTTTCTTTCTCTTTTTCAATTGGCAGGTGTGGATCCAGATGATACTTATAATGAGACTCCCTACGAGAAAGGGTTCTGCTTTGTTTCATACTTGGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTC
  3  -1   2       ext Int1      in                        CAAP10262.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTTGCCTGGAAGCAGCTGCTGGAAGAGCCCTGTTACGGCAGCACATGGACTCTTCTGGGGAAGACCACCCCTTTGAACAAATTACGAGTAAAGATAGAGCCTGGTATGTATTTGTTAACAAAGATACATAACATCAGATGCTGCATAGTAACATTTCTCCTCTTTTCTTTCTCTTTTTCAATTGGCAGGTGTGGATCCAGATGATACTTATAATGAGACTCCCTACGAGAAAGGGTTCTGCTTTGTTTCATACTTGGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGT
  5  -1   2       ext Int1      in                        CAAP10262.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTGCCTGGAAGCAGCTGCTGGAAGAGCCCTGTTACGGCAGCACATGGACTCTTCTGGGGAAGACCACCCTTTGAACAAATTACGAGTAAAGATAGAGCCTGGTATGTATTTGTTAACAAAGATACATAACATCAGATGCTGCATAGTAACATTTCTCCTCTTTTCTTTCTCTTTTTCAATTGGCAGGTGTGGATCCAGATGATACTTATAATGAGACTCCCTACGAGAAAGGGTTCTGCTTTGTTTCATACTTGGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGT
  5   1   2       ext Sto1      in                         CABG9677.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGCACATGGACTCTTCTGGGGAAGACCACCNCTTTGAACAAATTACGAGTAAAGATAGAGCCTGGTATGTATTTGTTAACAAAGATACATAACATCAGATGCTGCATAGTAACATTTCTCCTCTTTTCTTTCTCTTTTTCAATTGGCAGGTGTGGATCCAGATGATACTTATAATGAGACTCCCTACGAGAAAGGGTTCTGCTTTGTTTCATACTTGGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTA
  3   1   4      seed Int1 5g3  in                        CAAP14932.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GATGCTGCATAGTAACATTTCTCCTCTTTTCTTTCTCTTTTCAAATGGCAGGGTGTGGATCCAGATGATACTTATAATGAGACTCCCTACGAGAAAGGGTTCTGCTTTGTTTCATACTTGGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTNTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAAAATGCAATAAACCA
  3   1   2       ext Sto1      in                         CABG9677.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATAGTAACATTTCTCCTCTTTTCTTTCTCTTTTTCAATTGCCAGGTGTGGATCCAGATGATACTTATAATGAGACTCCCTACGAGAAAGGGTTCTGCTTGTTTCATACTTGGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTACCACACTTGTTCAGACTGAAAATGCAATAAACCAAAATAAACATC
  3   1   2       ext Int1 5g3  in                         CAAP2544.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATCCAGATGATACTTATAATGAGACTCCCTACGAGAAAGGGTTCTGCTTTGTTTCATACTTGGCCCACCTCACTGGGGACCAGACCAAGTTTGATGCATTTTTAAAGGCCTATGTGAATAAGTTCAAGTTCCAGAGCATTCTTGCTGATGAAGCCCTTGAGTTTTATCTAGAATATTTTCCAGAACTGAAAGCAAAGGGAGTGGATACGATATCCGGTCTGGAATTTGACCATTGGCTAAACACTCCAGGATGGCCTCCTTTCCTCCCAGACCTGTCCCCTGGAGAGGCACTTATGAAACCAGCAACAGAACTAGCAAACCTCTGGTCTTCTACTCCACTTGATACTGAAACTATTTCAAAAGTTGATCCCACAATATGGAGGACCTATCAGCTTGTCTACTTTTTGGATAGAGTACTTGAGTTGTCACCACTGCCTGATGGAAATGTCGAACAACTGGAAAAGTATTATCCAAAGATTTCCAATGCTACAAATGCTGAGCTGCGTTTGCGCTGGGCCCAGATTGTATTGAAGAATGACTATCAGCTCCACTTTCATAAAGTCAGGGACTTTCTCCATTGCCAGGGGAAGCAGAAGTATACTTTACCTTTATACCGTGCCATGCAAGCTGGCTCAAAGGCAGCACAGGACCTCGCTAGGGAGACCTTTACGCAAACTTGTCCACAGCTTCATGCCAATGTGCAGAACTATGTAAAGAGGATCCTAGGAACATAGAGTTGCACATCTGCACAATGAGAGCGCATATAGAGCATTGCAGATCATTGTCCAGCTACAGAATGGAAGTGTAATCAACATACTGTCCCACACTTGTTCAGACTGAAAATGCAATAAACCAAAATAAACATC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)