Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TGas068a09.5                          2 END     2           3      100                (no blast hit)

 This cluster: approximate FL confidence score = 92%

 1012071904 Xt7.1-TTbA039b13.5.5 - 65 ESTs
                                                                       ..-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TTbA039b13.5.5             TAGAGTCAGCAATTGGAGAACACGGGGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACACTTTCCAGGACCAGCTTCTGCCATAAAGCAAGGATTTCAATAGCTTGTATACAACATCATGATGGTGGATTTTGGATATGCAGAAGCAGCGCAGAGGTCGCTTAGAAAATGGAGGACTGTTGGTCAAGAAGAACAACTATGCTGAATTGCACATTGCGATGAGTATCAAGAAGGAAGATGAAACATGAAATTAAGGAGGGTTGGAAAATAGTTCAGGCTGCCATTTGAAATGGGAAATATATATTCTGGCTAATGCATTGGGGTTTTAATTTTGTTCTAAATTCATAAAATGTTAAATTATTGTTTATTTATGCAACTATACTTTAATGTATTCTTTAGGAAACTGGTACACTGACATTTTTATGCATAAAGTTTTTGAGACAAATGAAATGTTTTTAAGTTTTTTTTTTGTTTTTTTTTTACAATAAAGCTTT
                                                  Xt7.1-CHK-1008224638                   CAGCAATTGGAGAACACGGGGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACACTTTCCAGGACCAGCTTCTGCCATAAAGCAAGGATTTCAATAGCTTGTATACAACATCATGATGGTGGATTTTGGATATGCAGAAGCAGCGCAGAGGTCGCTTAGAAAATGGAGGACTGTTGGTCAAGAAGAAGAACTATGCTGAATTGCACxxxxCxATGAGTATCAAGxAxGAxGATGAAACATGAAATTAAGGAGGGTTGGAAAATAGTTCAGGCTGCCATTTGAAATGGGAAATATATATTCTGGCTAATGCATTGGGGTTTTAATTTTGTTCTAAATTCATAAAATGTTAAATTATTGTTTATTTATGCAACTATACTTTAATGTATTCTTTAGGAAACTGGTACACTGACATTTTTATGCATAAAGTTTTTGAGACAAATGAAATGTTTxxxxxTTTTTTTTTTGTTTTTTTTTTACAATAAAGCTTTTTGAAT
                                                      consensus depths                  4     4    18    23    26    27    29    30    29    30    31    32    32    33    32    33    34    35    33    36    34    37    33    38    34    38    35    38    35    38    35    38    35    38    36    41    37    43    37    44    38    44    37    44    39    44    39    45    38    46    39    47    41    48    44    49    44    49    46    53    47    52    47    53    47    53    46    53    46    53    46    53    46    54    47    54    45    54    46    54    46    53    46    55    46    55    46    55    45    56    45    57    44    55    45    56    44    55    44    55    42    53    42    53    41    55    42    54    41    53    37    49    35    48    28    40    24    36    18    33    18    33    16    31    16    31    13    28    13    26    13    26    13    26    13    26    12    25    11    25    10    24     8    22     7    20     7    20     5    17     6    17     7    16     7    16     7    16     7    16     7    16     7    16     7    16     7    18     7    18     7    18     7    18     7    18     7    18     7    18     6    18     7    16     6    17     4    16     7    14     5    14     3    14
  5   1   2  SIG                                    Xt7.1-TTbA039b13.5             TAGAGTCAGCAATTGGAGAACACGGGGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACACTTTCCAGGACCAGCTTCTGCCATAAAGCAAGGATTTCAATAGCTTGTATACAACATCATGATGGTGGATTTTGGATATGCAGAAGCAGCGCAGAGGTCGCTTAGAAAATGGAGGACTGTTGGTCAAGAAGAACAACTATGCTGAATTGCACATTGCGATGAGTATCAAGAAGGAAGATGAAACATGAAATTAAGGAGGGTTGGAAAATAGTTCAGGCTGCCATTTGAAATGGGAAATATATATTCTGGCTAATGCATTGGGGTTTTAATTTTGTTCTAAATTCATAAAATGTTAAATTATTGTTTATTTATGCAACTATACTTTAATGTATTCTTTAGGAAACTGGTACACTGACATTTTTATGCATAAAGTTTTTGAGACAAATGAAATGTTTTTAAGTTTTTTTTTTGTTTTTTTTTTACAATAAAGCTTT
  5   1   2  SIG                                      Xt7.1-XZG57742.5                                                                                                         CCACGCGTCCGAGAGTCAGCAATTGGAGAACACGGGGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACACTTTCCAGGACCAGCTTTTGCCATAAAGCAAGGATTTCAATAGCTTGTATACAACATCATGATGGTGGATTTTGGATATGCAGAAGCAGCGCAGAGGTCGCTTAGAAAATGGAGGACTGTTGGTCAAGAAGAACTATGCTGAATTGCACATTGCGCCAATGAGTATCAAGGAAGATGAAACATGAAATTAAGGAGGGTTGGAAAATAGTTCAGGCTGCCATTTGAAATGGGAAATATATATTCTGGCTAATGCATTGGGGTTTTAATTTTGTTCTAAATTCATAAAATGTTAAATTATTGTTTATTTATGCAACTATACTTTAATGTATTCTTTAGGAAACTGGTACACTGACATTTTTATGCATAAAGTTTTTGAGACAAATGAAATGTTTTTAAGTTTTTTTTTTTTGTTTTTTTTTTACAATAAAGCTTTTTGAATTGAATAAAAAAAAAAAAAAAAAAAA
                                                                   VAR                                                                                                                                                 CGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAG
                                                                   VAR                                                                                                                                                                                                                                                                                                             GTTCGTGTGTTGCTGCTGTTGCGAGGACTTGCCTGGGTCAGAAAGGGGTTTGTGGGGTCAGCCAAAAGCATTGCGCAAAATGGTAGTTTGGTGTGAACAGATGCCTTCCATGCACCCATCTGCGCTGTGGGCACTTGCACCTCCTCTTGGGGTCGGTGGGTGCTACATCACAACGGCCCATGTAATCATTTTGTTACAACGACCAATAGCATAGCCGCCCCGGTTGCCCCTTACTGCAGCAGGGATCATTTTGTCATGAGGTGCATTCGCCCTATGGCCCCTTGCCCCTGGGCTTCTGTTCCTTTTAAACTGTGGCCTTCCTGCTTGTATAGGACTTCAGCTCCCAGC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGGACTGAGTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACTTTCAAGAAGAAAAGTAAAAACACTTTCCAGGACCAGCTTCTGCCATAAAGCAAGGATTTCAATAGCTTGTATACAACATCATGATGGTGGATTTTGGATATGCAGAAGCAGCGCAGAGGTCGCTTAGAAAATGGAGGACTGTTGGTCAAGAAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TATGCTGAATTGCACATTGCGCCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCAATGAGTATC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGATGAAACATGAAATTAAGGAGGGTTGGAAAATAGTTCAGGCTGCCATTTGAAATGGGAAATATATATTCTGGCTAATGCATTGGGGTTTTAATTTTGTTCTAAATTCATAAAATGTTAAATTATTGTTTATTTATGCAACTATACTTTAATGTATTCTTTAGGAAACTGGTACACTGACATTTTTATG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                     AA----------
                                               BLH ATG     168     528             
                                               BLH MIN     168      54             
                                               BLH MPR     132      54             
                                               BLH OVR     168      90             
                                               CDS MIN     168      54             
                                               EST CLI       4      50             
                                               ORF LNG     168       3             
                                                                                                                                                                                                                                                                       PROTEIN --- Bb ==== 5e-007     AAL79538.1 40S ribosomal protein S12 [Branchiostoma belcheri] ====================================================================================================================================================================================================================================
                                                                                                                                                                                                                       PROTEIN --- Dm ---- 2e-010     NP_610264.1 CG11086-PA [Drosophila melanogaster] ----------===========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                           PREDICTED = Dr ==== 7e-052     NP_956870.1 hypothetical protein MGC65993 [Danio rerio] ================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                           PROTEIN === Gg ==== 3e-058     NP_001038143.1 growth arrest and DNA-damage-inducible, alpha [Gallus gallus] ===========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                           PROTEIN === Mm ==== 4e-058     NP_031862.1 growth arrest and DNA-damage-inducible 45 alpha; growth arrest andDNA-damage-inducible, alpha; Gadd45alpha; DNA-damage inducible transcript 1 [Musmusculus] ================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                           PROTEIN === Hs ==== 7e-060     NP_001915.1 growth arrest and DNA-damage-inducible, alpha; DNA-damage-inducible transcript1; DNA damage-inducible transcript-1; DNA damage-inducible transcript 1 [Homosapiens] ========================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                           PREDICTED = Xl ==== 3e-082     AAH44046.1 Similar to growth arrest and DNA-damage-inducible, alpha [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                           PROTEIN === ?? ==== 3e-082     NP_001079537.1 similar to growth arrest and DNA-damage-inducible, alpha [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                           PROTEIN === Xt ==== 4e-087     AAI21533.1 Growth arrest and DNA-damage-inducible, alpha [Xenopus tropicalis] ==========================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TTbA039b13.5.5             TAG---------------------------------------------------------------TGA------------TAG------------------------------------------------------------------------------------ATG------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------ATG---------TAATAA---TAA------------TGA------------------------------------------------------------------TAA---------------------------------TGA---------------ATG------------------------------------------------------------------------------ATG------------------------TGA---TAA------------------------------------------------------------------------TAA------------------------TAA------------------------------ATG---------------------------------ATG------------------------ATG---------------------------------TAA
                                                                   ORF                                                                                                                                                                                     [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
  5   1   1         - Gas                            TGas043c04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGTATGTAGGCTTTTTTTGTTACTTCCCCTTAAAGTCAACTTTAACATTATGGTTGTTACAGTGCACAAATCAAACTTAAAAAAAAAAAAATCAAGGCTGCGTTTACCTTTTTAGATTAAGTTTTAGTAATATATTCTGAGACTATTTGCATTGGCTCTTTATCTGTTATTGTTTGTGGTTTTTGAAGTATTTAGCTGTTTGCtcagctttctggttgctagggtccaatttaccttgacaaccaggcagtggtttgaatgagagactgaaatatgaataggagaaggcatgaatggaatacaaaggtaataaaagcaacaataacattgtaggtttacagagcaatagtgattttggctgctgggatcagtgtcccccaattacaaGATAGCATTTTAAATTGCAAGCTAGAAGAGTAGGAAGGGAAATTAATTGTAAAAAATGAGGAGTATTTGAAAAGTTGGCAAGAATAAGGCATGCTCTGACAAAAAAAAAAGTTAGATCAAAGGTGAATTGCCCCCAC
  5   1   2  SIG                                    Xt7.1-TTbA039b13.5             TAGAGTCAGCAATTGGAGAACACGGGGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACACTTTCCAGGACCAGCTTCTGCCATAAAGCAAGGATTTCAATAGCTTGTATACAACATCATGATGGTGGATTTTGGATATGCAGAAGCAGCGCAGAGGTCGCTTAGAAAATGGAGGACTGTTGGTCAAGAAGAACAACTATGCTGAATTGCACATTGCGATGAGTATCAAGAAGGAAGATGAAACATGAAATTAAGGAGGGTTGGAAAATAGTTCAGGCTGCCATTTGAAATGGGAAATATATATTCTGGCTAATGCATTGGGGTTTTAATTTTGTTCTAAATTCATAAAATGTTAAATTATTGTTTATTTATGCAACTATACTTTAATGTATTCTTTAGGAAACTGGTACACTGACATTTTTATGCATAAAGTTTTTGAGACAAATGAAATGTTTTTAAGTTTTTTTTTTGTTTTTTTTTTACAATAAAGCTTT
                                                  Xt7.1-CHK-1008285064                   CAGCAATTGGAGAACACGGGGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACACTTTCCAGGACCAGCTTCTGCCATAAAGCAAGGATTTCAATAGCTTGTATACAACATCATGATGGTGGATTTTGGATATGCAGAAGCAGCGCAGAGGTCGCTTAGAAAATGGAGGACTGTTGGTCAAGAAGAAGAACTATGCTGAATTGCACxxxxCxATGAGTATCAAGxAxGAxGATGAAACATGAAATTAAGGAGGGTTGGAAAATAGTTCAGGCTGCCATTTGAAATGGGAAATATATATTCTGGCTAATGCATTGGGGTTTTAATTTTGTTCTAAATTCATAAAATGTTAAATTATTGTTTATTTATGCAACTATACTTTAATGTATTCTTTAGGAAACTGGTACACTGACATTTTTATGCATAAAGTTTTTGAGACAAATGAAATGTTTxxxxxTTTTTTTTTTGTTTTTTTTTTACAATAAAGCTTTTTGAAT
  0   1   1           Neu  FL                     TNeu003a20.FL-Sanger                                              CGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAAAAAAAAAAAAAAAAAA
  0   1   1           Int1 FL                          CAAP1754.FL-MGC                                                                        CGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACACTTTCCAGGACCAGCTTCTGCCATAAAGCAAGGATTTCAATAGCTTGTATACAACATCATGATGGTGGATTTTGGATATGCAGAAGCAGCGCAGAGGTCGCTTAGAAAATGGAGGACTGTTGGTCAAGAAGAACTATGCTGAATTGCACATTGCGCCAATGAGTATCAAGGAAGATGAAACATGAAATTAAGGAGGGTTGGAAAATAGTTCAGGCTGCCATTTGAAATGGGAAATATATATTCTGGCTAATGCATTGGGGTTTTAATTTTGTTCTAAATTCATAAAATGTTAAATTATTGTTTATTTATGCAACTATACTTTAATGTATTCTTTAGGAAACTGGTACACTGACATTTTTATGCATAAAGTTTTTGAGACAAATGAAATGTTTTTAAGTTTTTTTTTTTTTGTTTTTTTTACAATAAAGCTTTTTGAATTGAAAAAAAAAAAAAAAAAA
  5   1   2       ext HeRe 5g3  in                     EC2CAA37BF04.g1 GGGCAGAGTGAGTAGAGTCAGCAATTGGGGAACACGGGGCAGCGGCGCGCTACTGTATCAGCCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAACATCCACTACAAATCTGCAGCGCGACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTAAAGTGAATT
  5   1   3        nb 1030 5g                         IMAGE:7029645.5p GAGCAGAGTGTGTAGAGTCAGCAATTGGAGAACACGGGGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAG
  3   1   2       ext Gas7 5g3  in                         XZG46843.3p   CCACGCGTCCGAGAGTCAGCAATTGGAGAACACGGGGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTG
  5   1   3   30   nb Te1  5x3                            CBWN14066.b1 ..GCAGAGTGTGTAGAGTCAGCAATTGGAGAACACGGGGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTA
  5   1   3   32   nb Gas7 5g                              XZG17100.5p .............AGAGTCAGCAATTGGAGAACACGGGGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATTGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAAAAGG
  5   1   2   12  ext Gas7 5g3  in                         XZG46843.5p .............AGAGTCAGCAATTGGAGAACACGGGGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAAAAGG
  5   1   3        nb Gas  5g                        TGas133i13.p1kSP6                 CCCGGGCAATTGGAGAAACGGGGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCT
  3   1   3        nb Gas  5g3  in                    TGas143e09.q1kT7                 TCAGCAATTGGAGAACATCGGGGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATAGGCAGGGATACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAATGTTGTGCTCTGTTATGTTGGCTACTGCCGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGGTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGTTGAGATCATGGGCGGCTCTGACAAGCCTGGGGAACATGCTGATATGCATTGTATTATAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGAGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGAAGGGTGACACTGTGATTAATCCTGCACAGAAGCAGATGATATAAGATATGCGCGCAACTCCTTAATAAATTTTACACTGCAGTTTAA
  5   1   3   32   nb Tad5 5g                              XZT67129.5p ................GTCAGCAATTGGAGAACACGGGGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACACTTTCCAGGACCAGCTTCTGCCATAAAGC
  5   1   3   30   nb Spl2 5x3                            CBSS5299.fwd ................GTCAGCAATTGGAGAACACGGGGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACACTTTCCAGGACCAGCTTCTGCCATAAAGC
  5   1   3   30   nb Tbd1 5x3                            CBXT20389.b1 ................GTCAGCAATTGGAGAACACGGGGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACACTTTCCAGGACCAGCTTCTGCCATAAAGCAAGGATTTCAATAGCTTGTATACAACATCATGATGGTGGATTTTGGATATGCAGAAGCA
  5   1   3        nb Gas  5g3  in                   TGas143e09.p1kSP6                  TCGCAATTGGAGAACACGGGGCAGCGGCGCGCTACTGTATCAAGCAGCATTTCCGAGAACTGAAGTGATACTTTCTAGTTCCCACTGAACAGCCTTGCTGGCCGCGAAATCCACTACAAATCTGCATCGCTACAGATCAATGCAACCCATACAGCAATATAATATGACTCTGGAGGAGCAACTGTCTGGGGATCACAACATTGGAAACATGGAGTCAGTGGGAAACTCACTGGACGAAGTGCTCTGCAACGTCAAACTGCAGATGACCATCACTATTGGGGTGTACGAAGCTGCGAAACTTCTCAATGTGGACCCAAACAACCTTGAGCTCTGTTTGATGGCTACTGACCATACCTACAATATGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCTACATCCTGAGAGAGAGCAACATGAGCCGGCTACCTGACATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAACCCACGTGAATTACATGTGAAGGATCCTGCT
  5   1   4      seed TbA  5g3  in                   TTbA035b15.p1kSP6                  TCAGCAATTGGAGAACACGGGGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAATTACTNTTCAAGAAGAGAAGTAAAAACACTTTCCCAGGACCAGCTTCTGCCATAAAGCAAGGATTTCAATAGCTT
  5   1   3        nb Neu  5g                        TNeu018c22.p1kSP6                   CAGCAATTGGAGAACACGGGGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCT
  5   1   2       add TpA  5x   in                   TTpA050o02.p1kSP6                   CAGCAATTGGAGAACACGGGGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGTAAGATCTCTTGCGCCACAGAGCGGGTTATAGTGCGGATGGGGCAGTCTGTGTTCGTGCGGATGGGGCAGTCTGTGTTCGTGTGTTGCTGCTGTTGCGAGGACTTGCCTGGGTCAGAAAGGGGTTTGTGGGGTCAGCCAAAAGCATTGCGCAAAATGGTAGTTTGGTGTGAACAGATGCCTTCCATGCACCCATCTGCGCTGTGGGCACTTGCACCTCCTCTTGGGGTCGGTGGGTGCTACATCACAACGGCCCATGTAATCATTTTGTTACAACGACCAATAGCATAGCCGCCCCGGTTGCCCCTTACTGCAGCAGGGATCATTTTGTCATGAGGTGCATTCGCCCTATGGCCCCTTGCCCCTGGGCTTCTGTTCCTTTTAAACTGTGGCCTTCCTGCTTGTATAGGACTTCAGCTCCCAGCATCCAGCACAGCCCAGTGCTCCTTAGTGGCTTCTGCAATGGCCTTTCAAATGGCTCACTTTGGGACTGAGTTTTTGTTCAAAAGTGTAAATCTGTGATAAATGTACTCTCTGTAAGTAGCTATATGTAATGTGTGTGTGTGTGCACATGTCTGTGCCTGAGAGGTATTCTAAGTGCCTGTTGCTGCAGAACTTACTCAGACATAGTGCCTGACTCATGCATGGTTAGGATGCT
  5   1   3        nb TbA  5g                        TTbA039b13.p1kSP6                   CAGCAATTGGAGAACACGGGGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACACTTTCCAGGACCAGCTTCTGCCATAAAGCAAGGATTTCAATAGCTTGTATACAACATCATGATGGTGGATTTTGGATATGCAGAAGCAGCGCAGAGGTCGCTTAGAAAATGGAGGACTGTTNGGTCAGAAGACTATGCTGAAATGCACATTGCGCCAATGAGTATCAA
  5   1   3        nb Gas  5g                        TGas079d21.p1kSP6                    AGCAATTGGAGAACACGGGGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCG
  3   1   3        nb Gas  5g3  in                   TGas121g02.q1kaT7                    AGCAATTGGAGAACACGGGGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACACTTAAAAAAAAAAAAAAAAA
  5   1   3        nb Gas  5g3  in                   TGas121g02.p1kSP6                     GCAATTGGAGAACACGGGGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTG
  5   1   0       chi Gas  5x                        TGas038e13.p1kSP6                      CAATTGGAGAACACGGGGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGTAAGATCTCTTGCGCCACAGAGCGGGTTATAGTGCGGATGGGGCAGTCTGTGTTCGTGCGGATGGGGCAGTCTGTGTTCGTGTGTTGCTGCTGTTGCGAGGACTTGCCTGGGTCAGAAAGGGGTTTGTGGGGTCAGCCAAAAGCATTGCGCAAAATGGTAGTTTGGTGTGAACAGATGCCTTCCATGCACCCATCTGCGCTGTGGGCACTTGCACCTCCTCTTGGGGTCGGTGGGTGCTACATCACAACGGCCCATGTAATCATTTTGTTACAACGACCAATAGCATAGCCGCCCCGGTTGCCCCTTACTGCAGCAGGGATCATTTTGTCATGAGGTGCATTCGCCCTATGGCCCCTTGCCCCTGGGCTTCTGTTCCTTTTAAACTGTGGCCTTCCTGCTTGTATAGGACTTCAGCTCCCAGCATCCAGCAC
  5   1   3        nb Gas  5g                       TGas089i23.p1kaSP6                      CAATTGGAGAACACGGGGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGA
  3   1   3        nb Gas7 5g3  in                         XZG48605.3p                      CCACGCGTCCGCACGGGGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATT
  3  -1   3        nb Ova1      in                         CABE6778.3p                       GCCTAGTGCGGCCGCACCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACACTTTCCAGGACCAGCTTCTGCCATAAAGCAAGGATTTCAATAGCTTGTATACAACATCATGATGGTGGATTTTGGATATGCAGAAGCAGCGCAGAGGTCGCTTAGAAAATGGAGGACTGTTGGTCAAGAAGACTATGCTGAATTGCACATTGCGCCCATGAGTATCAGGGAAGATGAAACATG
  5   1   3        nb Gas  5g                        TGas029b08.p1kSP6                            GAGAACACGGGGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTG
  5   1   3   12   nb Gas7 5g3  in                         XZG48605.5p ................................CACGGGGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAAAAAAAAAG
  5   1   3        nb Gas8 5g3  in                          st55m10.5p                                 CACGGGGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAA
  5   1   3        nb Gas8 5x3                              st57k02.5p                                 CACGGGGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATT
  5   1   0       chi Gas7 PIPE                            XZG42242.5p                                     GTCAGCAATTGGAGAACACGGGGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACACTTTCCAGGACCAGCTTCTGCCATAAAGCAAGGA
  5   1   3        nb Neu  5g                        TNeu027d09.p1kSP6                                      GGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCT
  5   1   3        nb Neu  FL                        TNeu003a20.p1kSP6                                                CGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTG
  3  -1   3        nb Fat1      in                         CABC7476.3p                                                CGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACACTTTCCAGGACCAGCTTCTGCCATAAAGCAAGGATTTCAATAGCTTGTATACAACATCATGATGGTGGATTTTGGATATGCAGAAGCAGCGCAGAGGTCGCTTAGAAAATGGAGGACTGTT
  5   1   3        nb Lun1      in                         CABD7711.5p                                                              GCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACACTTTCCAGGACCAGCTTCTGCCATAAAGCAAGGATTTCAATAGCTTGTATACAACATCATGATGGTGGATTTTGGATATGCAGAAGCAGCGCAGAGGTCGCTT
  5   1   3        nb Int1 FL   in                         CAAP1754.5p                                                                        CGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACACTTTCCAGGACCAGCTTCTGCCATAAAGCAAGGATTTCAATAGCTTGTATACAACATCATGATGGTGGATTTTGGATATGCAGAAGCAGCGCAGAGGTCGCTTAGAAAATGGAGGACTGTTGGTCA
  5   1   3        nb Gas8 5x3                              st58k02.5p                                                                           GAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAG
  5   1   3        nb Lun1      in                         CABD5054.5p                                                                                                  TCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACACTTTCCAGGACCAGCTTCTGCCATAAAGCAAGGATTTCAATAGCTTGTATACAACATCATGATGGTGGATTTTGGATATGCAGAAGCAGCGCAGAGGTCGCTTAGAAAATGGAGGACTGTTGGTCAAGAAGAACTATGCTGAATTGCACATTGCGCCAATGAGTATC
  5   1   0       chi Gas       in                   TGas064b10.p1cSP6                                                                                                             CGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATT
  3   1   0       chi Gas       in                    TGas064b10.q1kT7                                                                                                             CGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACAGAGCATTGGAAAGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATANATTTTAACTGCAGTTTAAGTGAATAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas8 5g3  in                          st55m10.3p                                                                                                                              ATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCNGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGNAAAGATGGAGTCAGTGGGAATCGCANTGGAGGAAGTGCTCTGCANGNCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACNTACGATCAGGATATCGCTTTACAGATCCACTTCACCNTGATCCAGGCATTTTGNTGTGAGAATGACATCAACNTCCTGAGAGTGAGCANCATGAGCCGGCTAGCTGNGATCCTGGGCGNCTGTGACAA
  5  -1   3        nb Ova1      in                         CABE6778.5p                                                                                                                                                                                                                                 GATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACACTTTCCAGGACCAGCTTCTGCCATAAAGCAAGGATTTCAATAGCTTGTATACAACATCATGATGGTGGATTTTGGATATGCAGAAGCAGCGCAGAGGTCGCTTAGAAAATGGAGGACTGTTGGTCAAGAAGAACTATGCTGAATTGCACATTGCGCCAATGAGTATCAAGGAAGATGAAACATGAAATTAAGGAGGGTTGGAAAATAGTTCAGGCTGCCATTTGAAATGGGAAATATATATTCTGGCTAATGCATTGGGGTTTTAATTTTGTTCTAAATTCATAAAATGTTAAATTATTGTTTATTTATGCAACTATACTTTAATGTATTCTTTAGGAAACTGGTACACTGACATTTTTATG
  5   1   3        nb Neu                            TNeu023p11.p1kSP6                                                                                                                                                                                                                                    GAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACACTTTCCAGGACCAGCTTCTGCCATAAAGCAAGGATTTCAATAGCTTGTATACAACATCATGATGGTGGATTTTGGATATGCAGAAGCAGCGCAGAGGTCGCTTAGAAAATGGAGGACTGTTGGTCAAGAAGAACTATGCTGAATTGCACATTGCGCCAATG
  3   1   2       ext HeRe 5g3  in                     EC2CAA37BF04.b1                                                                                                                                                                                                                                                AAACGCACTGGAGGAAGTGTTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTATGAAGCTGCAAAACTTCTCAATGTGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCATGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCATAATAATTTT
  5   1   2       add Gas       out                  TGas051j10.p1cSP6                                                                                                                                                                                                                                                                                           GAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAATTTTCTCAGGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACACTTTCCAGGACCAGCTTCTGCCATAAAGCAAGGATTTCAATAGCTTGTATACAACATCATGATGGTGGATTTTGGATATGCAGAAGCAGCGCAGAGGTCGCTTAGAAAATGGAGGACTGTTGGTCAAG
  3   1   0       add TpA  5x   in                    TTpA050o02.q1kT7                                                                                                                                                                                                                                                                                                      AGTCTGTGTTCGTGTGTTGCTGCTGTTGCGAGGACTTGCCTGGGTCAGAAAGGGGTTTGTGGGGTCAGCCAAAAGCATTGCGCAAAATGGTAGTTTGGTGTGAACAGATGCCTTCCATGCACCCATCTGCGCTGTGGGCACTTGCACCTCCTCTTGGGGTCGGTGGGTGCTACATCACAACGGCCCATGTAATCATTTTGTTACAACGACCAATAGCATAGCCGCCCCGGTTGCCCCTTACTGCAGCAGGGATCATTTTGTCATGAGGTGCATTCGCCCTATGGCCCCTTGCCCCTGGGCTTCTGTTCCTTTTAAACTGTGGCCTTCCTGCTTGTATAGGACTTCAGCTCCCAGCATCCAGCACAGCCCAGTGCTCCTTAGTGGCTTCTGCAATGGCCTTTCAAATGGCTCACTTTGGGACTGAGTTTTTGTTCAAAAGTGTAAATCTGTGATAAATGTACTCTCTGTAAGTAGCTATATGTAATGTGTGTGTGTGTGCACATGTCTGTGCCTGAGAGGTATTCTAAGTGCCTGTTGCTGCAGAACTTACTCAGACATAGTGCCTGACTCATGCATGGTTAGGATGCTGTTGGGAATAGCTCAGGAGTCACATTTGCATGCTTTGCTCAGATGCTCATGAGTGTTTCTTGTGTTATTCTGCAGGATGGAGTCAGTGGGAAACGCACTGGAGGAAGTGCTCTGCAAGGCCAAACTGCAGAGGACCATCACTATTGGGGTGTACGAAGCTGCAAAACTTCTCAATGTGTATGTAGGCTTTTTTTGTTACTTCCCCTTAAAGTCAACTTTAACATTATGGTTGTCACAGTGCACAAATCAAACTTAAAAAAAAAAAAAAAA
  5   1   0       add Gas8      out                         st25i17.5p                                                                                                                                                                                                                                                                                                               TCGTGTGTTGCTGCTGTTGCGAGGACTTGCCTGGGTCAGAAAGGGGTTTGTGGGGTCAGCCAAAAGCATTGCGCAAAGTGGTAGTTTGGTGTGAACAGATGCCTTCCATGCACCCATCTGCGCTGTGGGCACTTGCACCTCCTCTTGGGGTCGGTGGGTGCTACATCACAACGGCCCATGTAATCATTTTGTTACAACGACCAATAGCATAGCCGCCCCGGTTGCCCCTTACTGCAGCAGGGATCATTTTGTCATGAGGTGCATTCGCCCTATGGCCCCTTGCCCCTGGGCTTCTGTTCCTTTTAAACTGTGGCCTTCCTGCTTGTATAGGACTTCAGCTCCCAGCATCCAGCACAGCCCAGTGCTCCTTAGTGGCTTCTGCAATGGCCTTTCAAATGGCTCACTTTGGGACTGAGTTTTTGTTCAAAAGTGTAAATCTGTGATAAATGTACTCTCTGTAAGTAGCTATATGTAATGTGTGTGTGTGTGTGTGTGTGTGCACATGTCTGTGCCNGAGAGGTATTCTAAGTGCCTGTTGCTGCANAACTTACTCANACATAGTGCCTGACTCATGCATGGTTAAGATGCTGTT
  5   1   0       chi Neu                            TNeu015k20.p1kSP6                                                                                                                                                                                                                                                                                                                          CTTGTTTTCTCAGGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACGTAGGTAACACTCTCATGTGGAGTCTGCCAGGAGGGGCTTGGGTGGGTTCTGCTGTTTGCATACCAAGACAATAACGAGGGGCTTTGTAAATGGGATACTGTCACTCCTTTAAATTTACCCTGCTTATTGTTATTTGAATGCTGAATAACTGATTGTTTAGTAATACCATAGTGCTATGTTGGTCATTACATTCCCAGGTAAATAGTCATGCTTCCTCCTATTATGGTGAACTGCTGCACGGAGAAAAGTAAACACCATATCCAAATGCATTTATAATTATAGGTTACTTTCCATTTGTTCCCCGTAAAGTATGAGGGCATAGCTTATATGCACAGAATGTTCCTTCTCTGCATACTTCTCATAAGTACAAGCGGGAGCAGTCCCAGTTTCTAGCTCAGTGAATGCAGTGTGTACAGGATGTTGTTGCATTGCTCCTGTTGCCTCTGGGGAG
  3   1   3        nb Lun1      in                         CABD7711.3p                                                                                                                                                                                                                                                                                                                                           CCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACACTTTCCAGGACCAGCTTCTGCCATAAAGCAAGGATTTCAATAGCTTGTATACAACATCATGATGGTGGATTTTGGATATGCAGAAGCAGCGCAGAGGTCGCTTAGAAAATGGAGGACTGTTGGTCAAGAAGAACTATGCTGAATTGCACATTGCGCCAATGAGTATCAAGGAAGATGAAACATGAAATTAAGGAGGGTTGGAAAATAGTTCAGGCTGCCATTTGAAATGGGAAATATATATTCTGGCTAATGCATTGGGGTTTTAATTTTGTTCTAAATTCATAAAATGTTAAATTATTGTTTATTTATGCAACTATACTTTAATGTATTCTTTAGGAAACTGGTACACTGACATTTTTATGCATAAAGTTTTTGAGACAAATGAAATGTTTTTAAGTTTTTTTTTTTTTGTTTTTTTTTTACAATAAAGCTTTTTGAATTGAAC
  3   1   4      seed TbA  5g3  in                    TTbA035b15.q1kT7                                                                                                                                                                                                                                                                                                                                                              GTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTTTGACAAGCCTGGGGAACCTGCTGATTTGCATTGTATTTTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACACTTTCCAGGACCAGCTTTTGCCATAAAGCAAGGATTTCAATAGCTTGTATACAACATCATGATGGTGGATTTTGGATATGCAGAAGCAGCGCAGAGGTCGCTTAGAAAATGGAGGACTGTTGGTCAAGAAGAACTATGCTGAATTGCACATTGCGCCCATGAGTATCCAGGAAGATGAAACCTGAAATTAAGGAGGGTTGGAAAATAGTTCAGGCTGCCCTTTGAAATGGGAAATATATATTTTGGCTAATGCCTTGGGGTTTTAATTTTGTTCTAAATTCATAAAAAGTTAAATTATTGTTTATTTATGCAACTATACTTTAATGTATTCTTTAGGAAACTGGTACACTGACCTTTTTATGCATAAAGTTTTTGAGACAAAATGAAAAGTTTTTAAGTTTTTTTTTTTTTGTTTTTTTTTTACAATAAAGCTTTTTGAATGAAAAAAAAAAAAAAAAA
  5   1   3        nb Gas7                                 XZG48603.5p                                                                                                                                                                                                                                                                                                                                                               CCTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGCGTGCCTGTGATTAACCTGCCATAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAAAAAAAAAG
  3   1   3        nb Lun1      in                         CABD5054.3p                                                                                                                                                                                                                                                                                                                                                                      GCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACACTTTCCAGGACCAGCTTCTGCCATAAAGCAAGGATTTCAATAGCTTGTATACAACATCATGATGGTGGATTTTGGATATGCAGAAGCAGCGCAGAGGTCGCTTAGAAAATGGAGGACTGTTGGTCAAGAAGAACTATGCTGAATTGCACATTGCGCCAATGAGTATCAAGGAAGATGAAACATGAAATTAAGGAGGGTTGGAAAATAGTTCAGGCTGCCATTTGAAATGGGAAATATATATTCTGGCTAATGCATTGGGGTTTTAATTTTGTTCTAAATTCATAAAATGTTAAATTATTGTTTATTTATGCAACTATACTTTAATGTATTCTTTAGGAAACTGGTACACTGACATTTTTATGCATAAAGTTTTTGAGACAAATGAAATGTTTTTAAGTTTTTTTTTTTTGTTTTTTTTTTACAATAAAGCTTTTTGAATTGA
  5  -1   3        nb Fat1      in                         CABC7476.5p                                                                                                                                                                                                                                                                                                                                                                        GGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACACTTTCCAGGACCAGCTTCTGCCATAAAGCAAGGATTTCAATAGCTTGTATACAACATCATGATGGTGGATTTTGGATATGCAGAAGCAGCGCAGAGGTCGCTTAGAAAATGGAGGACTGTTGGTCAAGAAGAACTATGCTGAATTGCACATTGCGCCAATGAGTATCAAGGAAGATGAAACATGAAATTAAGGAGGGTTGGAAAATAGTTCAGGCTGCCATTTGAAATGGGAAATATATATTCTGGCTAATGCATTGGGGTTTTAATTTTGTTCTAAATTCATAAAATGTTAAATTATTGTTTATTTATGCAACTATACTTTAATGTATTCTTTAGGAAACTGGTACACTGACATTTTTATGCATAAAGTTTTTGAGACAAATGAAATGTTTTTAAGTTTTTTTTTTTTTGTTTTTTTTTTACAATAAAGCTTTTTGAATTGAAACCTG
  5   1   3        nb Gas7      in                         XZG31205.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTTAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACACTTTCCAGGACCAGCTTCTGCCATAAAGCAAGGATTTCAATAGCTTGTATACAACATCATGATGGTGGATTTTGGATATGCAGAAGCAGCGCAGAGGTCGCTTAGAAAATGGAGGACTGTTGGTCAAGAAGAACTATGCTGAATTGCACATTGCGCCAATGAGTATCAAGGAAGATGAAACATGAAATTAAGGAGGGTTGGAAAATAGTTCAGGCTGCCATTTGAAATGGGAAATATATATTCTGGCTAATGCATTGGGGTTTTAATTTTGTTCTAAATTCATAAAATGTTAAATTATTGTTTATTTATGCAACTATACTTTAATGTATTCTTTAGGAAACTGGTACACTGACATTTTTATGCATAAAGTTTTTGAGACAAATGAAATGTTTTTAAGTTTTTTTTTTTTGTTTTTTTTTTACAATAAAGCTTTTTGAAT
  3   1   3        nb Int1 FL   in                         CAAP1754.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACACTTTCCAGGACCAGCTTCTGCCATAAAGCAAGGATTTCAATAGCTTGTATACAACATCATGATGGTGGATTTTGGATATGCAGAAGCAGCGCAGAGGTCGCTTAGAAAATGGAGGACTGTTGGTCAAGAAGAACTATGCTGAATTGCACATTGCGCCAATGAGTATCAAGGAAGATGAAACATGAAATTAAGGAGGGTTGGAAAATAGTTCAGGCTGCCATTTGAAATGGGAAATATATATTCTGGCTAATGCATTGGGGTTTTAATTTTGTTCTAAATTCATAAAATGTTAAATTATTGTTTATTTATGCAACTATACTTTAATGTATTCTTTAGGAAACTGGTACACTGACATTTTTATGCATAAAGTTTTTGAGACAAATGAAATGTTTTTAAGTTTTTTTTTTTTTGTTTTTTTTACAATAAAGCTTTTTGAATTG
  3   1   3        nb Gas7      in                         XZG37194.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCACGCGTCCGGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACACTTTCCAGGACCAGCTTCTGCCATAAAGCAAGGATTTCAATAGCTTGTATACAACATCATGATGGTGGATTTTGGATATGCAGAAGCAGCGCAGAGGTCGCTTAGAAAATGGAGGACTGTTGGTCAAGAAGAACTATGCTGAATTGCACATTGCGCCAATGAGTATCAAGGAAGATGAAACATGAAATTAAGGAGGGTTGGAAAATAGTTCAGGCTGCCATTTGAAATGGGAAATATATATTCTGTTAATGCATTGGGGTTTTAATTTTGTTCTAAATTCATAAAATGTTAAATTATTGTTTATTTATGCAACTATACTTTAATGTATTCTTTAGGAAACTGGTACACTGACATTTTTATGCATAAAGTTTTTGAGACAAATGAAATGTTTTTAAGTTTTTTTTTTGTTTTTTTTTTACAATAAAGCTTTTTGAATTGAAAAAAAAAAAAAAAAGG
  5   1   3        nb Gas7      in                         XZG37194.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACACTTTCCAGGACCAGCTTCTGCCATAAAGCAAGGATTTCAATAGCTTGTATACAACATCATGATGGTGGATTTTGGATATGCAGAAGCAGCGCAGAGGTCGCTTAGAAAATGGAGGACTGTTGGTCAAGAAGAACTATGCTGAATTGCACATTGCGCCAATGAGTATCAAGGAAGATGAAACATGAAATTAAGGAGGGTTGGAAAATAGTTCAGGCTGCCATTTGAAATGGGAAATATATATTCTGTTAATGCATTGGGGTTTTAATTTTGTTCTAAATTCATAAAATGTTAAATTATTGTTTATTTATGCAACTATACTTTAATGTATTCTTTAGGAAACTGGTACACTGACATTTTTATGCATAAAGTTTTTGAGACAAATGAAATGTTTTTAAGTTTTTTTTTTGTTTTTTTTTTACAATAAAGCTTTTTGAATTGAAAAAAAAAAAAAAAAGG
  3   1   3        nb Gas7      out                        XZG56543.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAATTTCAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTTCCTGGACCAGTGGGTGCCTGTGATTTACCTGCCAGAGCGATGATTAAGTTTGGCGCCCTCCTAATAATTTTAACCGCAGTTTAAGGGAATTAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACACTTTCCAGGACCAGCTTTTGCCATAAAGCAAGGATTTCAATAGCTTGTATACAACATCATGATGGGGGATTTTGGATATGCAGAAGCAGCGCAGAGGTCGCTTAGAAAATGGAGGACTGTTGGTCAAGAAGAACTATGCTGAATTGCCCATTGCGCCAATGGGTTTCAAGGAAGGTGAAACCTGAAATTTAGGAGGGTTGGAAAATAGTTCAGGCTGCCCTTTGAAATGGGAAATATATTTTCTGGCTAATGCATTGGGGTTTTAATTTTGTTCTAAATTCATAAAATGTTAAATTATTGTTTATTTATGCAACTATACTTTAATGTATTCTTTAGGAAACTGGTACCCTGACATTTTTATGCATAAAGTTTTTGAGACAAATGAAAAGTTTTTAAGTTTTTTTTTTTGTTTTTTTTTTACAATAAAGCTTTTTGGGTTGG
  5   1   3        nb Gas7                                    XZG63.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTGCTCTCAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACACTTTCCAGGACCAGCTTCTGCCATAAAGCAAGGATTTCAATAGCTTGTATACAACATCATGATGGTGTATTTTGGATATGCAGAAGCAGCGCAGAGGTCGCTTAGAAAATGGAGGACTGTTGGTCAAGAAGAACTATGCTGAATTGCACATTGCGCCAATGAGTATCAAGGAAGATGAAACATGAAATTAAGGAGGGTTGGAAAATAGTTCAGGCTGCCATTTGAAATGGGAAATATATATTCTGGCTAATGCATTGGGGTTTTAATTTTGTTCTAAATTCATAAAATGTTAAATTATTGTTTATTTATGCAACTATACTTTAATGTATTCTTTAGGAAACTGGTACACTGACATTTTTATGCATAAAGTTTTTGAGACAAATGAAATGTTTTTAAGTTTTTTTTTTTTGTTTTTTTTTTACAATAAAGCTTTTTGAATTGGAGCNCA
  3   1   3        nb Gas7      in                         XZG31205.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCCCCCCTAATAATTTTAACCGCCGTTTAAGGGAATTAAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACCCTTTCCAGGACCAGCTTTTGCCATAAAGCAAGGATTTCAATAGCTTGTATACAACATCATGATGGGGGATTTTGGATATGCAGAAGCAGCGCAGAGGTCGCTTAGAAAATGGAGGACTGTTGGTCAAGAAGAACTATGCTGAATTGCCCCTTGCGCCCATGGGTTTCAAGGAAGGTGAAACCTGAAATTAAGGGGGGTTGGAAAATAGTTCAGGCTGCCCTTTGAAATGGGAAATATATATTCTGGCTAATGCCTTGGGGTTTTAATTTTGTTCTAAATTCATAAAATGTTAAATTATTGTTTATTTATGCAACTATACTTTAATGTATTCTTTAGGAAACTGGTACCCTGCCCTTTTTATGCATAAAGTTTTTGAGACAAATGAAATGTTTTTAAGTTTTTTTTTTTTGTTTTTTTTTTCCAATAAAGCTTTTTGAATTGG
  5   1   3        nb Neu                            TNeu100o03.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACACTTTCCAGGACCAGCTTCTGCCATAAAGCAAGGATTTCAATAGCTTGTATACAACATCATGATGGTGGATTTTGGATATGCAGAAGCAGCGCAGAGGTCGCTTAGAAAATGGAGGACTGTTGGTCAAGAAGAACTATGCTGAATTGCACATTGCGCCAATGAGTATCAAGGAAGATGAAACATGAAATTAAGGAGGGTTGGAAAATAGTTCAGGCTGCCATTTGAAATGGGAAATATATATTCTGGCTAATGCATTGGGGTTTTAATTTTGTTCTAAATTCATAAAATGTTAAATTATTGTTTATTTATGCAACTATACTTTAATGTATTCTTTAGGAAACTGGTACACTGACATTTTTATGCATAAAGTTTTTGAGACAAATGAAAACCCGGGGATTCCCCGG
  3   1   3        nb Gas       ?                     TGas068a09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGAAAAGTAAAAACACTTTCCAGGACCAGCTTCTGCCATAAAGCAAGGATTTCAATAGCTTGTATACAACATCATGATGGTGGATTTTGGATATGCAGAAGCAGCGCAGAGGTCGCTTAGAAAATGGAGGACTGTTGGTCAAGAAGAACTATGCTGAATTGCACATTGCGCCAATGAGTATCAAGGAAGATGAAACATGAAATTAAGGAGGGTTGGAAAATAGTTCAGGCTGCCATTTGAAATGGGAAATATATATTCTGGCTAATGCATTGGGGTTTTAATTTTGTTCTAAATTCATAAAATGTTAAATTATTGTTTATTTATGCAACTATACTTTAATGTATTCTTTAGGAAACTGGTACACTGACATTTTTATGCATAAAGTTTTGAGACAAATAAAAAAAAAAAAAAAAAA
  3   1   3        nb Eye                                  CCAX1664.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGTCGCTTAGAAAATGGAGGACTGTTGGTCAAGAAGAACTATGCTGAATTGCACATTGCGCCAATGAGTTTCAAGGAAGATGAAACATGAAATTAAGGAGGGTTGGAAAATAGTTCAGGCTGCCATTTGAAATGGGAAATATATATTTTGGCTAATGCATTGGGGTTTTAATTTTGTTCTAAATTCATAAAATGTTAAATTATTGTTTATTTATGCAACTATACTTTAATGTATTTTTTAGGAAACTGGTACACTGACATTTTTATGCATAAAGTTTTTGAGACAAATGAAATGTTTTTAAGTTTTTTTTTTTTGTTTTTTTTTTACAATAAAGCTTTTTGAATTG
  5   1   2  SIG                                      Xt7.1-XZG57742.5                                                                                                         CCACGCGTCCGAGAGTCAGCAATTGGAGAACACGGGGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACACTTTCCAGGACCAGCTTTTGCCATAAAGCAAGGATTTCAATAGCTTGTATACAACATCATGATGGTGGATTTTGGATATGCAGAAGCAGCGCAGAGGTCGCTTAGAAAATGGAGGACTGTTGGTCAAGAAGAACTATGCTGAATTGCACATTGCGCCAATGAGTATCAAGGAAGATGAAACATGAAATTAAGGAGGGTTGGAAAATAGTTCAGGCTGCCATTTGAAATGGGAAATATATATTCTGGCTAATGCATTGGGGTTTTAATTTTGTTCTAAATTCATAAAATGTTAAATTATTGTTTATTTATGCAACTATACTTTAATGTATTCTTTAGGAAACTGGTACACTGACATTTTTATGCATAAAGTTTTTGAGACAAATGAAATGTTTTTAAGTTTTTTTTTTTTGTTTTTTTTTTACAATAAAGCTTTTTGAATTGAATAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008285062                                                                                                               GTCCGAGAGTCAGCAATTGGAGAACACGGGGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACACTTTCCAGGACCAGCTTTTGCCATAAAGCAAGGATTTCAATAGCTTGTATACAACATCATGATGGTGGATTTTGGATATGCAGAAGCAGCGCAGAGGTCGCTTAGAAAATGGAGGACTGTTGGTCAAGAAGAACTATGCTGAATTGCACATTGCGCCAATGAGTATCAAGGAAGATGAAACATGAAATTAAGGAGGGTTGGAAAATAGTTCAGGCTGCCATTTGAAATGGGAAATATATATTCTGGCTAATGCATTGGGGTTTTAATTTTGTTCTAAATTCATAAAATGTTAAATTATTGTTTATTTATGCAACTATACTTTAATGTATTCTTTAGGAAACTGGTACACTGACATTTTTATGCATAAAGTTTTTGAGACAAATGAAATGTTTTTAAGTTTTTTTTTTTTGTTTTTTTTTTACAATAAAGCTTTTTGAATTGAATAAAAAAAAAAAAAA
  3   1   2       ext Gas7 5g3  in                         XZG57742.3p                                                                                                         CCACGCGTCCGAGAGTCAGCAATTGGAGAACACGGGGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTG
  5   1   2   12  ext Gas7 5g3  in                         XZG57742.5p ...................................................................................................................AGAGTCAGCAATTGGAGAACACGGGGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAAAAAGG
  5   1   4      seed Gas  5g3  in                   TGas070n04.p1cSP6                                                                                                                                         CGGGGCAGCGGCGCGCTACTGTATCAGGCAGCAGTTCCGAGAACTGAGGTGAAACTTTCTAGTTCCCAGGAAGAGCCTTGCTGGCCGCAAAATCCACTACAAATCTGCAGCGCTACGGAGCAGTGCAACCCGTACAGCAATATAATATGACTCTGGAGGAGCAGCTGTCTGGGGATCAGAGCATTGGAAAGGACCCAGACAACGTTGTGCTCTGTTTGTTGGCTACTGACGATACCTACGATCAGGATATCGCTTTACAGATCCACTTCACCCTGATCCAGGCATTTTGCTGTGAGAATGACATCAACATCCTGAGAGTGAGCAACATGAGCCGGCTAGCTGAGATCCTGGGCGGCTCTGACAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACACT
  3   1   4      seed Gas  5g3  in                    TGas070n04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAAGCCTGGGGAACCTGCTGATCTGCATTGTATTCTAATCAACAGCCCACATGAATTACAGGTGAAGGATCCTGCTCTCAAAGAAGTGATTTGTTACTGCAAAGAGAGTCGTTACCTGGACCAGTGGGTGCCTGTGATTAACCTGCCAGAGCGATGATTAAGTATGGCGCACTCCTAATAATTTTAACTGCAGTTTAAGTGAATTAAAAAAAAAAAAATTACTTTCAAGAAGAAAAGTAAAAACACTTTCCAGGACCAGCTTTTGCCATAAAGCAAGGATTTCAATAGCTTGTATACAACATCATGATGGTGGATTTTGGATATGCAGAAGCAGCGCAGAGGTCGCTTAGAAAATGGAGGACTGTTGGTCAAGAAGAACTATGCTGAATTGCACATTGCGCCAATGAGTATCAAGGAAGATGAAACATGAAATTAAGGAGGGTTGGAAAATAGTTCAGGCTGCCATTTGAAATGGGAAATATATATTCTGGCTAATGCATTGGGGTTTTAATTTTGTTCTAAATTCATAAAATGTTAAATTATTGTTTATTTATGCAACTATACTTTAATGTATTCTTTAGGAAACTGGTACACTGACATTTTTATGCATAAAGTTTTTGAGACAAATGAAATGTTTTTAAGTTTTTTTTTTTTGTTTTTTTTTTACAATAAAGCTTTTTGAATTGAATAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)